ID: 1140758810

View in Genome Browser
Species Human (GRCh38)
Location 16:78092603-78092625
Sequence GCAGCAATTATTCTTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140758808_1140758810 -5 Left 1140758808 16:78092585-78092607 CCTCTGCAGGGTTTTCCTGCAGC No data
Right 1140758810 16:78092603-78092625 GCAGCAATTATTCTTTCTCCAGG No data
1140758805_1140758810 3 Left 1140758805 16:78092577-78092599 CCCCATGACCTCTGCAGGGTTTT No data
Right 1140758810 16:78092603-78092625 GCAGCAATTATTCTTTCTCCAGG No data
1140758806_1140758810 2 Left 1140758806 16:78092578-78092600 CCCATGACCTCTGCAGGGTTTTC No data
Right 1140758810 16:78092603-78092625 GCAGCAATTATTCTTTCTCCAGG No data
1140758807_1140758810 1 Left 1140758807 16:78092579-78092601 CCATGACCTCTGCAGGGTTTTCC No data
Right 1140758810 16:78092603-78092625 GCAGCAATTATTCTTTCTCCAGG No data
1140758802_1140758810 17 Left 1140758802 16:78092563-78092585 CCAGCTATTCTTCTCCCCATGAC No data
Right 1140758810 16:78092603-78092625 GCAGCAATTATTCTTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140758810 Original CRISPR GCAGCAATTATTCTTTCTCC AGG Intergenic
No off target data available for this crispr