ID: 1140772487

View in Genome Browser
Species Human (GRCh38)
Location 16:78217599-78217621
Sequence GAGCCCTCTGTTAAGTTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140772487_1140772488 6 Left 1140772487 16:78217599-78217621 CCGAGAAACTTAACAGAGGGCTC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1140772488 16:78217628-78217650 GAAATCTATTGAAAGTTACTAGG 0: 1
1: 0
2: 0
3: 17
4: 252
1140772487_1140772490 21 Left 1140772487 16:78217599-78217621 CCGAGAAACTTAACAGAGGGCTC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1140772490 16:78217643-78217665 TTACTAGGTGCCAGGTGTCTCGG 0: 1
1: 0
2: 0
3: 13
4: 187
1140772487_1140772489 13 Left 1140772487 16:78217599-78217621 CCGAGAAACTTAACAGAGGGCTC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1140772489 16:78217635-78217657 ATTGAAAGTTACTAGGTGCCAGG 0: 1
1: 0
2: 9
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140772487 Original CRISPR GAGCCCTCTGTTAAGTTTCT CGG (reversed) Intronic
900576415 1:3384767-3384789 GAGCCCTCTGCTAAGGAGCTGGG - Intronic
904366999 1:30018820-30018842 GATCCTCCTTTTAAGTTTCTTGG + Intergenic
907687746 1:56630506-56630528 TACCACTCTGTCAAGTTTCTTGG - Intronic
910684642 1:89903829-89903851 GAGCCAGCTATAAAGTTTCTGGG - Intronic
911999498 1:104812839-104812861 GAGCTCTCTGTTAAGGACCTTGG - Intergenic
915782966 1:158574073-158574095 AAGCCATCTGTTAAATTTATTGG + Intergenic
916287712 1:163129120-163129142 GTGCCTTCTGTCAAGTTCCTAGG - Intronic
918415177 1:184298864-184298886 GAGACCTCTGGTAATTTTCCAGG - Intergenic
919426191 1:197434232-197434254 GACTCCACTGTTAATTTTCTGGG + Intronic
924891901 1:248291749-248291771 GAGGCCTCTGTTCTGTTTATTGG - Intergenic
1063464889 10:6236731-6236753 GAGCAGTCTTTTAATTTTCTGGG - Intergenic
1066383806 10:34924281-34924303 GAGCCCATTGTTAAGTTTTCAGG + Intergenic
1067229601 10:44397140-44397162 GGGACCTCTGTGAAGTCTCTGGG + Intergenic
1068468041 10:57420667-57420689 GTGGCCTGTGTTAAGTGTCTGGG + Intergenic
1069769262 10:70887534-70887556 GAGCCCACTGTTTACTTCCTTGG + Intronic
1070635559 10:78124242-78124264 GAGCCCTCTTTTAAATTTCCAGG - Intergenic
1070920285 10:80180411-80180433 GAGCCCTGTGTTGTCTTTCTGGG - Intronic
1071219486 10:83447274-83447296 GAGGCCTCTGTTCTGTTTCATGG - Intergenic
1073448812 10:103597303-103597325 GTGCCCTCAGTTCAGTTTCTAGG - Exonic
1078562916 11:12389053-12389075 GATCCCTCTGATAGGTTGCTTGG + Intronic
1080062141 11:27968307-27968329 GAGACCTCAGTCAAGTTACTTGG - Intergenic
1080456234 11:32422076-32422098 GCACCCTCTGTTAAGTTATTAGG - Intronic
1081478044 11:43455758-43455780 AAGTCCTCTGTGAAGTATCTGGG - Intronic
1082871704 11:57948882-57948904 GAGGCCTCTGTTCTGTTCCTTGG + Intergenic
1082999594 11:59279441-59279463 CAGCCCTCAGTAAAATTTCTGGG + Intergenic
1083049691 11:59766075-59766097 GAGCCCCCAGGAAAGTTTCTGGG - Intronic
1085672550 11:78481635-78481657 AACCCTTCTGTTAGGTTTCTGGG - Intronic
1089891513 11:121886236-121886258 GAGCTCTCTGTTAATTGACTTGG - Intergenic
1091663474 12:2401315-2401337 GTGCCCACAGTTAAGTTTCAAGG + Intronic
1091860595 12:3778572-3778594 GAGGCCTGTGGTAATTTTCTGGG - Intergenic
1099522938 12:83686348-83686370 GAGGCCTCTGTTCAGTTCCATGG - Intergenic
1103435236 12:120920343-120920365 GAGCCCTCTGGAAAGTATTTGGG + Intergenic
1103870803 12:124090249-124090271 GAGCCCTCTCTTCAGTCTCTTGG + Intronic
1106018002 13:25887145-25887167 GAGGCTTCTGCTAAGTGTCTGGG + Intronic
1106750011 13:32753363-32753385 AAGGCCTTTGTGAAGTTTCTGGG - Exonic
1107659550 13:42625013-42625035 AAGCCCTCTCTGAACTTTCTGGG - Intergenic
1109136720 13:58660899-58660921 GATCCCTCTTTTGATTTTCTTGG - Intergenic
1112718284 13:102212367-102212389 GATCCCTTTGGTAAGTTTCTGGG - Intronic
1113340407 13:109417852-109417874 GTGAACACTGTTAAGTTTCTTGG + Intergenic
1117192541 14:53306984-53307006 GAAGCCCCTGTTAAATTTCTGGG - Intergenic
1124646956 15:31444031-31444053 GAGCAATCTGGTAAATTTCTAGG - Intergenic
1128690844 15:69723736-69723758 GAGCCCTCTGTTACTGTTCAGGG + Intergenic
1135023252 16:18980062-18980084 GAGACCTCGGTTATTTTTCTAGG - Intergenic
1140772487 16:78217599-78217621 GAGCCCTCTGTTAAGTTTCTCGG - Intronic
1141281945 16:82636863-82636885 GAGCCCCTTGTTAAGTTTTTAGG - Intronic
1142912183 17:3103683-3103705 GACCCCTCTGTTGTGTTGCTGGG + Intergenic
1143206689 17:5146327-5146349 GAAAACTCTTTTAAGTTTCTGGG - Intronic
1147241732 17:39095070-39095092 GAGCCTGGTGTGAAGTTTCTAGG - Intronic
1147892384 17:43726534-43726556 AGGCCCTGTGTTAAGATTCTGGG + Intergenic
1148515408 17:48212271-48212293 GAGGCCTCTGTTATGATTCTTGG - Intronic
1149446357 17:56716261-56716283 GAACCCAGTGTTCAGTTTCTTGG - Intergenic
1149943930 17:60900321-60900343 GCTCCCTATGTTAAGTTTCAGGG + Intronic
1156007350 18:32458661-32458683 GAGCCCTTTGTTCAATTTTTTGG - Intronic
1156616926 18:38798258-38798280 GAGTCCTCTGAGAAGTTTCTGGG + Intergenic
1159127229 18:64237809-64237831 GTGCCCTCTGTAAAGTGTCTGGG + Intergenic
1161842101 19:6688480-6688502 GAGCCCAGTGTTAAATTTCCAGG - Intronic
1163271823 19:16259025-16259047 GAGCCTTTTCTGAAGTTTCTGGG + Intergenic
928786455 2:34892507-34892529 GAGCCCTCTTTTCACTTTCGAGG + Intergenic
933218780 2:79663458-79663480 GAGCCCTTCTTTCAGTTTCTTGG + Intronic
933437387 2:82264876-82264898 GAGCCCTTTGTGAAGTTTTGTGG - Intergenic
934807959 2:97253351-97253373 GAGCCGTCTGTTCAGGTTATCGG - Intronic
934829551 2:97503836-97503858 GAGCCGTCTGTTCAGGTTATCGG + Intronic
938191098 2:129281416-129281438 GAGCCCTCTGTTTAGTATTCTGG - Intergenic
939380424 2:141428456-141428478 GGGCTCACTGTTAAATTTCTGGG + Intronic
944506280 2:200415047-200415069 GTCCCTTTTGTTAAGTTTCTTGG - Intronic
945504950 2:210628540-210628562 TAGGCTTCTGTTAAGTTTTTAGG + Intronic
946838209 2:223794206-223794228 TAGCCCTCTATTAATATTCTGGG + Intronic
947992871 2:234500611-234500633 GTGCCCTCTGCTGAGCTTCTCGG + Intergenic
1169860758 20:10149354-10149376 GAGGGCTCTCTTAATTTTCTTGG - Intergenic
1172329405 20:34064552-34064574 GACACCTTTGTGAAGTTTCTAGG + Intronic
1172933197 20:38600698-38600720 GGGCCCTGTTTTCAGTTTCTTGG + Intergenic
1177196682 21:17910981-17911003 GAGCCAATTGTTAAGTTTTTAGG + Intronic
1177247956 21:18554670-18554692 GAGCCATCTCTTTAGTTACTGGG - Intergenic
1177639269 21:23825693-23825715 GAGCATTCAGTTCAGTTTCTTGG + Intergenic
1181451149 22:23022444-23022466 CAGCCCTTTGTTAGGTATCTAGG + Intergenic
1181528913 22:23504932-23504954 CAGCTCTCTGTCCAGTTTCTGGG - Intergenic
1184048697 22:41988578-41988600 CAGCCTTCTGTTGAGTTCCTGGG - Intronic
1185318932 22:50191312-50191334 GAGCTCTCTGTGCAGTGTCTAGG - Intronic
954346099 3:50000722-50000744 GAGCCTTCTTTTAAGATTCTGGG - Intronic
961582716 3:127895744-127895766 GAGTCATCTGTTATGTTCCTTGG - Intergenic
961699069 3:128727342-128727364 GAGCACTGTATTAAATTTCTAGG + Intronic
962004056 3:131330561-131330583 GAGGACCTTGTTAAGTTTCTTGG + Intronic
962351020 3:134655783-134655805 AAGACCTCTGTTGAGGTTCTTGG + Intronic
963217953 3:142772444-142772466 GAGCCCTGTATTAGTTTTCTGGG + Intronic
963884912 3:150571096-150571118 CAACCCTCTGTTATATTTCTTGG - Intronic
967806127 3:193715971-193715993 GAGCCATCTGCTTAGCTTCTGGG - Intergenic
971638282 4:29093450-29093472 AAGCATGCTGTTAAGTTTCTTGG + Intergenic
976099440 4:81545189-81545211 GAGGCCTCTGTTCTGTTTCATGG - Intronic
976698546 4:87944332-87944354 GAGCTGACTGTTAAATTTCTGGG - Intergenic
979801120 4:124910200-124910222 GAGCCCTCTCTTTTTTTTCTTGG + Intergenic
980385041 4:132078050-132078072 GAACCCTCTTTTAAGTTTCTAGG - Intergenic
983344774 4:166513881-166513903 AAACCCTCTGTTTAGTTTCTAGG + Intergenic
985193540 4:187403491-187403513 GAGGCCTCTGTTGTGTTCCTTGG + Intergenic
990100474 5:52178887-52178909 AAACTCTCTGTTAAGTTTTTTGG + Intergenic
990364585 5:55057305-55057327 GAGCCAACTGTTAAATTTTTAGG - Intergenic
990870401 5:60425343-60425365 GAGGCCTCTGTTCTATTTCTTGG - Intronic
991589135 5:68230838-68230860 GAGCCCTATGTTATGTTCTTCGG + Intronic
995266709 5:110170699-110170721 AATCTCTCTGTTAAATTTCTTGG - Intergenic
998898550 5:146826775-146826797 GAGCCATCTGTGAATGTTCTTGG - Intronic
1000809969 5:165849133-165849155 GAGCCATCTGTTCAGATCCTTGG - Intergenic
1001172330 5:169431526-169431548 GTGACCTTTGTAAAGTTTCTGGG - Intergenic
1004184151 6:13407551-13407573 GAGCCCTTTGTTATGTCTCTAGG + Intronic
1006139749 6:31921096-31921118 AAGGCCTCTGCTAAGTTCCTCGG - Intronic
1006772611 6:36566246-36566268 GAGAGCTCTGTTAAATTTATTGG - Intergenic
1007163752 6:39813260-39813282 GAGCCCTCTAGTGAGTTTTTGGG + Intronic
1008200474 6:48581899-48581921 GAACCCTGTATTAATTTTCTGGG - Intergenic
1008544107 6:52570742-52570764 GAGGCCTCTGGTGAGTTTGTAGG - Intronic
1009885281 6:69617491-69617513 GAGCCCTCGGATAACTTGCTGGG - Intergenic
1011554488 6:88560466-88560488 GCGCCCTCTGATTAGTTTCAAGG + Intergenic
1012902237 6:105019675-105019697 GCTCCTTCTGTTAATTTTCTTGG + Intronic
1013281053 6:108637348-108637370 AAGCCCTCTGTCTGGTTTCTAGG - Intronic
1014524315 6:122482919-122482941 GAGCTTGCTGTTAAGTTTCTTGG + Intronic
1015581236 6:134727670-134727692 AAGCTCTCTGAGAAGTTTCTAGG + Intergenic
1020692413 7:11372084-11372106 CAGACCCCTGTTAAGTTCCTGGG - Exonic
1021730023 7:23586868-23586890 GTGCCCTCTGTAAATTATCTGGG + Intergenic
1021740219 7:23679407-23679429 GCGCCCTCTGTAAAGTATCTGGG - Intergenic
1021814263 7:24432264-24432286 GTGCCCTCTGTAAATTATCTGGG - Intergenic
1021915830 7:25431525-25431547 GAGCCTTCTATCAAGGTTCTAGG + Intergenic
1022311089 7:29196247-29196269 AAGCCATCTGTTATCTTTCTTGG + Intronic
1022506179 7:30909871-30909893 GAGCTCTCTGGTCAGTTTCAGGG - Intergenic
1023254217 7:38296920-38296942 GATCCCTCTGTTAATGTTTTGGG + Intergenic
1030100340 7:105940353-105940375 GAGCCCTGTGTCCAGTTTGTAGG + Intronic
1035611644 8:969501-969523 GAACCAACTGTTAAGTTTTTAGG + Intergenic
1037626197 8:20609200-20609222 CAGCCCAGTGTGAAGTTTCTGGG - Intergenic
1038376518 8:27045381-27045403 GAGCCAACTGTTAAGTTTTCAGG + Intergenic
1038664251 8:29523900-29523922 GAGCTATCGGTTAAGTTTATAGG - Intergenic
1039051511 8:33498866-33498888 AACTCATCTGTTAAGTTTCTCGG - Exonic
1039160860 8:34617969-34617991 GGGCTCTCTGTTATGTTTATAGG + Intergenic
1039179536 8:34849983-34850005 GTGCCCTCTGGTCAGTTTATTGG - Intergenic
1039730872 8:40275651-40275673 GAGATGTCTGTTAAGTTCCTTGG + Intergenic
1041488551 8:58406581-58406603 GAGCCTACTGTTAAATTTTTAGG - Intergenic
1042218544 8:66451028-66451050 GGGGCCTCTGTAATGTTTCTGGG - Intronic
1044011776 8:87003032-87003054 GTGCCCTCTGCCAAGTTTCATGG - Intronic
1047477042 8:125242593-125242615 GGGCCCTCTGTTTACTTTCCAGG - Intronic
1051758105 9:20427764-20427786 GAGCCAGCTGTTAAATTTTTAGG + Intronic
1052615574 9:30835712-30835734 GAGGTCTCTGTTAAGGTCCTTGG + Intergenic
1055018760 9:71646835-71646857 GAGCCCACTGTTAAATATTTAGG - Intergenic
1056888820 9:90470229-90470251 GAACCCTCTGGTAAGCTGCTGGG + Intergenic
1057498238 9:95576966-95576988 CTGTACTCTGTTAAGTTTCTGGG + Intergenic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1061606073 9:131711868-131711890 TAATGCTCTGTTAAGTTTCTGGG + Intronic
1187302535 X:18064984-18065006 GAGCCATCTGCTAGGTTTTTTGG + Intergenic
1187641652 X:21297648-21297670 GAGTCTTCTCTTGAGTTTCTTGG + Intergenic
1193220651 X:78922361-78922383 GAGCCCTCTGTCATGTTTCATGG + Intergenic
1195317253 X:103691272-103691294 GAACCCTGTGTTAATTTTCAAGG + Intergenic