ID: 1140761384

View in Genome Browser
Species Human (GRCh38)
Location 16:78112028-78112050
Sequence GGTGGTAGTGGCCCCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140761378_1140761384 -1 Left 1140761378 16:78112006-78112028 CCACTACCGGTCTCCACATCTTG 0: 6
1: 32
2: 127
3: 118
4: 244
Right 1140761384 16:78112028-78112050 GGTGGTAGTGGCCCCCACCCTGG 0: 1
1: 0
2: 0
3: 12
4: 162
1140761377_1140761384 9 Left 1140761377 16:78111996-78112018 CCGTTCGGGGCCACTACCGGTCT 0: 22
1: 38
2: 31
3: 8
4: 26
Right 1140761384 16:78112028-78112050 GGTGGTAGTGGCCCCCACCCTGG 0: 1
1: 0
2: 0
3: 12
4: 162
1140761375_1140761384 13 Left 1140761375 16:78111992-78112014 CCAGCCGTTCGGGGCCACTACCG 0: 11
1: 24
2: 146
3: 192
4: 142
Right 1140761384 16:78112028-78112050 GGTGGTAGTGGCCCCCACCCTGG 0: 1
1: 0
2: 0
3: 12
4: 162
1140761381_1140761384 -7 Left 1140761381 16:78112012-78112034 CCGGTCTCCACATCTTGGTGGTA 0: 9
1: 46
2: 87
3: 115
4: 226
Right 1140761384 16:78112028-78112050 GGTGGTAGTGGCCCCCACCCTGG 0: 1
1: 0
2: 0
3: 12
4: 162
1140761374_1140761384 14 Left 1140761374 16:78111991-78112013 CCCAGCCGTTCGGGGCCACTACC 0: 11
1: 30
2: 40
3: 25
4: 38
Right 1140761384 16:78112028-78112050 GGTGGTAGTGGCCCCCACCCTGG 0: 1
1: 0
2: 0
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140761384 Original CRISPR GGTGGTAGTGGCCCCCACCC TGG Intronic
900466217 1:2826708-2826730 GGTGGACGTGGACCCCACCCTGG - Intergenic
900562369 1:3313650-3313672 GGTGGTTCTGGCCCCCAGGCGGG - Intronic
901460993 1:9391779-9391801 TGATGTTGTGGCCCCCACCCAGG + Intergenic
901494129 1:9611834-9611856 GGTGGTGGTGTCCACCACACAGG - Exonic
901772433 1:11537188-11537210 GGGGTGAGAGGCCCCCACCCTGG - Exonic
903263928 1:22145135-22145157 GGTGAGAGTGGCCCCTGCCCTGG - Intergenic
903280186 1:22245785-22245807 GGCAGGAGTGGCCCTCACCCAGG + Intergenic
904841603 1:33375415-33375437 GGTGGAAGTGGCCGCCCCACCGG - Exonic
905631165 1:39519299-39519321 GGTGGTGGTGGTCACCAGCCCGG - Intronic
905666593 1:39766872-39766894 GGTGGTGGTGGTCACCAGCCCGG + Intronic
907869043 1:58426286-58426308 GGTAGTGTTGGCCTCCACCCTGG + Intronic
908241529 1:62192995-62193017 GATCTTGGTGGCCCCCACCCAGG - Intergenic
912506653 1:110161369-110161391 AGTGGAAGTGGTCCCCACTCAGG - Intronic
920011377 1:202870182-202870204 GGGGTTAGAGGCCCCTACCCAGG - Intergenic
922804242 1:228377436-228377458 GGCCCTGGTGGCCCCCACCCCGG + Intronic
923615093 1:235530728-235530750 GGAGGCAGTGGCCGTCACCCTGG + Intergenic
1063961563 10:11310229-11310251 GTTGGTAGTCTCCCCCTCCCTGG + Intronic
1069710620 10:70486303-70486325 GGTGGTGATGGCGCCAACCCAGG - Intronic
1070279108 10:75036035-75036057 GGTCATAGTGGCCCCAACCTAGG - Intergenic
1070758188 10:79006398-79006420 GGTGGGGCTGGCCCACACCCTGG - Intergenic
1071069986 10:81680610-81680632 TGATTTAGTGGCCCCCACCCAGG - Intergenic
1072615547 10:97046904-97046926 CGTGGGAGCTGCCCCCACCCTGG + Intronic
1072734493 10:97869715-97869737 GGTGGCAGTGGCTGCCAACCGGG - Exonic
1073137900 10:101229828-101229850 GGTGGCAGCGGGGCCCACCCGGG - Intergenic
1076610584 10:131723541-131723563 CCTGGTGGTGGCCCCCACCTGGG + Intergenic
1078068229 11:8091836-8091858 GGTGGTAGTGGTACCCTGCCAGG + Intronic
1078867354 11:15310457-15310479 GGTGCTAGTGGCCCCCAGAGTGG + Intergenic
1080990878 11:37533274-37533296 GGTCTTATTGGACCCCACCCAGG - Intergenic
1081725790 11:45328224-45328246 TGTGGTAATGGCCTCCAGCCTGG + Intergenic
1081978118 11:47248702-47248724 GGTGGTGATGCCGCCCACCCGGG - Exonic
1083096359 11:60255030-60255052 GCTGGTGATGGCCCCTACCCAGG - Intergenic
1083297726 11:61724285-61724307 GGAGGTACTGGGACCCACCCTGG - Intronic
1083396861 11:62398450-62398472 GGTGTGAGTGGCCTCCACCTGGG - Intergenic
1084177953 11:67433257-67433279 GGTGGGAGTAGCCCCCCTCCTGG + Intronic
1084571413 11:69962272-69962294 GGGGGACGTGGCCCCCACTCGGG + Intergenic
1085509751 11:77082294-77082316 GGTGGTCCTGAACCCCACCCAGG + Intronic
1085802154 11:79600632-79600654 GGTGGCCCTGGCCCCTACCCTGG - Intergenic
1088712574 11:112521824-112521846 AGTGGTGGTGTCCCCCACCCAGG - Intergenic
1094484556 12:30914333-30914355 GGTGGTGGTGGTCCCCAGTCTGG + Intergenic
1094847540 12:34367913-34367935 CGAGGAAGTGGTCCCCACCCAGG - Intergenic
1096647464 12:53046695-53046717 GGTGCTAGCGTCCCCTACCCAGG - Intergenic
1097174004 12:57132411-57132433 GGTGGTAGTGGTCCCTATTCTGG + Intronic
1100046169 12:90383395-90383417 GATGGTAGTGGGCCCCAGTCAGG - Intergenic
1102666434 12:114577938-114577960 AGTGGCAGAGGCCTCCACCCAGG + Intergenic
1104363320 12:128153988-128154010 GGTGGCACTGGCCCCCAGACAGG + Intergenic
1105817712 13:24051851-24051873 GGAGGCAGTGGCCGCCAGCCTGG + Intronic
1106912632 13:34479194-34479216 GGTAGTAGTTGCCCCCTCCCAGG + Intergenic
1111312093 13:86502302-86502324 TCTGGTAGTAGCCCACACCCAGG + Intergenic
1111565038 13:90002989-90003011 GCCTGTTGTGGCCCCCACCCAGG - Intergenic
1112080123 13:95959835-95959857 GGTGCTAGTGTACACCACCCTGG + Intronic
1113232297 13:108226237-108226259 GGTGGGAGTGAGCACCACCCTGG + Intronic
1113661516 13:112109263-112109285 GGGGCCAGTGGCCACCACCCCGG - Intergenic
1114535063 14:23417474-23417496 GCTGGCTGCGGCCCCCACCCAGG + Intronic
1119469697 14:74887675-74887697 GGTAGTGGTGGCCACCACTCCGG + Intronic
1122806549 14:104262885-104262907 GGTGTCAGGGCCCCCCACCCTGG + Intergenic
1124636856 15:31371108-31371130 GGTGCCAGAGCCCCCCACCCTGG + Intronic
1126841056 15:52717846-52717868 GTTGGTAGTAGCCCCTATCCAGG - Intergenic
1132275988 15:100564380-100564402 GGTTCTTGTGGCCCCCACCCAGG + Intronic
1134625227 16:15718454-15718476 GAGGGTAGAGGCCCCCACCATGG - Intronic
1136024581 16:27461454-27461476 GGTGGAAGTGCCCTCCAGCCTGG - Exonic
1136074215 16:27805884-27805906 AGTGGTAGGGACCTCCACCCAGG + Intronic
1137584144 16:49654019-49654041 GGTGGTAGTGGTCACCACATAGG - Intronic
1139345957 16:66304050-66304072 GGTGGTCGTGGCTCCAAGCCTGG - Intergenic
1140514607 16:75532946-75532968 GGTGGGAGAGGCCCACAGCCTGG - Intronic
1140761384 16:78112028-78112050 GGTGGTAGTGGCCCCCACCCTGG + Intronic
1140776605 16:78254660-78254682 GGTGGCAGTGGCATGCACCCGGG - Intronic
1141182763 16:81765585-81765607 GGTGCTAGTGCCCTCCAGCCTGG + Intronic
1142248055 16:88978806-88978828 GGTGGTGGCTCCCCCCACCCGGG + Intergenic
1143657104 17:8301596-8301618 TGTTCTTGTGGCCCCCACCCAGG - Intergenic
1144443511 17:15305253-15305275 TGTGGTAAAGGCCCCCACGCAGG + Intronic
1146273163 17:31497743-31497765 GGTGACAGTGGCCCCCAAGCAGG + Intronic
1148109424 17:45136388-45136410 GGTGGTGATGGGTCCCACCCAGG - Intronic
1148873938 17:50675586-50675608 GGTGCTTGAGGCCCCCTCCCTGG + Intronic
1150283989 17:63945303-63945325 GATGGAGGTGCCCCCCACCCCGG - Intronic
1151340831 17:73469661-73469683 GGAGGGAGTTCCCCCCACCCTGG + Intronic
1151427157 17:74038466-74038488 AGAGGGAGGGGCCCCCACCCAGG - Intergenic
1152094260 17:78263859-78263881 GGTGGTTGGGGAACCCACCCAGG - Intergenic
1152750012 17:82058323-82058345 GGTGGTAGGCGCCCTCACCTGGG + Exonic
1152926548 17:83090216-83090238 GGTGTGTGTGGCTCCCACCCTGG - Intronic
1152926562 17:83090250-83090272 GGTGTGTGTGGCTCCCACCCTGG - Intronic
1152926576 17:83090284-83090306 GGTGTGTGTGGCTCCCACCCTGG - Intronic
1160187011 18:76683861-76683883 TATGGTAGTGGTCCCCATCCCGG + Intergenic
1160419236 18:78732730-78732752 AGTGGCTCTGGCCCCCACCCTGG + Intergenic
1160532457 18:79573525-79573547 GGTGGAGGTGGACCCCACGCTGG - Intergenic
1160871147 19:1278574-1278596 GGGGGAAGGGGCCCCCAGCCAGG - Intronic
1160985069 19:1834803-1834825 GGTGGTAGCAGCCTCCACCCGGG - Intronic
1162307382 19:9883420-9883442 GGGGGTAGTGGCGGCCACCTGGG + Intronic
1165851154 19:38851097-38851119 GGAGGTCCTGGCCCCGACCCTGG + Intronic
1166072937 19:40397373-40397395 GTCGGTAGTGGTGCCCACCCTGG - Exonic
1166194680 19:41197992-41198014 GCTGGGGGTGGCCCCAACCCAGG + Intronic
1167750329 19:51375489-51375511 GGTGGTAGTGGGACCCACTTGGG - Intergenic
927447813 2:23180801-23180823 GGTGGTAGTGGTTCTCACACAGG - Intergenic
932404965 2:71506705-71506727 CGTGTCAGTGGGCCCCACCCAGG - Intronic
932575450 2:72960091-72960113 GGTGGGTGAGGCCTCCACCCTGG - Intronic
934568426 2:95353248-95353270 GCTGGGAGAGGCCCCCACCCAGG - Intronic
935332051 2:101984613-101984635 GGTGGTACAGCCCTCCACCCTGG + Intergenic
937426296 2:121801710-121801732 GGTGTCAGTGGGCCCCAGCCGGG + Intergenic
938229422 2:129645754-129645776 GGAGGTAGTGGACCTCACCCTGG - Intergenic
942501141 2:176592169-176592191 GTTGTTATTGGCCCCCACCATGG + Intergenic
945735128 2:213589562-213589584 GATGGGAGTGGGCCCTACCCTGG - Intronic
948429759 2:237911964-237911986 GGTGGCGGTGGCCTCCAGCCAGG - Exonic
1170575629 20:17659643-17659665 GGTGGAGGGGGCCCCAACCCAGG - Intronic
1172099103 20:32474908-32474930 GGTGGAAGTGGCCCCGGCTCTGG + Intronic
1172580758 20:36045478-36045500 GGTGGCAGTGGCTAACACCCAGG + Intergenic
1173407205 20:42777060-42777082 GGTGGTGGTGGCCCGCACCAGGG - Intronic
1173619815 20:44428455-44428477 TGTGTGAGTGGCCCCGACCCAGG + Exonic
1174357846 20:50010166-50010188 GGTGGTCGCCGCCCCCAGCCCGG - Intergenic
1174580631 20:51569096-51569118 GGTCCTAGTGGCTCCCACCTTGG + Intergenic
1175296152 20:57910127-57910149 GGTGGTCCTGGCCCACAGCCAGG + Intergenic
1175426735 20:58872106-58872128 GGTGGTGGTGGCCCCCGTCTTGG - Intronic
1175600017 20:60265718-60265740 GGTGATTGTGCCCCCTACCCTGG + Intergenic
1175798229 20:61785605-61785627 GGTGGACAGGGCCCCCACCCAGG + Intronic
1181683553 22:24513344-24513366 GGTGGTGGTGTCTCCCATCCTGG + Exonic
1181688847 22:24547023-24547045 GGATGGAGTGGCCACCACCCAGG + Intronic
1183732387 22:39625977-39625999 GGTGATAGTTCCCCCGACCCAGG + Intronic
1184100201 22:42338044-42338066 GGGGGTACTGGGCCCCACCTGGG + Intronic
1185137540 22:49081256-49081278 TGTGGCTGTGGCCCCCGCCCTGG + Intergenic
950531393 3:13554105-13554127 GGTGGTAGGGGCCCCCAGTAGGG + Intronic
953131643 3:40145170-40145192 GGTGGAAGTGGCCCAGACCCTGG - Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961381729 3:126500011-126500033 GGAGGGAGGGGCCACCACCCTGG - Intronic
963870597 3:150410028-150410050 GGTAGTAGTGGCCTCCATGCAGG + Exonic
968599961 4:1504113-1504135 GGTGGGAGGGGCCTCCACCAGGG + Intergenic
968661284 4:1799842-1799864 GGTGGCAGCGGGCCCCACCCCGG - Intronic
968743301 4:2342187-2342209 GGTGGGAGGGGACGCCACCCTGG - Intronic
969609113 4:8217123-8217145 GGTGGCAGTGGCGGCCGCCCCGG + Exonic
969676428 4:8616860-8616882 GGGGCTCGTGACCCCCACCCTGG - Intronic
969858597 4:10018974-10018996 GGTGGTGAATGCCCCCACCCCGG - Exonic
970463059 4:16295002-16295024 AGTGGTAGTGGCAGCCTCCCAGG - Intergenic
978794698 4:112697480-112697502 GCTATTAGTTGCCCCCACCCAGG - Intergenic
979670197 4:123353407-123353429 GGTGGCCCTGACCCCCACCCAGG - Intergenic
979728765 4:123996259-123996281 GGTGGGAGAGGCCTCCACCTTGG - Intergenic
980963351 4:139498205-139498227 GGAGGGACTGCCCCCCACCCAGG + Intronic
985574334 5:666522-666544 GGTGGAGGTGTCCCCCACACAGG + Intronic
986218489 5:5744329-5744351 GGTGGTTTTGGCCCCCAGCAAGG + Intergenic
987837468 5:23179500-23179522 GGTGGGAGTGCCCCTTACCCAGG + Intergenic
988776318 5:34480846-34480868 TGATCTAGTGGCCCCCACCCAGG + Intergenic
992595295 5:78340548-78340570 GGTGGTAGTGGGCCCTGACCGGG + Intergenic
996536562 5:124583854-124583876 GGTAGTAGTAGCACTCACCCAGG - Intergenic
997226064 5:132210378-132210400 GGTTGTGGTGGCCTCCTCCCCGG + Exonic
999077346 5:148808890-148808912 GGAGGTCTTGGTCCCCACCCCGG - Intergenic
1002985766 6:2189564-2189586 GAGGGCAGTGGCTCCCACCCTGG - Intronic
1007643654 6:43363845-43363867 GGTGGCAGTGGCCACCTCCTTGG - Intronic
1018190223 6:161304060-161304082 TGTGGTTGTGGGCGCCACCCAGG + Intergenic
1022497360 7:30861484-30861506 GGTGGCCTTGGGCCCCACCCAGG + Intronic
1025129819 7:56369439-56369461 GGAGGAAGTGGCCCGCACGCGGG + Intergenic
1026247647 7:68635382-68635404 TGGTGTTGTGGCCCCCACCCAGG - Intergenic
1029849187 7:103445476-103445498 TTTGGTATTGGCCCCCTCCCGGG - Intronic
1032747741 7:134805071-134805093 TGGGCTTGTGGCCCCCACCCAGG - Intronic
1033673097 7:143511665-143511687 GGTGGTGGTGCCCCGCTCCCTGG - Intergenic
1034414887 7:150959222-150959244 GGTGGTCATGTTCCCCACCCTGG + Intronic
1035350035 7:158239101-158239123 CATGGTGGTGGCCCCCACCCCGG - Intronic
1035446706 7:158948048-158948070 GGTGCTTGTGGGCCCCTCCCAGG + Intronic
1037547578 8:19939565-19939587 GGTGGCAGTGGCCACCCGCCGGG - Intronic
1040616839 8:49046074-49046096 AGTGGTAGTGGAGCCCACTCCGG - Intergenic
1044319014 8:90781112-90781134 GGTGGAAGTGGTCCCACCCCTGG + Intronic
1048720536 8:137319334-137319356 GGTGTTAGTGGAGCCCACTCAGG - Intergenic
1053181575 9:35976189-35976211 GGTGGCAGTGGGCACCACACAGG + Intergenic
1056777964 9:89527675-89527697 GCTGGGAGTGGCTCCCAGCCAGG + Intergenic
1059437300 9:114284487-114284509 GATGGTTGGGGGCCCCACCCTGG - Intronic
1060783611 9:126431951-126431973 GGTGGTAATGCCCACCTCCCAGG + Intronic
1061537952 9:131261080-131261102 GGTGTTGGTGGCCACCAGCCAGG + Exonic
1061622621 9:131821499-131821521 GGTGGGACTTGCCCCCTCCCAGG + Intergenic
1061797750 9:133098240-133098262 GGTGGCAGTGACCCACACCTGGG + Exonic
1062352684 9:136146980-136147002 GGTGGAAGTGGGGCCCGCCCTGG - Intergenic
1062436679 9:136549434-136549456 CCTGGTGGTGGCCCCCACCCAGG - Intergenic
1187161422 X:16768757-16768779 TGGTGTTGTGGCCCCCACCCAGG + Intergenic
1187536680 X:20147293-20147315 TGAGCTTGTGGCCCCCACCCAGG + Intergenic
1187841294 X:23491725-23491747 AGTCCTTGTGGCCCCCACCCAGG + Intergenic
1191256857 X:58283271-58283293 GGTGGGAGAGACACCCACCCTGG + Intergenic
1197759807 X:130020087-130020109 GGGGGTCCTGGCCCCCAGCCCGG - Intronic
1200141779 X:153906142-153906164 GGTGTTCGTGGCACCTACCCTGG + Exonic
1201642335 Y:16192944-16192966 TGACGTTGTGGCCCCCACCCAGG + Intergenic
1201660479 Y:16392376-16392398 TGACGTTGTGGCCCCCACCCAGG - Intergenic
1202095367 Y:21243903-21243925 GGTACCAGTGGCCCCCAGCCTGG + Intergenic