ID: 1140765409

View in Genome Browser
Species Human (GRCh38)
Location 16:78152441-78152463
Sequence CATAGCTATCAAATTTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140765409 Original CRISPR CATAGCTATCAAATTTGAAG TGG (reversed) Intronic
905320724 1:37114983-37115005 CATAGCTATAAAATGGGAATGGG + Intergenic
906503222 1:46357536-46357558 CAGAGCTATGTAATTTCAAGGGG - Intronic
907901904 1:58748714-58748736 CAGAGTTGTCAAATCTGAAGGGG - Intergenic
908056616 1:60293948-60293970 CATGGCCATCAAATTGCAAGGGG + Intergenic
908149838 1:61288665-61288687 AATACCTATCAAATATAAAGGGG + Intronic
908226348 1:62059867-62059889 CGTAGATATGAAAGTTGAAGAGG + Intronic
908230185 1:62096946-62096968 CATAGATACTAAGTTTGAAGGGG - Intronic
908400089 1:63764604-63764626 TATAGCTTTCAAATTTGATGGGG - Intergenic
908777715 1:67657177-67657199 TATAGCTATCAAGTCAGAAGAGG + Intergenic
908911810 1:69080206-69080228 CATAACTCTTAAATTTGAAGAGG - Intergenic
911945307 1:104100000-104100022 TATAGCTATCAAATTTTAACAGG + Intergenic
916617151 1:166453731-166453753 CAAAGTTGTCAAATTAGAAGAGG - Intergenic
918657139 1:187041711-187041733 CATAGCTATTATATTTAAAAGGG - Intergenic
918763172 1:188441488-188441510 CATAGCTTTAAAATTTGCATAGG - Intergenic
919561713 1:199128140-199128162 CAAAGCAATCAAAGTTGAATGGG - Intergenic
921006335 1:211097059-211097081 CATAGCTAATAAATTACAAGAGG + Intronic
922312229 1:224405851-224405873 CCTAGCTTACAAATTTTAAGTGG - Intronic
1067328161 10:45289483-45289505 CATAGTTATCAGATTTCCAGAGG - Intergenic
1068756651 10:60662299-60662321 AATATCTATCAGATATGAAGTGG - Intronic
1077773120 11:5242882-5242904 CAGAGCTATCAAATGGTAAGTGG + Intergenic
1078120714 11:8506099-8506121 TATAGCTATCAAAATTGGACTGG - Intronic
1079116745 11:17645056-17645078 CATAGCTATCAAACTGGACCAGG - Intronic
1079795625 11:24799295-24799317 CACAGCTATTAAATTCAAAGGGG + Intronic
1079801765 11:24878280-24878302 AATATCTTTCAAATATGAAGGGG - Intronic
1080162975 11:29201232-29201254 CAAAACAATCCAATTTGAAGAGG + Intergenic
1083502497 11:63123419-63123441 CATAGTTATGAAAGTGGAAGGGG - Intronic
1084222503 11:67692471-67692493 TATAGCTAACAAATTTAAAGAGG + Intergenic
1085932193 11:81097168-81097190 CATAGCTATCACATTTAAACAGG + Intergenic
1086171010 11:83836485-83836507 CAGAGCTTCCAAATGTGAAGAGG - Intronic
1086516060 11:87614750-87614772 AATAGCTATCAATTATTAAGCGG + Intergenic
1086776518 11:90841937-90841959 CATAGGTAGCATGTTTGAAGAGG + Intergenic
1086943084 11:92818097-92818119 TTTGGCTATCAAATTTAAAGTGG - Intronic
1088701059 11:112412136-112412158 CAAAGCTATCAAAATTGAAGTGG - Intergenic
1089648846 11:119898536-119898558 CATAGATTACAAATTTCAAGGGG - Intergenic
1091036551 11:132238969-132238991 CATAGCTACCATTTTTGAGGTGG + Intronic
1091064867 11:132500286-132500308 CAGACCTATCAAATTGGATGAGG - Intronic
1092126158 12:6076394-6076416 GATGGCTATCATATTTGAATTGG + Intronic
1093778484 12:23105733-23105755 CATATATATCAAGTTTAAAGAGG - Intergenic
1093853925 12:24075431-24075453 CATAGCTATCTAATAAGAATAGG - Intergenic
1097210385 12:57363957-57363979 AATACCTTTCAAAATTGAAGAGG - Intronic
1097351498 12:58554137-58554159 CACAGAAAACAAATTTGAAGTGG + Intronic
1097724578 12:63060167-63060189 CATAGCTATCAAGGTTTAAGTGG + Intergenic
1098254576 12:68603741-68603763 AATAGTTATCAAATTCCAAGAGG - Intergenic
1099056728 12:77851126-77851148 CCCAGCTATCAAATGAGAAGTGG + Intronic
1099813688 12:87618878-87618900 TATAGCTGTCCAATTTGAGGTGG + Intergenic
1100168356 12:91944385-91944407 CATAGTAATGAAGTTTGAAGAGG + Intergenic
1103374441 12:120444773-120444795 CATAGCCATCAGATTTGATGAGG - Exonic
1105574609 13:21638385-21638407 GAAAGCTAGCAATTTTGAAGTGG + Intergenic
1110956099 13:81554326-81554348 CATATCTATCAATTTTGAAAAGG + Intergenic
1111875367 13:93887220-93887242 CATAGCAATAAAATGAGAAGAGG + Intronic
1113717938 13:112526970-112526992 CACAGCTATCATCTTTGTAGTGG + Exonic
1114296220 14:21331577-21331599 CTTAGGCATAAAATTTGAAGGGG - Intronic
1118474407 14:66103166-66103188 AATGGCTCTCAAATTTGGAGTGG - Intergenic
1121894150 14:97629953-97629975 CATAGCTGCCAAATTTCCAGTGG - Intergenic
1126474135 15:49048177-49048199 CATTGATATTAAATTTGAGGTGG - Intergenic
1137297530 16:47110342-47110364 TTTAGCTATAAAATTTGAATGGG - Intronic
1138816586 16:60209946-60209968 CATTACTCTCAAATTTGAAAAGG - Intergenic
1139063787 16:63288591-63288613 CAGATCTGTCAAATTGGAAGTGG + Intergenic
1140765409 16:78152441-78152463 CATAGCTATCAAATTTGAAGTGG - Intronic
1144635681 17:16907412-16907434 CATATGTACCATATTTGAAGGGG + Intergenic
1147889717 17:43708774-43708796 CACAGCTAGCAAATTGGAAGAGG - Intergenic
1149086475 17:52723625-52723647 CATAGATATCAAATATGAAGAGG - Intergenic
1150496482 17:65611748-65611770 CAAAGATATAAAATTTGAATTGG - Intronic
1150916445 17:69442429-69442451 GATAGTTATCAAGTATGAAGTGG - Intronic
1153418249 18:4874646-4874668 AATAGCTACCAAATATGAAGGGG + Intergenic
1157209410 18:45728567-45728589 TTCAGCTATGAAATTTGAAGAGG + Intronic
1159243534 18:65775280-65775302 CATTGCTATTAACTTTGAAATGG + Intronic
1159795386 18:72836872-72836894 GATAGCTATTAAATTTGATCAGG + Intronic
1166916424 19:46198714-46198736 CATAGTTATCAGAATTGAAGGGG - Intergenic
926379967 2:12277170-12277192 CAGAGCTATGAAAATTCAAGCGG + Intergenic
926429851 2:12774580-12774602 CACAGCTGTGAAATTTCAAGGGG - Intergenic
929745691 2:44655711-44655733 CAGAGCTATCCAATTAGAAAAGG + Intronic
931280476 2:60786890-60786912 TGTAGCTTTCAAATTTAAAGTGG + Intronic
932096896 2:68858200-68858222 AATAGCTTTGAGATTTGAAGTGG - Intergenic
933244736 2:79962686-79962708 CATATCTATCAAACTAAAAGAGG - Intronic
939667945 2:144973689-144973711 CATAGCTCCCCAATTAGAAGAGG - Intergenic
940141173 2:150492337-150492359 CAAAGATCTGAAATTTGAAGAGG - Intronic
942818274 2:180078977-180078999 GATAGTTATTAAATTTCAAGAGG + Intergenic
944234388 2:197428426-197428448 CAGAGATAAAAAATTTGAAGTGG - Intronic
946868556 2:224064985-224065007 CATAGCTATCAACTTAGGTGTGG + Intergenic
1168910424 20:1442597-1442619 CATAGCAATCAAACTTATAGGGG + Exonic
1169871917 20:10257169-10257191 CATAGTTCTCAAATCTGGAGGGG - Intronic
1173147865 20:40540754-40540776 CATGGCTAACAAATGGGAAGGGG + Intergenic
1180944392 22:19682495-19682517 CATAACTTACAAAATTGAAGAGG - Intergenic
1181021639 22:20106610-20106632 CACGTCTATCAAGTTTGAAGTGG + Exonic
949680033 3:6503031-6503053 CACAGCTTTCATATTTTAAGGGG - Intergenic
952094157 3:29928168-29928190 TATATATATAAAATTTGAAGAGG - Intronic
952283841 3:31948732-31948754 CATAGCTAAGAAATTGGAAAAGG + Intronic
954345157 3:49991084-49991106 GAAAGTTATCAAATCTGAAGGGG - Intronic
954532889 3:51336208-51336230 CATTGATATAAAAGTTGAAGAGG - Intronic
956231872 3:67026241-67026263 AAAAGCAATGAAATTTGAAGGGG - Intergenic
956545523 3:70397186-70397208 GATAGCTATCACATATGAAAAGG - Intergenic
961162296 3:124739213-124739235 CTTAGCTATCTAATTTCAATAGG - Intronic
963000365 3:140675279-140675301 AATAGCTATCAAAATTCTAGTGG + Intergenic
965374783 3:167909847-167909869 GAAAGCTGCCAAATTTGAAGTGG + Intergenic
965472454 3:169111248-169111270 CATAGCACTCAATTTTGAAATGG + Intronic
967462097 3:189759456-189759478 CATGGCCCTCAAATTTCAAGAGG + Intronic
967563618 3:190947364-190947386 GATAACTAGCAAATTTGAATAGG + Intergenic
973680603 4:53314726-53314748 CATATCTTCCAAATTTGAATTGG + Intronic
984371182 4:178867505-178867527 TTTACCTATCAAATTGGAAGAGG + Intergenic
984611712 4:181847378-181847400 GATAACTATTAAATTTGAGGAGG + Intergenic
985202956 4:187503493-187503515 CATAGCAAGCAGTTTTGAAGGGG + Intergenic
995195492 5:109362474-109362496 CATAGGTTTTAAAATTGAAGTGG + Intronic
996538434 5:124603216-124603238 CATACCTATAAAATATGAAGAGG + Intergenic
998069451 5:139185586-139185608 CATATGTTTCAAATTTGAAAAGG + Intronic
998620471 5:143789083-143789105 CATCTCTATCAAATTTGATAGGG + Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1002139006 5:177127218-177127240 CATAGCTATCCCATTTGGTGAGG + Intergenic
1002550032 5:179981208-179981230 CAAAGCTTTCTAATTTGAACAGG - Intronic
1009583100 6:65562333-65562355 CATAGCCAAACAATTTGAAGAGG + Intronic
1011155495 6:84325671-84325693 AATAGCTAACAACTTTGAAAAGG - Intergenic
1011342684 6:86334772-86334794 AATAGCAAACATATTTGAAGTGG - Intergenic
1012023611 6:93959656-93959678 CATAGTTATCAAATTTCCTGAGG - Intergenic
1014293284 6:119586479-119586501 TCTAGCTACTAAATTTGAAGTGG + Intergenic
1014635893 6:123846020-123846042 CATAGTTATAAAATTAGAATGGG - Intronic
1018338204 6:162818930-162818952 CAAACCTCTCAAATTTGAAAGGG + Intronic
1021563857 7:21997467-21997489 CACAGCTATCAAAGATAAAGAGG + Intergenic
1023179255 7:37465236-37465258 CATATCAAACAAATTTAAAGAGG + Intergenic
1026544600 7:71311011-71311033 AATAACTTTCAAATCTGAAGAGG + Intronic
1028216457 7:88139480-88139502 CAGAGTTATCAAATTTAAATAGG - Intronic
1030548499 7:110929161-110929183 AATAGCTTGCAAATTTGATGGGG - Intronic
1030976157 7:116126062-116126084 AATCCCTATCATATTTGAAGAGG - Intronic
1036758344 8:11486789-11486811 CATAGATCTCAATTTTGAGGGGG - Intergenic
1037216880 8:16465013-16465035 CCTAGCTGACATATTTGAAGTGG - Intronic
1038981504 8:32764144-32764166 CATTGCTAACAGATTGGAAGTGG + Exonic
1039950457 8:42167700-42167722 AAAAGCTACCAAGTTTGAAGGGG + Exonic
1042794224 8:72643048-72643070 CATATATGCCAAATTTGAAGTGG + Intronic
1044371060 8:91411634-91411656 CATAGCAATGAAATTAGAACAGG + Intergenic
1045736902 8:105306861-105306883 CATAGGTATCATTTCTGAAGAGG + Intronic
1046348984 8:112979593-112979615 CATAGCTATCCAATGTTAAAAGG + Intronic
1047137759 8:122100690-122100712 CATTTCTATAAAATTTGAAAAGG - Intergenic
1051313277 9:15800377-15800399 AATAGCAAACAAATTTGAAAAGG - Intronic
1052137104 9:24926160-24926182 CATAGATTTAAAATTTAAAGTGG + Intergenic
1052620501 9:30902677-30902699 CCTAGCTATCAAAATTGAGCAGG - Intergenic
1055926738 9:81518234-81518256 AATAGCCAACAAATTAGAAGAGG + Intergenic
1056235669 9:84591518-84591540 CAGAGTTATCAGATTTGATGAGG + Intergenic
1056469207 9:86888679-86888701 AATAGCAATCAAATTTAAGGTGG + Intergenic
1056705582 9:88949973-88949995 CATATCTATAAAATTGAAAGGGG - Intergenic
1058213356 9:102200911-102200933 CATAGATATCAAACATAAAGTGG - Intergenic
1058748228 9:108013031-108013053 CATAGCTAATAAATATGAAATGG + Intergenic
1059100180 9:111463882-111463904 CATCTCTAGCAAAGTTGAAGAGG + Intronic
1059547294 9:115190364-115190386 AAAAGCTATCCAATTTGAAAAGG + Intronic
1189709504 X:43795209-43795231 CAAATCAATCAAACTTGAAGGGG - Intronic
1190768089 X:53492253-53492275 CATAGCTAACAGATTTCCAGAGG - Intergenic
1190834957 X:54092107-54092129 CATAGCTATCAACTAGTAAGTGG - Intronic
1197145985 X:123172892-123172914 CATACCTCTCAAAATTTAAGTGG - Intergenic
1197188552 X:123617946-123617968 TATAGATATCAAAATTGAAATGG + Intronic
1199371981 X:147059875-147059897 CAAAGCACTGAAATTTGAAGGGG - Intergenic
1200730184 Y:6727290-6727312 CATTGCTATTTACTTTGAAGTGG - Intergenic