ID: 1140771744

View in Genome Browser
Species Human (GRCh38)
Location 16:78211899-78211921
Sequence AACTCAGCTCAGAGAGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140771744_1140771749 -8 Left 1140771744 16:78211899-78211921 CCCTACCCTCTCTGAGCTGAGTT 0: 1
1: 0
2: 2
3: 37
4: 266
Right 1140771749 16:78211914-78211936 GCTGAGTTTGTTTTGGACACTGG 0: 1
1: 0
2: 1
3: 17
4: 194
1140771744_1140771750 16 Left 1140771744 16:78211899-78211921 CCCTACCCTCTCTGAGCTGAGTT 0: 1
1: 0
2: 2
3: 37
4: 266
Right 1140771750 16:78211938-78211960 GATAATGCATGTTAACATCCTGG 0: 1
1: 1
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140771744 Original CRISPR AACTCAGCTCAGAGAGGGTA GGG (reversed) Intronic
901128712 1:6948761-6948783 TACTCAGCTCAGAAATGGCAGGG + Intronic
901491061 1:9596553-9596575 GACTGAGTTCCGAGAGGGTAGGG + Intronic
902251529 1:15156737-15156759 AACAAAACTCAGAGAGGGGATGG + Intronic
904465769 1:30706800-30706822 AACAGAGCTCAGAGAGGGTCAGG + Intergenic
905695115 1:39968214-39968236 TACACAGCTCAGTGAGGATATGG - Intronic
905706105 1:40059862-40059884 AATTAAGCTCAGAGAGGAAAAGG + Intronic
906060281 1:42943954-42943976 AACTGAGCCCTGAGAGGGTGAGG + Intronic
906061224 1:42949987-42950009 GTCTCAGCTCAGAGTGGGCAAGG - Intronic
906489925 1:46260352-46260374 AAGTTAGCTCAGAGAGGGATGGG - Intronic
906582509 1:46947840-46947862 AATTCATTTCAGAGAGGGTGTGG - Intergenic
906601105 1:47130028-47130050 AATTCATTTCAGAGAGGGTGTGG + Intergenic
906689253 1:47781823-47781845 AACCAAGCCCAGAGAGGGCAGGG - Intronic
907158353 1:52354305-52354327 AACTCAGGTCCGAGAGGAAAGGG - Intronic
907312178 1:53544958-53544980 AAGGCAGCCCAGAGAGGGCAAGG + Intronic
907960264 1:59272891-59272913 CACTAAACTCAGAGAGAGTATGG - Intergenic
912236958 1:107862718-107862740 AACACAGCTCAGATAGGATACGG + Intronic
912701581 1:111882128-111882150 ACCAGAGCTCAGAGAGGGAAGGG - Intronic
914260390 1:145994314-145994336 AACTCATCTCAGAGCTGGTTCGG + Exonic
914454018 1:147818655-147818677 AACTCAACTCAAAGTGGCTAGGG - Intergenic
915036566 1:152932567-152932589 AACTCAGTTCACAGAGAGTTGGG - Intergenic
915251089 1:154589178-154589200 AGCTCAGCTCACAGAGGGGATGG + Intronic
915622790 1:157096151-157096173 AGCTTAGCTCAGAGGGAGTAGGG - Intronic
917997646 1:180457520-180457542 AACTCAGGTCTGACAGGTTAAGG - Intronic
918060258 1:181054892-181054914 AAATCAGCTCAGAGAGTTAATGG + Intronic
918102929 1:181392099-181392121 AGATCAGCACAGAAAGGGTAAGG + Intergenic
919805145 1:201376968-201376990 AGCTCAGCTCTGGGAGGGAATGG + Intronic
919918568 1:202154188-202154210 CACTCAGCTCCGAGAGGGCAAGG - Exonic
920098087 1:203499633-203499655 AACTTTGCTGAGAGAGGTTAGGG - Exonic
920539399 1:206766799-206766821 ATCTCAGCTCAAAGAGGATTTGG + Intergenic
922494036 1:226041994-226042016 AGCTCAGGTCAGAGAGGGTGGGG + Intergenic
923559600 1:235028488-235028510 AACCAGGCTCAGAGAGGGGAAGG + Intergenic
924448383 1:244155537-244155559 ACCTCAGCTCAGTCAGAGTAAGG + Intergenic
1065934200 10:30506105-30506127 ATCAAAGCACAGAGAGGGTAAGG - Intergenic
1067258451 10:44665784-44665806 AAATCAGCACAGAGAGGAGATGG + Intergenic
1067685790 10:48465432-48465454 AGCCCAGCTCAGAGAGGCTTAGG - Intronic
1068943640 10:62706075-62706097 TCCTGAGCTCAGAGAGGTTAAGG + Intergenic
1070722161 10:78764327-78764349 AACTGAGGTCAGAGAGGACAGGG - Intergenic
1070785455 10:79159822-79159844 AACTGAGATCAGAGAGGGGAAGG - Intronic
1072008037 10:91275021-91275043 AACTGATCTCAGAGTGGGGATGG + Intronic
1073053275 10:100683449-100683471 AACTCAGCTTGGAGAAGGGAGGG - Intergenic
1073476640 10:103757907-103757929 GACTCAGCACAGAGTGGGGAGGG + Intronic
1073572799 10:104594928-104594950 CACTCAGGGTAGAGAGGGTAGGG + Intergenic
1075397788 10:122140594-122140616 AACCCAGCCCAGAGAGAGCAGGG - Intronic
1076170006 10:128311408-128311430 CACTCAGCCAAGAGAGGCTATGG + Intergenic
1076353088 10:129832069-129832091 AAATCAGTGGAGAGAGGGTAGGG + Intergenic
1077219020 11:1407220-1407242 CACCAAGCTCAGAGAGGGCAGGG - Intronic
1077746963 11:4917058-4917080 ATATGAGCTCAAAGAGGGTAGGG + Intronic
1078576758 11:12509387-12509409 AACTGAGGTCAGAGAGGTTAAGG - Intronic
1079130722 11:17745462-17745484 AACTCAGGCAAGAGAGGGCAGGG - Intronic
1079411648 11:20193225-20193247 AACTGAGCTCAGAAAAGTTAAGG + Intergenic
1080568259 11:33532136-33532158 ACCAGAGCTCAGAGAGGGCAAGG - Intergenic
1081238462 11:40675409-40675431 AACTCAGGACAGAGATAGTAGGG + Intronic
1081285114 11:41258841-41258863 AACTCAGCTCTGAGAGCCAAAGG - Intronic
1081536928 11:44003221-44003243 AAGTCACCTCAGAGAGGACATGG + Intergenic
1081817862 11:45962119-45962141 AACTGAGTTCCGTGAGGGTACGG + Intronic
1083163352 11:60868972-60868994 AACTGAGAGCAGAGAGGGGAGGG + Intronic
1084962506 11:72724644-72724666 CACTCAACTCAGAGAGTGTATGG - Intronic
1087727530 11:101739294-101739316 TACTCACCACAAAGAGGGTATGG + Intronic
1087921715 11:103874668-103874690 AAGGCAGCTCAGAGAGGTTAAGG - Intergenic
1089046269 11:115504112-115504134 AACTCAGGGCTGAGAGGGAAGGG - Intronic
1089102910 11:115978921-115978943 AACTAAGCTGAGATAAGGTAAGG + Intergenic
1089965816 11:122654526-122654548 AACTCAGCTCAGAGAGGTTGGGG - Intergenic
1090452419 11:126818438-126818460 AAATAGGCTCAGAGAGGTTACGG - Intronic
1090656900 11:128853107-128853129 AGTGCAGCTCAGAGAGGTTAAGG - Intronic
1090851165 11:130571874-130571896 GTCTCATCTCAGAGAAGGTAAGG + Intergenic
1091346882 11:134860565-134860587 AAATCAGCTCAAAATGGGTAAGG - Intergenic
1091389228 12:115690-115712 AAATGGGCTCAGAGAGGTTAAGG + Intronic
1091785171 12:3238974-3238996 ATCTCAGCCCAGAGAGGGGTAGG + Intronic
1092061111 12:5551290-5551312 AAAGCAGCTCAGAGAAGTTATGG + Intronic
1092664823 12:10784296-10784318 AACTCAGCAGAGAGAGGCTGGGG + Intergenic
1093197775 12:16149076-16149098 TCCTCAGCTAAGAGAGGGTCAGG + Intergenic
1096547464 12:52350471-52350493 AACTGACATCAGAGAGGGGAAGG + Intergenic
1096826988 12:54287140-54287162 AATTCAGGTTAGAGAGGATATGG + Intergenic
1097470761 12:59988032-59988054 CACTTAGCACAGAGAGGCTATGG - Intergenic
1097973442 12:65659753-65659775 AATTAAGCTCCGAGAGTGTAGGG + Intergenic
1099204033 12:79707983-79708005 GACTCAGCTAAGAGAGCCTAAGG + Intergenic
1099228981 12:80001421-80001443 ACCTAAGCCCAGAGAGGTTAAGG + Intergenic
1100030957 12:90190399-90190421 AACTAAGCTCAGAAAGGCTAGGG - Intergenic
1101317308 12:103641348-103641370 ACATCAGTTCAGAGAGGGTAAGG - Intronic
1101490468 12:105205107-105205129 AAATCAGCTCACAGAGGCTGGGG + Intronic
1102260606 12:111440922-111440944 AACAGAGCTCCCAGAGGGTATGG - Intronic
1102297069 12:111745414-111745436 AACTCAGCTCACAGTGGATCTGG - Intronic
1102412682 12:112733774-112733796 AACCCAGCACAGAGTGGGCATGG + Intronic
1102646442 12:114406830-114406852 AATACATCTCAGAGAGGGAAAGG - Intronic
1103002530 12:117396225-117396247 AACTGAGCTGAGAGAGGGCGAGG - Intronic
1103515992 12:121508728-121508750 AAGTAGGCTCAGAGAGGGTACGG - Intronic
1103697301 12:122826252-122826274 AACTCAGCGGAGAGAGGGAGGGG - Intronic
1104200953 12:126588422-126588444 AGCTGAGCTCTGAGAGGGTAGGG - Intergenic
1104272175 12:127292630-127292652 ACCTCAGCTTAGAGAGGGTAAGG - Intergenic
1104401588 12:128480914-128480936 CTGTCAGCTCAGAGAGGGTGGGG + Intronic
1104851692 12:131878578-131878600 AATTCATTTCAGAGAGGGTGTGG + Intergenic
1107828840 13:44356440-44356462 AACTCATATCAGAGTGGTTAAGG - Intergenic
1109100145 13:58173472-58173494 AAATCAGATCAGAGGGGTTATGG + Intergenic
1109324463 13:60851132-60851154 AACTAAGCACAGAGAAGTTAAGG + Intergenic
1109337990 13:61017360-61017382 AACTCAGATCTGAGAGCTTAAGG - Intergenic
1115163619 14:30423523-30423545 AACTGAGGTCAGAGAGGATATGG - Intergenic
1119892279 14:78191864-78191886 CACACAGCTCAAAGAGGGGAAGG - Intergenic
1120181109 14:81343009-81343031 ACCACATCTCAGGGAGGGTAGGG + Intronic
1120679774 14:87466599-87466621 AACGATGCTAAGAGAGGGTATGG + Intergenic
1121313326 14:92946765-92946787 ACCGGAGCTCAGAGAGGGTTGGG + Intronic
1122616575 14:103022081-103022103 AAGTCAGCAGAGAGAGGGGAGGG + Intronic
1122661618 14:103299699-103299721 AACAGAGCTCACAGAAGGTATGG - Intergenic
1125595784 15:40885233-40885255 AGCGTAGCTCAGAGGGGGTAGGG + Intergenic
1127701346 15:61504520-61504542 ATCTCAGCTCAGTGTGGGGAGGG - Intergenic
1133026737 16:2991883-2991905 AAACCAGGTCAGGGAGGGTAGGG + Intergenic
1133772969 16:8878380-8878402 AATTCAACCCAGAGAGGTTAGGG + Intergenic
1134322527 16:13176660-13176682 AAGCCAGCTCAGAGATGGAATGG - Intronic
1135133372 16:19870608-19870630 AACTGAGCTAGGAGAGGGGATGG + Intronic
1135460945 16:22642439-22642461 AAGTGACCTCAGAGAGGGAACGG + Intergenic
1136559686 16:31031829-31031851 AACCCAGCTCAGGCAGGGTGTGG - Intergenic
1136684555 16:31986579-31986601 AAAACAGCCCAGAGAGGGGAAGG + Intergenic
1138490582 16:57373940-57373962 TACTAAGCTGAGAGAGGGAAGGG + Intronic
1139152639 16:64402005-64402027 AACTGAGATCAGAGGGGTTACGG + Intergenic
1139850666 16:69950247-69950269 AACCCCGCTCCGAGAGGGTGTGG + Intergenic
1139879652 16:70173159-70173181 AACCCCGCTCCGAGAGGGTGTGG + Intergenic
1140372874 16:74422389-74422411 AACCCCGCTCCGAGAGGGTGTGG - Intergenic
1140771744 16:78211899-78211921 AACTCAGCTCAGAGAGGGTAGGG - Intronic
1141008691 16:80376806-80376828 GACTCTGCTGAGAGAGGGGAGGG - Intergenic
1141560335 16:84863592-84863614 AAGAAGGCTCAGAGAGGGTAAGG - Intronic
1142177923 16:88653361-88653383 AGCTCAGCTGAGAGAGGGGCCGG + Exonic
1143156016 17:4836559-4836581 AATGAAGCTTAGAGAGGGTAAGG - Intronic
1143527890 17:7482964-7482986 ACCTCAGCTGTGAGAGGGAAGGG + Exonic
1144115216 17:12082379-12082401 TTTTAAGCTCAGAGAGGGTATGG - Intronic
1145783400 17:27578542-27578564 GACTGAGCTCAGAGAGGGAAAGG + Intronic
1146274713 17:31509466-31509488 AACTCACCCCAGAAAGGGTGTGG - Intronic
1146523299 17:33543760-33543782 AGGTCAGTTCAGAGAGGTTAAGG + Intronic
1146887409 17:36481918-36481940 AACTCTGCTCAGTGAGGGGCGGG - Intergenic
1147145487 17:38482260-38482282 AAAACAGCCCAGAGAGGGGAAGG + Intronic
1147427897 17:40355036-40355058 AACTGGGCTCAGGGAGGGTTTGG + Intronic
1147978049 17:44259157-44259179 CCCTCATGTCAGAGAGGGTAAGG - Exonic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150164908 17:62932359-62932381 ACCTCAGCTCAGAGAAGCTAAGG + Intergenic
1150852802 17:68721090-68721112 AATGCAGCTCAGAGAGCTTAAGG - Intergenic
1152278836 17:79373324-79373346 AATGAAGCTCAGAGAGGGAAGGG + Intronic
1152290520 17:79437419-79437441 AGCTCAGCTCAGAGGTGCTATGG - Intronic
1152377210 17:79925008-79925030 ATCCCAGCTCGGAGAAGGTAAGG - Intergenic
1153748298 18:8202949-8202971 AACTCAGCTCAGGCAGCATAGGG + Intronic
1154217846 18:12428659-12428681 AGCTCAGTTCAGAGGAGGTAGGG + Intronic
1156679713 18:39573627-39573649 AACTCATCTCAGAGACAGAACGG + Intergenic
1156980027 18:43275644-43275666 AACTGAACTCAGAGAATGTAAGG + Intronic
1157408480 18:47443926-47443948 AATGCAGCTCAGAGAGGAGAAGG - Intergenic
1160539664 18:79613643-79613665 AACTCAGCTCAGAGCAGGTGCGG - Intergenic
1160807581 19:999314-999336 AACTCAGCTCTGGGAGGGTTGGG - Intergenic
1161162461 19:2768832-2768854 AGCTAAGCCCAGAGAGGGCAGGG - Intronic
1162312693 19:9916498-9916520 AACTGAGCTCAGAGAGGAGAGGG + Intronic
1164173431 19:22747438-22747460 AATTCACTTCAGAGAGGGTGTGG - Intergenic
1164514201 19:28920492-28920514 AACTCAGATCACAGAGAGCACGG - Intergenic
1165733002 19:38158427-38158449 AACTGAGATCAGGGAGGGGACGG + Intronic
1165785848 19:38461377-38461399 AACTGAGCACAGAGAGGCAAAGG + Intronic
1166087497 19:40486783-40486805 AGCTCAGTTCAGAGAGGACACGG - Intronic
1168181300 19:54664499-54664521 CACTGAGCTCAGAGAGGACAGGG - Intronic
925100313 2:1238725-1238747 AACTCAGCTTAGAGGGAGCAAGG - Intronic
926263252 2:11288164-11288186 GACTGAGCTCCCAGAGGGTAAGG - Intronic
926329043 2:11809917-11809939 AACAAAGCTCAGAGTGGGGAAGG - Intronic
927058850 2:19394128-19394150 ATCTCAAATCAGAGAGGGAAGGG - Intergenic
927714484 2:25342742-25342764 AGCTCATCTCAGAGAGGCTTTGG - Intergenic
928676915 2:33659548-33659570 AATTCATTTCAGAGAGGGTATGG - Intergenic
929030199 2:37643221-37643243 AATTCAGCTCACAGCAGGTATGG + Exonic
929560408 2:42952981-42953003 CACTCAGCTCTGAGAGGAGAAGG - Intergenic
929773869 2:44915681-44915703 AGCTCAGCTCAGAGAGTGAATGG + Intergenic
930614773 2:53582314-53582336 AACTGAGCTTAGAGGGGGTTTGG + Intronic
931229587 2:60363146-60363168 AACTCAGGTGAGAGAGGCTTTGG - Intergenic
938410426 2:131059281-131059303 GAGTCAGCTCAGAGAGGGGCAGG + Intronic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
939783409 2:146477670-146477692 AAGTTAGCTCAGAGAGTGAAAGG + Intergenic
945401788 2:209390788-209390810 AACTGAGGTCAGAGAGAATATGG - Intergenic
945440740 2:209876030-209876052 AATTCAGCTCAGAGAGGGAGAGG - Intronic
948438226 2:237967852-237967874 AACTGAGCCCAGGGAGGGGAAGG - Intronic
948750069 2:240127067-240127089 AACTTAGGACAGAGAGGGGAAGG + Intronic
1170349291 20:15421293-15421315 ACCTCAGCTCAGGGAGGCTGAGG + Intronic
1170601201 20:17843066-17843088 TCCTCAGCTCACAGAGGGAAAGG - Intergenic
1172984024 20:38968062-38968084 AAGTGAGCTCCGTGAGGGTAGGG + Intronic
1173208378 20:41012701-41012723 AAGTCAGCTCACAGTGGGAATGG + Intergenic
1173866445 20:46315489-46315511 CACTCAGCTCTGAGTGGGTGAGG - Intergenic
1174362344 20:50036958-50036980 ACTGCAGCTCAGAGAGGGTGGGG - Intergenic
1175355942 20:58368159-58368181 AACACAGGTCAGAGAGGTTAAGG - Intergenic
1176338280 21:5619255-5619277 AACTCTGCCTAGAGAGGGCATGG - Intergenic
1176339688 21:5682328-5682350 AACTCTGCCTAGAGAGGGCATGG - Intergenic
1176471942 21:7114481-7114503 AACTCTGCCTAGAGAGGGCATGG - Intergenic
1176495503 21:7496259-7496281 AACTCTGCCTAGAGAGGGCATGG - Intergenic
1176505139 21:7642128-7642150 AACTCTGCCTAGAGAGGGCATGG + Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1181538176 22:23557612-23557634 AATTCAGTTCAGAGAGGTTAAGG - Intergenic
1182162759 22:28139679-28139701 ACTTCAGCTCAGAGAAGCTAAGG - Intronic
1182461160 22:30485048-30485070 AAATGGGCACAGAGAGGGTACGG + Intergenic
1183304390 22:37074531-37074553 CACTCAGCTCAGAGCAGGAAAGG + Intronic
1183387061 22:37520855-37520877 AGCAGAGCTCAGAGAGGGCAAGG + Intergenic
1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG + Intronic
1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG + Intronic
950101466 3:10359426-10359448 AACTGAGGCCAGAGAGGGGAAGG + Intronic
950175122 3:10868147-10868169 ATGCCAGCCCAGAGAGGGTATGG + Intronic
950483134 3:13256996-13257018 AACTGGGCACAGAGAGGTTAAGG - Intergenic
950539485 3:13601701-13601723 ATGTCAGCTCCCAGAGGGTAGGG - Intronic
953843831 3:46410975-46410997 AACTCAGCTAAGTAAGGGTTTGG + Intronic
954168812 3:48782884-48782906 TATTCAGCCCAGAGAGGCTAAGG - Intronic
954324686 3:49856980-49857002 AACTGAGGACTGAGAGGGTAGGG - Intergenic
954435593 3:50494148-50494170 GACTCAGCTCACAGAGAGAAAGG + Intronic
955137374 3:56233077-56233099 AACACAGCTCTCTGAGGGTATGG + Intronic
956927638 3:74006146-74006168 AACCCAGCTCAGAGATGTTGGGG - Intergenic
967294414 3:187951145-187951167 TAGTCAGCTCTGTGAGGGTAGGG - Intergenic
967937129 3:194738206-194738228 ATGTCAGCTCAGAGAGGGAAGGG + Intergenic
968481000 4:833008-833030 AACTCAGCTCAGAGAGAAGCGGG - Intergenic
968911966 4:3480988-3481010 AGCTCAGCTGTCAGAGGGTAAGG + Intronic
969202804 4:5619074-5619096 AACTCAGCTCAGGGAGGTCAGGG + Intronic
969686042 4:8674821-8674843 TCCCCAGCTCAGAGAGGGTGGGG + Intergenic
970050062 4:11904362-11904384 AAACCAGCTCAGAGAGATTAGGG - Intergenic
976189625 4:82475931-82475953 AATTCATTTCAGAGAGGGTGTGG - Intergenic
977725585 4:100293356-100293378 AAATCAGCTCAGAGAGATAATGG - Intergenic
978351801 4:107826963-107826985 AACACAGCTCAGAGAGCCTCAGG - Intronic
978834451 4:113131956-113131978 AATTCAGCTCAAAGAGGAAAGGG - Intronic
980023850 4:127740845-127740867 ATCTCTGCACAGAAAGGGTAGGG + Intronic
980124181 4:128757813-128757835 AACTTAGCCCAGAGAGGGCCAGG - Intergenic
983032397 4:162819066-162819088 AAGTCAGATGAGAGAGGGTAGGG + Intergenic
987741206 5:21910876-21910898 AACTCAGATCCCAGAGGGTAAGG + Intronic
990686607 5:58309916-58309938 AACCCAAGTCAGGGAGGGTAGGG - Intergenic
991125675 5:63067196-63067218 AACTTGGCTAAGAGAGGGTAGGG - Intergenic
991353872 5:65747851-65747873 CACTCAGCTCAGATGAGGTAAGG - Intronic
991630668 5:68653708-68653730 AACTGAGCTCAGAGAGTTTTAGG - Intergenic
992400441 5:76406119-76406141 AACTCAGCTCAGGGCTGCTATGG + Intronic
994140276 5:96333836-96333858 AATGAAGCTCAGAGAGGCTAAGG - Intergenic
995206335 5:109485517-109485539 AATGCAGCTCAGAGAAGGGATGG + Intergenic
995396624 5:111693871-111693893 ATCTCAGCTGAGAGAGGCTGAGG + Intronic
997851786 5:137339501-137339523 AACAGAGCTCAGAGATGGGAAGG + Intronic
998587384 5:143441592-143441614 AACTGGGCTCAGGGAGGGGATGG - Intergenic
999102538 5:149038220-149038242 AAATCTGCTCAAAGAGGGGAGGG + Intronic
999249262 5:150172451-150172473 AATGAGGCTCAGAGAGGGTAAGG + Intronic
999398130 5:151243845-151243867 AACTGAGGCCAGAGAGGTTAAGG + Intronic
999676636 5:154010679-154010701 ATCAAAGCTCAGAGTGGGTAGGG - Intronic
1000204496 5:159045938-159045960 AACAAAGCTCAGATAGGCTATGG - Intronic
1000976111 5:167766169-167766191 ATTTAAGCTCAGAGAGGGTGAGG + Intronic
1001576468 5:172767703-172767725 AGCACAGCTCAGAGATGGGAAGG + Intergenic
1001647200 5:173290737-173290759 AGCTCTGCACAGAGAGGGCAGGG + Intergenic
1001953345 5:175831309-175831331 ATCGTAGCTCAGAGAGGGGAAGG + Intronic
1002102636 5:176864988-176865010 AACTGAGCCCAGGGAGGGGAGGG - Intronic
1003339011 6:5201918-5201940 AAATGAGCTCAGAGAGGTTAAGG - Intronic
1004187307 6:13432005-13432027 AACACAGCTCAGGGAGGAGAGGG + Intronic
1004284061 6:14304230-14304252 AACCCAGCACATACAGGGTAAGG - Intergenic
1006844352 6:37051989-37052011 AAACAAGCTCAGAGAGGTTAAGG - Intergenic
1006993485 6:38236169-38236191 AACGCATCTAAAAGAGGGTATGG - Intronic
1007387338 6:41528697-41528719 ATCACAGCTCAGAGTGGGTTTGG + Intergenic
1010635824 6:78258294-78258316 AAATCAGCTTGGAGTGGGTAGGG - Intergenic
1012117884 6:95326837-95326859 ATCTTAGCTCAGGGAGGCTAAGG + Intergenic
1013109546 6:107054066-107054088 AAACCAGCTCAGAGAGGTTAAGG - Intergenic
1013605330 6:111742183-111742205 ATCTAACCTCAGAGAGGTTAAGG + Intronic
1014882077 6:126735799-126735821 AAATCAGCTCACAGAGACTATGG - Intergenic
1015787321 6:136931240-136931262 ACCTGAGCTCAGAGTGGGAAGGG - Intergenic
1017237661 6:152133686-152133708 AACTGAGATCAGAGACGGTCAGG - Intronic
1018932591 6:168251130-168251152 AATTAAGGTCAGAAAGGGTAAGG - Intergenic
1019938450 7:4271243-4271265 AGCTCAGCTCAGAGATGCTTTGG - Intergenic
1022127036 7:27368550-27368572 TGCTCAGATCAGAGAGGGTGTGG - Intergenic
1024294288 7:47830382-47830404 AACAGAGCACAGAGAGGGGAAGG + Intronic
1024393299 7:48839240-48839262 AGCTCAGATGGGAGAGGGTAAGG + Intergenic
1025573837 7:62609009-62609031 CACTCATCTCACAGAGGGAAAGG - Intergenic
1026014957 7:66665559-66665581 CACTCAGCTCAGAGGTGGTGAGG - Intronic
1026175135 7:67989962-67989984 AACTCAGGTCAGAGAGGAGATGG - Intergenic
1026891706 7:73986255-73986277 ATCCCAGCTCAGGGAGGGTGGGG + Intergenic
1027535983 7:79402505-79402527 ATAGAAGCTCAGAGAGGGTAAGG + Intronic
1029256353 7:99272310-99272332 AACTGAGGTCTGAGAGGTTAAGG + Intergenic
1029606492 7:101602269-101602291 GACTGAGGCCAGAGAGGGTAAGG - Intergenic
1029817822 7:103114559-103114581 AACTTGGCTCTGAGAGGGCAGGG - Intronic
1031519417 7:122745335-122745357 AACTAAGCTCAAAGAAGTTAAGG + Intronic
1031750659 7:125569033-125569055 AACAGGTCTCAGAGAGGGTAAGG + Intergenic
1032012183 7:128353875-128353897 AAGTCACCTAAGAGAGGGTGAGG + Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033860211 7:145615309-145615331 AACTCTGCTCTGAGTGGGTGTGG + Intergenic
1037089313 8:14894287-14894309 AAGTCAACTGAGAGAGGTTATGG - Intronic
1037638709 8:20723181-20723203 AACTCTGCTCACAGTGGGCATGG - Intergenic
1043333348 8:79143852-79143874 ATCTCAGGTCAGTGAGAGTATGG + Intergenic
1044474642 8:92612083-92612105 AACCAAGCTCAGAGAGGTTCTGG - Intergenic
1045181736 8:99791626-99791648 AACTGAGCTAAGACAGAGTAAGG + Intronic
1045507422 8:102788630-102788652 ATCGAAGCTCAGAGAGGTTATGG - Intergenic
1047336825 8:123943875-123943897 ACCTCACCTCGGAGAGGTTAGGG - Intronic
1048408429 8:134146567-134146589 AACTGAGCTTAGAGAGGTAAAGG + Intergenic
1048639070 8:136332666-136332688 AATACAGCTCAGAGAGGTTAAGG - Intergenic
1049082261 8:140452582-140452604 AAATTGGCTCAGAGAGGTTATGG - Intronic
1049546683 8:143235113-143235135 ACCACGGCTCAGAGAGGGCAGGG - Intergenic
1050741654 9:8827194-8827216 AACTAAGCTCACTGAGGGTAAGG + Intronic
1052859826 9:33430769-33430791 AATTCAGATGAGAGAGGGCAGGG - Intergenic
1056278099 9:85013093-85013115 AACACAGCTCAGGGCAGGTAAGG - Intronic
1057213502 9:93214708-93214730 AACTCAGCAAAGAGAGGGCGGGG - Intronic
1057743817 9:97735583-97735605 AACTGAGGCCAGAGAGGGAAAGG - Intergenic
1057846658 9:98531237-98531259 GACCCCGCTCAGAGAGGCTAGGG - Intronic
1058575080 9:106392391-106392413 GTCACAGCTCAGAGAGGTTAAGG - Intergenic
1060204222 9:121673135-121673157 AAATCAGCTCAGAGAGAGAAAGG + Intronic
1060449646 9:123724689-123724711 ACCTGTGCTCAGAGAGGTTATGG - Intronic
1060597336 9:124856360-124856382 CACTCAGCTCCAAGTGGGTATGG - Intronic
1061122786 9:128654449-128654471 AGGTGAGGTCAGAGAGGGTAAGG - Intronic
1061177458 9:129006352-129006374 AGCTCAGCTCTGAGTTGGTACGG + Exonic
1061243803 9:129390948-129390970 AATTGAGTTCAGAGAGGTTAAGG + Intergenic
1061800134 9:133109188-133109210 CACACAGCTCTGAGAGAGTAAGG - Intronic
1062600844 9:137318034-137318056 AACTGAGCACAGAGAATGTAAGG + Intronic
1187255827 X:17641074-17641096 AACTCAGTGGAGAGAGGGAAAGG - Intronic
1187398026 X:18934920-18934942 GCCTCAGCTCAGAGAGGCTGTGG - Intronic
1188930464 X:36103463-36103485 CACTCAGCTCACAGAGGGCAAGG - Intronic
1190276592 X:48903213-48903235 AACTCAGCTAAGAGATAGTGTGG + Intronic
1190822680 X:53988301-53988323 AAAGCAGCTCAGTGAGGGAAAGG + Intronic
1191167221 X:57403553-57403575 AATTCATTTCAGAGAGGGTGTGG + Intronic
1191721025 X:64228931-64228953 AACTGAGTCCAGAGAGGGTAAGG + Intronic
1191842502 X:65523401-65523423 AACTGAGTCCAGAGAGGGGAGGG - Intronic
1192509112 X:71711766-71711788 CACTCAGCTCAGACAGGCTCCGG - Intergenic
1192517585 X:71769787-71769809 CACTCAGCTCAGACAGGCTCCGG + Intergenic
1192940105 X:75902906-75902928 AATTCATTTCAGAGAGGGTGTGG + Intergenic
1197741189 X:129895600-129895622 AACTCAGTACAGAGAGGGACTGG + Intergenic
1198180953 X:134208675-134208697 AAATCAGCACAGAGAGGCAAAGG + Intergenic
1200125257 X:153810445-153810467 CAGTCAGCACAGAGAGGGCAGGG + Intronic
1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG + Intronic