ID: 1140767059

View in Genome Browser
Species Human (GRCh38)
Location 16:78169750-78169772
Sequence CGTTGTTTGCAGGAGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140767052_1140767059 -1 Left 1140767052 16:78169728-78169750 CCTGATGTCATCCATCTCCCTAC 0: 1
1: 0
2: 0
3: 44
4: 218
Right 1140767059 16:78169750-78169772 CGTTGTTTGCAGGAGGAAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140767059 Original CRISPR CGTTGTTTGCAGGAGGAAAA GGG Intronic
901934952 1:12620455-12620477 CATTTATTGCAGGAGGAAACAGG + Intergenic
906120730 1:43388897-43388919 CGTTGGTTGGGGGAGGGAAAGGG - Intronic
906872672 1:49501433-49501455 TGTTATTGGCAGGAGGAAGATGG - Intronic
907583174 1:55590389-55590411 AGTCATTTGCAGGAGGACAAAGG - Intergenic
907625251 1:56023173-56023195 CTTTGTTAGCAGCATGAAAATGG - Intergenic
909597746 1:77425084-77425106 CTTTGCATGCAGGAAGAAAATGG + Intronic
910690172 1:89957500-89957522 TCATTTTTGCAGGAGGAAAATGG - Intergenic
910948824 1:92622452-92622474 CACTGTTTGCAAGAGCAAAAAGG + Intronic
912069762 1:105795499-105795521 CGTTGTATGCAGGTGGATTAAGG - Intergenic
913117464 1:115710623-115710645 CGTGGTTTGAAGGAGGGGAAGGG - Intronic
913219277 1:116646313-116646335 CGTTATTTTTAGGAGGAAGATGG + Intronic
913498361 1:119448595-119448617 AGTGGTTTGGAGGAGGATAAAGG + Intergenic
915204701 1:154261386-154261408 GGTAGTTTGGAGGAAGAAAAAGG - Intronic
917702379 1:177594451-177594473 CCTTGTTTTCAGAAGAAAAAGGG - Intergenic
918047576 1:180950811-180950833 CTTTGTTGGCAGGGGGAGAAGGG + Exonic
921989405 1:221348180-221348202 CATTGTATGCATGAGGAAAGAGG - Intergenic
922636569 1:227178803-227178825 CTTTGTTAGCAGCATGAAAATGG + Intronic
923883424 1:238129190-238129212 TGTGGTTTGCAGCAGGAGAAAGG + Intergenic
924377042 1:243421832-243421854 TGTTTTTTGAAGGAGGTAAACGG + Intronic
1063968530 10:11365143-11365165 CGAGGTTTGCAGCAGGAGAAAGG - Intergenic
1064081035 10:12308205-12308227 CTTTGCTGGCAGGAGGCAAAAGG + Intergenic
1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG + Intronic
1067731902 10:48818841-48818863 CGTTGTTTGCAGGAGAGAGGTGG + Intronic
1067834041 10:49627153-49627175 CCTTGTTTGCAACAGCAAAATGG - Intronic
1068658191 10:59595803-59595825 CATTGTTTGGAGGAGGTAATTGG - Intergenic
1072186630 10:93046225-93046247 CATTATTAGAAGGAGGAAAAAGG + Intronic
1072790548 10:98314572-98314594 ACTTATTTGCAGGATGAAAATGG + Intergenic
1074099453 10:110342888-110342910 GGTTATTTTCAGGAGGAAAGGGG - Intergenic
1074599037 10:114895169-114895191 CATTGTCAGCAGGAAGAAAATGG - Intronic
1077962194 11:7087422-7087444 TGAGGTTTGCAGCAGGAAAAAGG - Intergenic
1080406067 11:31980393-31980415 AGGTGTTTGAAGGAGGAAAGAGG + Intronic
1081307269 11:41528773-41528795 CTTTGTTTTGAGGGGGAAAAAGG - Intergenic
1083881824 11:65552748-65552770 GGTTGACTGCAGGAGGAACAAGG - Intronic
1084105541 11:66977791-66977813 CAATGTCTGGAGGAGGAAAATGG + Intergenic
1088506639 11:110533617-110533639 CGTTGTTTCCATAAGGAAATTGG - Intergenic
1089053823 11:115568251-115568273 CATTCTTCGCAGGAGGAATAGGG - Intergenic
1089318880 11:117611581-117611603 AGAAGTTTGGAGGAGGAAAAGGG - Intronic
1090450336 11:126800601-126800623 TGCTGTTTGCAGGCAGAAAAGGG - Intronic
1092981612 12:13800089-13800111 CAGTGATTCCAGGAGGAAAATGG - Intronic
1093973823 12:25399918-25399940 CTTTGTTAGCAGCATGAAAATGG + Intergenic
1097907960 12:64939984-64940006 AGATGTTTGGAGGAGCAAAAGGG + Intergenic
1100168523 12:91945939-91945961 GTTTTTTTGGAGGAGGAAAAGGG + Intergenic
1103247928 12:119474144-119474166 CGTTCTTTGCAGGAGTAAGGTGG - Intronic
1106258148 13:28040296-28040318 CGTTGTTTAATGGAGGAGAATGG + Intronic
1106351983 13:28939775-28939797 CTTTGTTAGCAGCATGAAAACGG - Intronic
1110246932 13:73336698-73336720 TCTAGTTTGCAGCAGGAAAATGG - Intergenic
1112915943 13:104550478-104550500 CTCTGGTTTCAGGAGGAAAATGG + Intergenic
1113267220 13:108633062-108633084 CATTGTTTGCAGCAGGAGGAAGG + Intronic
1113658269 13:112084421-112084443 GGTTGTTTGCAGGTGGAAAGAGG - Intergenic
1117653732 14:57932980-57933002 GGTTGATTTCAGCAGGAAAATGG - Intronic
1118171579 14:63394537-63394559 CATTATTTGGAGAAGGAAAAGGG - Intronic
1119425749 14:74533768-74533790 AGAAGTTTGCAGCAGGAAAAGGG - Intronic
1119463864 14:74836890-74836912 TTTTCTTTGCAGGATGAAAAAGG - Intronic
1120183669 14:81370384-81370406 CTTTCTTTGCAGGTGGAATATGG - Intronic
1122158226 14:99763980-99764002 CGGTGTTAGCAAGAAGAAAAGGG - Intronic
1128058910 15:64721183-64721205 CGTTCTTTGTAGGAGAAAGAGGG - Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1131158002 15:90086797-90086819 CTTTGGTTCCAGTAGGAAAATGG - Intronic
1132918363 16:2367760-2367782 TGGTATTTGCAGGTGGAAAAGGG - Intergenic
1132923372 16:2412213-2412235 CTCTGCTTGCAGGAAGAAAAGGG - Intergenic
1135783389 16:25326205-25326227 CGTAGGGTGCAGGAGGAAAGTGG + Intergenic
1137771348 16:51017839-51017861 TGTTTTCTGCAGAAGGAAAAAGG - Intergenic
1140763810 16:78137168-78137190 TATTGGTTGCAGGAGGAAAAAGG - Intronic
1140767059 16:78169750-78169772 CGTTGTTTGCAGGAGGAAAAGGG + Intronic
1144227740 17:13167282-13167304 CATTGTTTACAAGAGCAAAAAGG - Intergenic
1148184785 17:45634240-45634262 CCTGTTTTGGAGGAGGAAAAGGG + Intergenic
1150470432 17:65432677-65432699 CTATGTGTCCAGGAGGAAAATGG - Intergenic
1151037536 17:70819667-70819689 AGTTGCTTGCTGGAGGCAAAAGG - Intergenic
1155544879 18:26904572-26904594 CTTTGTTAGCAGCATGAAAATGG - Intergenic
1156025137 18:32645025-32645047 TGTATTTTGCAGGAGGAATAAGG + Intergenic
1156331538 18:36128719-36128741 TGGTGTGTGCTGGAGGAAAAAGG + Intronic
1157143282 18:45134500-45134522 CTTTGTTTGCAGGTAGAGAAGGG + Intergenic
1159773649 18:72578878-72578900 GGGTGCTTTCAGGAGGAAAAAGG - Intronic
1160515622 18:79477932-79477954 TGGTGTTTGCAGGAGGTAACTGG - Intronic
1161608672 19:5229129-5229151 CGATGTTTGCACCAGGGAAATGG - Intronic
1162494164 19:11013889-11013911 CTCTGTTTGCAGGGAGAAAAAGG - Intronic
1162964478 19:14149423-14149445 GGTTGATGGCAGAAGGAAAATGG - Exonic
1166791290 19:45400236-45400258 CATTGTTAGCAAGAGGAACAGGG + Intronic
1167973521 19:53204874-53204896 CTTTGTTTAGAGGAGGAAAGAGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926138035 2:10350960-10350982 CGCTGTTGGTAGGATGAAAATGG + Intronic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929792499 2:45034048-45034070 AGTTGTTAGTAGGAGGAAAAAGG + Intergenic
931169453 2:59787559-59787581 TGATGTTGGCAGAAGGAAAAGGG + Intergenic
932087718 2:68776471-68776493 AGTTGTGGGCTGGAGGAAAATGG + Intronic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
935317366 2:101848910-101848932 GGATGGTTCCAGGAGGAAAAGGG + Intronic
935669423 2:105542558-105542580 CCTTGTTTTTAGGAAGAAAAGGG - Intergenic
938668655 2:133565818-133565840 GGGTGTTTGCAACAGGAAAATGG + Intronic
939336845 2:140840318-140840340 TCTTGTATGTAGGAGGAAAAAGG - Intronic
944204764 2:197145824-197145846 CTTTGTTTGCAGTAAGGAAAGGG - Intronic
944351812 2:198736916-198736938 ATTTCTTTGCAGGTGGAAAATGG + Intergenic
944946609 2:204694559-204694581 CGTAGTTTGGTGGAAGAAAAAGG - Intronic
945899331 2:215520290-215520312 CTTTGGTTGCCGGAGGAATACGG - Intergenic
946402749 2:219477085-219477107 CGTGGTTAGGAGGAGGAAAGGGG + Intronic
946532446 2:220586139-220586161 ATTTGTTTGCAGGAGGAAAGAGG + Intergenic
1169301943 20:4450481-4450503 TGTGTTTTGCAGAAGGAAAATGG + Intergenic
1169828423 20:9795197-9795219 AGTTGTTTCCAGTAGGAAACAGG - Intronic
1170485637 20:16813185-16813207 AAATGTTTTCAGGAGGAAAAAGG - Intergenic
1170715015 20:18823854-18823876 TGCTCTTTGCATGAGGAAAAGGG + Intronic
1171135626 20:22692148-22692170 CGCTGCTTGCAGGAGGGACAGGG - Intergenic
1173190967 20:40875361-40875383 AGTTGTTTTCAGGAGGCAAATGG + Intergenic
1173661868 20:44740142-44740164 GGTCCTTGGCAGGAGGAAAAGGG + Intergenic
1177344888 21:19855376-19855398 CTTTGTTAGCAGCATGAAAATGG - Intergenic
1178262806 21:31115817-31115839 CATTGTTGGTAGAAGGAAAAAGG - Intergenic
1179090155 21:38257345-38257367 TGCTGTTTGCATGTGGAAAACGG + Intronic
1179106491 21:38405087-38405109 AGGTGTTTGCAGTAGGAGAATGG - Intronic
1180820567 22:18824369-18824391 CGTTATTTTTAGGAGGAAGATGG + Intergenic
1181206791 22:21258841-21258863 CGTTATTTTTAGGAGGAAGATGG + Intergenic
1181823765 22:25496241-25496263 AGATGTTACCAGGAGGAAAAAGG + Intergenic
1185025453 22:48407479-48407501 CGGTGTGGGCAGGAGGGAAAAGG - Intergenic
1203220133 22_KI270731v1_random:36582-36604 CGTTATTTTTAGGAGGAAGATGG - Intergenic
1203270693 22_KI270734v1_random:50244-50266 CGTTATTTTTAGGAGGAAGATGG + Intergenic
951024262 3:17813464-17813486 CTTTATTAGCAGGATGAAAACGG + Intronic
952269298 3:31816626-31816648 AGATGTTTCCAGGAAGAAAAGGG - Intronic
952509088 3:34036143-34036165 AGTTGTTTGGAGGAGGAAGGGGG + Intergenic
952604600 3:35129967-35129989 CTTTATTAGCAGGATGAAAACGG - Intergenic
953932274 3:47011408-47011430 GGCTGTGTGCAGGAGGAATATGG - Intergenic
954179219 3:48868444-48868466 TGTAGTTAGCAGGAGGAATAGGG - Intronic
956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG + Intergenic
956267833 3:67417709-67417731 CTTTCTCTGCTGGAGGAAAAGGG - Intronic
956883865 3:73538709-73538731 TGTTCTATGCAGGAGAAAAATGG - Intronic
957430634 3:80101172-80101194 CATTGTAGGCAGGAGGAAGAAGG + Intergenic
959882975 3:111467624-111467646 TGTTGTTTGCAATAGAAAAAAGG + Intronic
960199639 3:114815476-114815498 CGTTGTGTGCAGGGGAAAATGGG - Intronic
960547305 3:118930453-118930475 TGTAGTTTTCAGGAGGTAAAGGG - Intronic
962631212 3:137277915-137277937 TGTTGTTTCAAGGTGGAAAAGGG - Intergenic
965034736 3:163423991-163424013 AGGTGTTTGCAGAAGGCAAAGGG - Intergenic
965124802 3:164612404-164612426 CCTTTTTTGCAGGAAGAAAAAGG - Intergenic
965570156 3:170164542-170164564 TGTTCTTGGCAGGAGGAATAGGG - Intronic
967954365 3:194867016-194867038 CTTTATTTGAAGCAGGAAAAGGG + Intergenic
968184888 3:196625714-196625736 CGTGGCTGGCAGGAGGATAATGG + Intergenic
968184900 3:196625774-196625796 CGTGGCTGGCAGGAGGATAATGG + Intergenic
968184912 3:196625834-196625856 CGTGGCTGGCAGGAGGATAATGG + Intergenic
968814970 4:2817560-2817582 GCTTGTTTGCAGGTGGAAGATGG + Intronic
969044079 4:4323913-4323935 TGTTGTTTCAAGGAGAAAAAAGG - Intergenic
969188766 4:5500057-5500079 AGTTTATTTCAGGAGGAAAATGG + Exonic
970635320 4:18004277-18004299 CTTTGTTAGCAGCATGAAAATGG - Intronic
971846993 4:31931744-31931766 AGTTGTTGGCAGGAGGAAGCTGG - Intergenic
971961913 4:33499517-33499539 CGTTTTTTGCAGTCGGAAAAGGG + Intergenic
973560667 4:52131896-52131918 ATATGTTTACAGGAGGAAAAGGG - Intergenic
974826781 4:67141391-67141413 TCTTGTCTGCAGGAGCAAAAAGG - Intergenic
975581443 4:75910483-75910505 TCTTGTTTTCAGGAAGAAAATGG + Intergenic
977656123 4:99522740-99522762 CCTTGTTTGCAGGAGGCATAAGG - Intronic
979320697 4:119321725-119321747 TGTTGTTTACAGTAAGAAAATGG - Intronic
983406241 4:167334901-167334923 CGTTGTCTGCAGGAGTAATGGGG - Intergenic
989152920 5:38317927-38317949 CAGTGTTGGCAGGAGGAAACCGG + Intronic
991037500 5:62142787-62142809 AGTTTTTTGCAGGCTGAAAATGG + Intergenic
991135691 5:63179726-63179748 CTTTTTTTGCATGAAGAAAATGG - Intergenic
992975041 5:82107379-82107401 GGGTGTTTGCAGGAGATAAAGGG + Intronic
994709708 5:103252479-103252501 TGTACTTTGCAGGAGGAATAGGG + Intergenic
995792735 5:115909196-115909218 TGTTTATTGCATGAGGAAAAGGG + Intronic
999435475 5:151559976-151559998 ATTTGTTTGGAGGAGAAAAATGG - Intronic
999631806 5:153578969-153578991 CCTTGTTTTCAGGAGAGAAAAGG - Intronic
999858033 5:155616564-155616586 TGTTGTTTGCAGGAGCATGATGG - Intergenic
1002053213 5:176583729-176583751 AGTTGTGTGCAGGAGGGACAGGG + Intronic
1002935136 6:1665317-1665339 CCTTGTTTGAAGGAGGTAATGGG + Intronic
1003290222 6:4774460-4774482 CGCTGTTTGGAGGAGGGAGAGGG + Intronic
1004331596 6:14726932-14726954 CATTATTTGCAGGAGCCAAAAGG + Intergenic
1005620103 6:27612163-27612185 CCTTCTTTGTAGGATGAAAAGGG - Intergenic
1009960584 6:70516107-70516129 AGTTGTTTGCAGAAGGAAGAGGG + Intronic
1011963941 6:93128876-93128898 AGTTGTTTGGAGGAGTAAATGGG - Intergenic
1012437068 6:99226126-99226148 CTTTTTTTAAAGGAGGAAAAAGG + Intergenic
1018618920 6:165712132-165712154 AGTGGTGTGGAGGAGGAAAAGGG + Intronic
1019511544 7:1419992-1420014 CACTGTTTGGAGGAGGAAACCGG - Intergenic
1020790710 7:12625286-12625308 TGATGTTGGTAGGAGGAAAATGG - Intronic
1021491552 7:21224738-21224760 CAGTGTTTGCAGCAGTAAAAAGG - Intergenic
1021927007 7:25543535-25543557 GGGTCTTTGCAGGAGGAAGATGG - Intergenic
1025775591 7:64558166-64558188 CGTTGGTTGGTGGAGGAAAAAGG + Intronic
1029007172 7:97222841-97222863 CTTTCTATACAGGAGGAAAATGG - Intergenic
1029947256 7:104545707-104545729 GGTGGTTTGAAGGATGAAAATGG - Intronic
1032331407 7:130984099-130984121 CCTATTTTGCAGGAGGAAAATGG - Intergenic
1032993582 7:137421086-137421108 GAGTGTTTGAAGGAGGAAAAAGG - Intronic
1033622898 7:143077977-143077999 AGTTGTTTCCAGGAGGATTATGG - Intergenic
1034278435 7:149834879-149834901 GGCTCTTTGCAGGAGGAACAGGG - Intergenic
1036605142 8:10298191-10298213 CATTGTTTGCAGTGGTAAAAAGG + Intronic
1037298390 8:17425553-17425575 CATTGTTTGCAGGAGGACCCAGG - Intergenic
1037760964 8:21741271-21741293 AGAAGTTTGCAGGAGGGAAAGGG - Intronic
1041013986 8:53572274-53572296 TGTAGTTAGCAGGAGGAATAAGG + Intergenic
1041193731 8:55379457-55379479 CGTTGAATGCATGAGGAAAGAGG - Intronic
1042024602 8:64409574-64409596 CATGGTTTTCAGGAGGACAAAGG + Intergenic
1042411606 8:68473027-68473049 CATTGTATGAAGGAGGAAGAAGG - Intronic
1043926646 8:86044474-86044496 TTTTGTTTGCAGTAGGAAAAGGG + Intronic
1045118552 8:99011287-99011309 TGTTGGTTCCAGGAGAAAAATGG + Intergenic
1046522508 8:115343453-115343475 CCTTTTTTGCAGAAGGAAAATGG - Intergenic
1048267636 8:133001470-133001492 GGTTATTTGCAGAATGAAAATGG - Intronic
1052874794 9:33549299-33549321 CTTTGTTTCCAGGAGATAAAAGG + Intronic
1053501228 9:38595020-38595042 CTTTGTTTCCAGGAGATAAAAGG - Intergenic
1056273335 9:84968409-84968431 TGTTGGTTGCAAGAAGAAAAGGG + Intronic
1059367692 9:113799572-113799594 CGCTGATTTCAGGAGGCAAAGGG - Intergenic
1059740619 9:117146097-117146119 AGTTGTATGCAGGATGAAATTGG - Intronic
1060675443 9:125510242-125510264 TGTAGTTTGCAGGAGGAAGGAGG - Intronic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1185763710 X:2707851-2707873 GGTCGTTTTCAGGAGCAAAAAGG + Intronic
1187669355 X:21653826-21653848 TGTTTTTTTCAGGAGGAGAAAGG + Exonic
1189921748 X:45909307-45909329 TGTTTTTTGCAGGAAGAAATGGG + Intergenic
1190108882 X:47577202-47577224 GGCTGAATGCAGGAGGAAAAAGG + Intronic
1190855983 X:54295447-54295469 CGTTTTTTGAAGGATTAAAAAGG + Intronic
1193209022 X:78783618-78783640 CTTTGTTAGCAGCATGAAAATGG + Intergenic
1194869737 X:99114352-99114374 ATTAGTTTGCAGGAGGAAAAAGG - Intergenic
1196659794 X:118257864-118257886 CTTTATTAGCAGGATGAAAACGG - Intergenic
1196885632 X:120242919-120242941 CCTTATTTGCAGGAGCAGAATGG - Intergenic
1196961442 X:121007347-121007369 CTCTGTTTGTAGGAGGAAATTGG + Intergenic
1197482602 X:127005446-127005468 GGTTGTTTGGAGGAAAAAAAAGG - Intergenic
1199473923 X:148225249-148225271 TGTTGTGTGTAGGGGGAAAATGG + Intergenic
1199612174 X:149627937-149627959 TCTTGTTTGAAGCAGGAAAAAGG - Intronic