ID: 1140758813

View in Genome Browser
Species Human (GRCh38)
Location 16:78092620-78092642
Sequence TCCAGGGTCCAGTCGCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140758808_1140758813 12 Left 1140758808 16:78092585-78092607 CCTCTGCAGGGTTTTCCTGCAGC No data
Right 1140758813 16:78092620-78092642 TCCAGGGTCCAGTCGCCTCAGGG No data
1140758807_1140758813 18 Left 1140758807 16:78092579-78092601 CCATGACCTCTGCAGGGTTTTCC No data
Right 1140758813 16:78092620-78092642 TCCAGGGTCCAGTCGCCTCAGGG No data
1140758805_1140758813 20 Left 1140758805 16:78092577-78092599 CCCCATGACCTCTGCAGGGTTTT No data
Right 1140758813 16:78092620-78092642 TCCAGGGTCCAGTCGCCTCAGGG No data
1140758809_1140758813 -3 Left 1140758809 16:78092600-78092622 CCTGCAGCAATTATTCTTTCTCC No data
Right 1140758813 16:78092620-78092642 TCCAGGGTCCAGTCGCCTCAGGG No data
1140758806_1140758813 19 Left 1140758806 16:78092578-78092600 CCCATGACCTCTGCAGGGTTTTC No data
Right 1140758813 16:78092620-78092642 TCCAGGGTCCAGTCGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140758813 Original CRISPR TCCAGGGTCCAGTCGCCTCA GGG Intergenic
No off target data available for this crispr