ID: 1140773805

View in Genome Browser
Species Human (GRCh38)
Location 16:78230933-78230955
Sequence CCATTGCCTCAAAGCAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140773805_1140773810 20 Left 1140773805 16:78230933-78230955 CCATGATTGCTTTGAGGCAATGG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1140773810 16:78230976-78230998 CCTTATTTACGCACTGACTGTGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140773805 Original CRISPR CCATTGCCTCAAAGCAATCA TGG (reversed) Intronic
900848071 1:5119739-5119761 CCATGGGCTCAAAAGAATCAGGG - Intergenic
903452358 1:23462902-23462924 CCATTCCTTCAAAGCAGACATGG - Intronic
904351702 1:29911936-29911958 CCATTGTCTGAAAGAAGTCATGG - Intergenic
905600837 1:39249152-39249174 CCATTCCATCAAAGAAACCAAGG - Intronic
906269738 1:44466951-44466973 CCAATGCCTCAAAGCTTTAAAGG - Intronic
906964593 1:50443985-50444007 GGATTGCTTCAAAGCAAACACGG + Intronic
908359534 1:63355369-63355391 CCATTGGCTTAGAGCTATCATGG - Intergenic
914929813 1:151921032-151921054 CCATTACCTGCAAGCCATCAGGG - Intergenic
915911101 1:159916085-159916107 CCAGGGCCACAAAGCAATTAAGG - Intergenic
915990149 1:160506334-160506356 CCACTGCCTCCTGGCAATCATGG - Intronic
917042599 1:170822654-170822676 CCATTGCATTAAACAAATCAAGG + Intergenic
919832489 1:201552012-201552034 CCATGGCCAGAAAGAAATCAGGG + Intergenic
919978615 1:202628670-202628692 CCATGGCCTCAAAACACCCATGG + Intronic
921818286 1:219588576-219588598 CCACTGCCTGAAAGCTTTCACGG + Intergenic
922000649 1:221474390-221474412 CCATTGCATTCAAGGAATCAAGG + Intergenic
922000752 1:221475712-221475734 CCATTGCATTCAAGGAATCAAGG - Intergenic
1063765685 10:9137693-9137715 CCATTGCTTCAAATCACTCGTGG - Intergenic
1069486296 10:68826240-68826262 CCTGTGCCTCAAAGCAGTGAAGG - Intergenic
1070094102 10:73319588-73319610 TCATTGCCTGCAAGCCATCAGGG + Intronic
1070500949 10:77071989-77072011 CCATTTCCTCAAAACCATCAAGG + Intronic
1072296692 10:94015302-94015324 CCATTGCAGGAAAGCAACCAAGG + Intronic
1074438189 10:113452391-113452413 TCATTGTCTCAAGCCAATCAGGG - Intergenic
1080578295 11:33620058-33620080 CCATTTCCTCAAAACTGTCAAGG - Intronic
1083202291 11:61127783-61127805 CAGTGGCCTCAAAGCAACCATGG + Exonic
1083275656 11:61595568-61595590 CCATTTCCTCCAAGGAGTCAGGG + Intergenic
1088085604 11:105975370-105975392 CCATTGCTTTTAAGCAATCCAGG + Intronic
1098753488 12:74326163-74326185 CCTTTGTCTCAAAGCATTTAGGG - Intergenic
1101131533 12:101696387-101696409 CCACTGCCTTAGAGCAATGAGGG - Intergenic
1101494543 12:105241253-105241275 CCATCGGCTCAAAGCAATAATGG + Intronic
1107138013 13:36965651-36965673 CCTTTGTGTCAAAGGAATCAGGG - Exonic
1108470412 13:50761674-50761696 TCATTGCCCCAAATGAATCATGG + Intronic
1108845082 13:54668432-54668454 CAATGGCCTCTAAGCATTCAAGG - Intergenic
1109471128 13:62805501-62805523 CCATAGCTTTAAAGCAATAAAGG + Intergenic
1111686406 13:91506967-91506989 CCAATGCCCCAAAGTAACCATGG + Intronic
1112192174 13:97188707-97188729 CCTCTGCCTAAAAGAAATCAGGG - Intergenic
1112204589 13:97311714-97311736 CCATGACCTCAAAGCAAACAAGG - Intronic
1112802082 13:103123968-103123990 CATGTGCCCCAAAGCAATCACGG + Intergenic
1115705223 14:35991292-35991314 TCATTCTCTCAAAGCAACCAGGG - Intergenic
1117069429 14:52043412-52043434 CCCTTCCCTCAAAACAATCTTGG - Intronic
1121320562 14:92989361-92989383 CCATCACCCCAAAGCAGTCAGGG + Intronic
1122801226 14:104230631-104230653 CCTGGGCCTCAGAGCAATCAGGG + Intergenic
1124494230 15:30176590-30176612 CCATGGCCTCAAAACACCCATGG + Intergenic
1124749340 15:32362055-32362077 CCATGGCCTCAAAACACCCATGG - Intergenic
1126639458 15:50810601-50810623 CCATTACCTCAAGTTAATCAAGG - Intergenic
1127570515 15:60236808-60236830 CCATTACCTGTAAGCCATCAGGG + Intergenic
1127922519 15:63504588-63504610 CCCTTGCGTCAAAGAAAGCACGG - Intronic
1128804202 15:70518531-70518553 CCATCACCTCAGAGCAAACAGGG + Intergenic
1129185917 15:73906422-73906444 CCATTCACTCAAAGACATCAGGG - Intergenic
1132422548 15:101684812-101684834 CCATTGCCTCTAAGCCACCGTGG + Intronic
1133834807 16:9358464-9358486 CCATAACCACAAAGAAATCATGG - Intergenic
1134564736 16:15241368-15241390 TCAATACGTCAAAGCAATCATGG - Intergenic
1134737762 16:16515331-16515353 TCAATACGTCAAAGCAATCATGG + Intergenic
1134929741 16:18196828-18196850 TCAATACATCAAAGCAATCATGG - Intergenic
1137743297 16:50801941-50801963 CCCTTCCCTCAAAGAAATCCAGG - Intergenic
1138262923 16:55638294-55638316 CCATTCACTCAAAGCACTCTCGG + Intergenic
1138724601 16:59122040-59122062 CCATTTCCTGACAACAATCAGGG + Intergenic
1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG + Intergenic
1139818095 16:69693543-69693565 CCAATGCCTCAAAGCCAACAAGG + Exonic
1140268423 16:73441027-73441049 CCAGTGCTTAAAAGAAATCAGGG - Intergenic
1140773805 16:78230933-78230955 CCATTGCCTCAAAGCAATCATGG - Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1143605164 17:7979564-7979586 CCATTGCTCCAAAAAAATCAGGG + Intergenic
1145277712 17:21444449-21444471 CAATGGCCTCTAAGCGATCAGGG - Intergenic
1146146667 17:30424799-30424821 TCATTGCCTGGAAGAAATCATGG - Intronic
1146330269 17:31921294-31921316 CTATTGCTTCAAAATAATCATGG + Intergenic
1149044183 17:52225346-52225368 CCATTGCCATAAAACAATCTAGG - Intergenic
1150345042 17:64398109-64398131 CCTTTGCCTCAACCCAATCAAGG - Intronic
1155352130 18:24917382-24917404 CCATTGGCTCAGAGCAAAGAAGG + Intergenic
1158841044 18:61387854-61387876 CCATTGCCCCTATACAATCAGGG - Intronic
1163244117 19:16082074-16082096 CCATTTTCTAAAAGCAAACACGG - Intronic
926547654 2:14261826-14261848 TCATTTCCTCATAGCAGTCATGG + Intergenic
929514146 2:42591015-42591037 TCCTTGTCACAAAGCAATCATGG - Intronic
930278090 2:49337292-49337314 CCATTGCCTCAGAGTAAATAAGG + Intergenic
931091239 2:58888777-58888799 CCATTGCTTTAGAACAATCAGGG - Intergenic
932610180 2:73193163-73193185 CCAGTGCCTAGAAGCAATCCAGG - Intergenic
941277778 2:163512557-163512579 GCTTTGCCTCAAACTAATCAAGG - Intergenic
947107661 2:226684712-226684734 GCATTGAATGAAAGCAATCACGG - Intergenic
947392322 2:229651893-229651915 GCATAGCCTTAAAGCAACCATGG + Intronic
1169219420 20:3812957-3812979 ACATTGGCTCTAAGCAATAATGG - Intergenic
1169607013 20:7333271-7333293 CCATATCCTAAAAGCAATAAGGG + Intergenic
1171062598 20:21980984-21981006 TCATTGCTTCAAAGCATTAATGG - Intergenic
1178407353 21:32335506-32335528 CCAGCGCCTCCAGGCAATCAAGG + Intronic
1180468665 22:15637645-15637667 CCATTGCCTCACTGCCAACAGGG - Intergenic
1183024213 22:35051948-35051970 ACATTGCCTCAGAGGTATCAGGG + Intergenic
1185302910 22:50092164-50092186 CAATGGACTGAAAGCAATCAGGG + Exonic
951985607 3:28617108-28617130 CCATTTCCTCAAAGGAAGGAAGG - Intergenic
952716772 3:36487799-36487821 ACATTGCCTCAAAGCAGTGAGGG + Intronic
955084035 3:55685243-55685265 CCATTGACTCAAGTCAGTCAGGG - Intronic
959498946 3:107083123-107083145 CCATTGGGTTAAAGCCATCAGGG + Intergenic
961474846 3:127140220-127140242 CCAGTGCCTCAAGCCAAGCAGGG - Intergenic
964330564 3:155597755-155597777 TCCTTTCCTCAAAGAAATCAAGG + Intronic
965274272 3:166660721-166660743 CAATTGACTCAAAGAACTCAGGG + Intergenic
965950165 3:174299128-174299150 CCATGCCCTCAAGGAAATCAAGG - Intergenic
968940536 4:3635229-3635251 CCAGGGCCTCAAAACCATCATGG + Intergenic
969322514 4:6421216-6421238 CCAATGCCACAAAGGAGTCAGGG + Intronic
970356944 4:15263809-15263831 CCAGTGCCTCAATGCACTCTTGG + Intergenic
972589860 4:40474725-40474747 CCTTTGGCAAAAAGCAATCAGGG + Intronic
974900152 4:67986895-67986917 ACATTGTCTCAAAGCAATGTAGG + Intergenic
982358961 4:154498094-154498116 CCATTGAATCAAGGCAGTCAGGG + Intergenic
983302317 4:165942465-165942487 CTTTTGCCTCAACCCAATCATGG - Intronic
988503777 5:31804354-31804376 CTATTGCCTTATAACAATCAAGG + Intronic
988518961 5:31929270-31929292 CCATAGAATGAAAGCAATCATGG + Intronic
991224385 5:64252706-64252728 CCTGTGCCTCAAAGAGATCAAGG + Intronic
991994041 5:72369997-72370019 GCATTACCTCAAAGCAAAGAAGG + Intergenic
995802986 5:116019895-116019917 CCCTTGTCTCAGAGCATTCATGG + Intronic
997142827 5:131400898-131400920 CTATTGCCCCAAAGCATCCATGG - Intergenic
1007207509 6:40164548-40164570 CCCCTGCCTCAAAGCACTCTGGG + Intergenic
1008404196 6:51100574-51100596 GAATTGCCTCAAAGCAGGCAAGG + Intergenic
1008666733 6:53724358-53724380 TCAGTTCCTCAGAGCAATCATGG - Intergenic
1010547219 6:77173178-77173200 CCATTGCCTCAGAGCTATTGTGG + Intergenic
1012178856 6:96125385-96125407 CCATTGCCACAATGTAATTAAGG - Intronic
1012449327 6:99338589-99338611 CCACTGCCCCAAAGCTGTCATGG + Intronic
1013087149 6:106866456-106866478 CCATTGGCTAAAAGGCATCAAGG - Intergenic
1016285418 6:142467579-142467601 CACTTGTCTGAAAGCAATCAAGG + Intergenic
1021355431 7:19649239-19649261 CCCTTGAGTCAAAGCATTCAAGG + Intergenic
1022662225 7:32377886-32377908 CCATTGACACAAAACAAACAAGG - Intergenic
1028235236 7:88353275-88353297 TCTTTGCCTCAAAGTAATAATGG + Intergenic
1029859801 7:103557891-103557913 CCTTTTCCACAAAGAAATCACGG - Intronic
1031744312 7:125474075-125474097 CCACTGCCACAGAGCAGTCAAGG + Intergenic
1033724682 7:144102227-144102249 CCAATCCTTCAAAGCACTCATGG - Intergenic
1034343993 7:150374707-150374729 CCCTTGCTTAAAAGCCATCAGGG - Intronic
1040288670 8:46113260-46113282 CCCTTGCTTCAAAGCCATGAAGG + Intergenic
1041631104 8:60088096-60088118 CCATTGCCTCAAAATACTCCTGG - Intergenic
1041649087 8:60283575-60283597 CCACAGTCTCAAAGCAATTAAGG - Intergenic
1043012741 8:74900871-74900893 CCATTAGCTGAAAGCCATCAGGG - Intergenic
1044458607 8:92417817-92417839 ACTTTGCCTCAAAGAACTCAGGG - Intergenic
1049370062 8:142260095-142260117 CCATTGGCTCTAGGGAATCAAGG - Intronic
1057257707 9:93563865-93563887 CCACTGCCACAAAACAAACAGGG - Intronic
1057483661 9:95464999-95465021 CCATTGGTGCTAAGCAATCAGGG - Intronic
1059815120 9:117903500-117903522 CCAGTGCCTTAAAGCATTCTTGG + Intergenic
1185811865 X:3118076-3118098 CCATTCCTTCAAAGCTATTAAGG - Intergenic
1190935501 X:54995581-54995603 TCATTGCCTCATAGCCAACAAGG - Intronic
1191138583 X:57092650-57092672 CCATTGCCTGAAAACAAACTCGG + Intergenic
1197341703 X:125283378-125283400 CCATTGCTTCAGAGCATGCAAGG - Intergenic
1197905451 X:131420145-131420167 CCACTGCCTAAAACCAATCTTGG - Intergenic
1197944285 X:131821880-131821902 CCATTGCCTTAGAGCAAGGAGGG - Intergenic
1198392049 X:136186116-136186138 CCATTGCCACTAATCCATCATGG + Intronic
1200013177 X:153136085-153136107 TCATAGTCTCAAAGAAATCAAGG - Intergenic
1200026423 X:153263838-153263860 TCATAGTCTCAAAGAAATCAAGG + Intergenic
1200039148 X:153353387-153353409 CCACTGCCTCAGAGAAGTCAGGG + Intronic
1201269430 Y:12240281-12240303 CCATTCCTTCAAAGCTATTAAGG + Intergenic