ID: 1140776466

View in Genome Browser
Species Human (GRCh38)
Location 16:78253463-78253485
Sequence GTACCCTGCTCAAGATCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140776466 Original CRISPR GTACCCTGCTCAAGATCACT GGG Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
903188734 1:21644402-21644424 GTAACCTGTTCAAGGTCCCTTGG - Intronic
903569377 1:24293206-24293228 GTAATCTGCTCAAGGTCACAGGG - Intergenic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904055901 1:27669639-27669661 GTATCCTGCCCAAGGTCACTTGG - Intronic
904889581 1:33769398-33769420 GACCCCTGCTCAAAATCAATGGG - Intronic
905835463 1:41116410-41116432 GGAGCTTGCTCAAGATCACGTGG - Intronic
906912777 1:49972993-49973015 CTAACCTGCCCAAGATCACATGG + Intronic
907798421 1:57740379-57740401 GTACCTTGCCCAAGAACACATGG - Intronic
910603466 1:89056518-89056540 GAAGCCTGCTCAAGATAAGTAGG + Intronic
912713028 1:111963034-111963056 GTGGCCTGCTCAAGATCTCCTGG - Intronic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913498141 1:119447033-119447055 CTCCCCTGCTCAAGACCATTTGG - Intergenic
915299522 1:154944165-154944187 TTAACTTGCCCAAGATCACTTGG + Exonic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
919834841 1:201566386-201566408 GCACCCTGAGCAATATCACTAGG - Intergenic
1063923528 10:10955198-10955220 GTAACCTGCTCAAGGCCACGTGG + Intergenic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1070079602 10:73172438-73172460 GTAACCTGCTTAAGGTCATTTGG - Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070726560 10:78795470-78795492 GTAGCTTGCTCAAGGCCACTTGG - Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1073345346 10:102778734-102778756 GTAGCCTTCTAAAGATCACTTGG + Intronic
1073447619 10:103590847-103590869 GTACACTGCTCAAGGGCAGTTGG - Exonic
1074374323 10:112926817-112926839 GTGCCCTGCACAAGAACATTTGG + Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1075663950 10:124217696-124217718 GTACCCTGTTCACACTCACTTGG + Intergenic
1075996385 10:126879491-126879513 GCCCCCAGCTCACGATCACTTGG + Intergenic
1078742330 11:14078651-14078673 GTAACCTGTTCAAGGTCACAGGG - Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083504350 11:63141625-63141647 GTCCTCTCCTCAAGATAACTTGG - Intronic
1087008456 11:93491550-93491572 GTAACTTGCTCAGGACCACTAGG + Intronic
1088560671 11:111112704-111112726 GTACTTTGCTCCAAATCACTTGG + Intergenic
1089529585 11:119117828-119117850 GTTGCCTGCTCAAGATCACTTGG - Exonic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1095540047 12:43299232-43299254 GTAACTTGCTCAAGGTCATTCGG + Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102975477 12:117204102-117204124 GTACCCTCCACAAGATTACCAGG - Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104725644 12:131074121-131074143 GTACCTTGCTCATGAACAGTAGG + Intronic
1106153662 13:27131541-27131563 GTACCTTGTTCAAGTACACTTGG + Intronic
1107671967 13:42755298-42755320 GTTCACTACTCAAGTTCACTTGG + Intergenic
1109076219 13:57839094-57839116 GTAACTTGCCCATGATCACTTGG + Intergenic
1109716024 13:66223471-66223493 GTAACCTGTCCAAGATCACATGG - Intergenic
1110313760 13:74081182-74081204 GTATCTTGCTTAAGATCACCTGG - Intronic
1110472767 13:75878569-75878591 GTTCCCAGCTGAGGATCACTAGG + Intronic
1110973897 13:81805055-81805077 GTAACTTGCCCAAGGTCACTGGG - Intergenic
1113833009 13:113311683-113311705 CTACCCTGCTCAAGATCACAGGG - Intronic
1115110659 14:29817656-29817678 GTAACCTGCGGGAGATCACTAGG + Intronic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120737302 14:88067087-88067109 GTGACTTGCTCAAGATTACTAGG - Intergenic
1125933672 15:43617272-43617294 GTAACCTGCTCAAGGTCATATGG + Intronic
1125946770 15:43716734-43716756 GTAACCTGCTCAAGGTCATATGG + Intergenic
1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG + Intronic
1130062039 15:80577258-80577280 GTTCCCAGCTCCAGCTCACTTGG - Intronic
1131174851 15:90202989-90203011 GTAGCCTGCTCAAGGTCACATGG - Intronic
1131923425 15:97354973-97354995 TTACCGTGCCCAAGTTCACTGGG - Intergenic
1132997664 16:2831604-2831626 GTAACGAGCTCAAGATCACAGGG + Intronic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1138372565 16:56539036-56539058 GTATCTTGCCTAAGATCACTTGG + Intergenic
1139182792 16:64767601-64767623 GTAACGTACCCAAGATCACTTGG + Intergenic
1139719973 16:68844331-68844353 GTAACCTGTCCAAGATCACGTGG + Intronic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1144670582 17:17130544-17130566 GTATCCTGCTAGAGATCACACGG - Intronic
1146676945 17:34780279-34780301 CTACCCTGCTCAAGAACTTTCGG - Intergenic
1148164901 17:45476574-45476596 GTATCCTGCTCAAGTTCCCCAGG - Intronic
1148222952 17:45877370-45877392 GTAAGCTGCTCATGATAACTGGG + Intergenic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1150304279 17:64071212-64071234 GCACCCTGCTCAGGAACACCCGG - Intronic
1150396119 17:64823237-64823259 GTATCCTGCTCAAGTTCCCCAGG - Intergenic
1151264680 17:72945682-72945704 TCCCCCTGCTCAAGAACACTAGG - Intronic
1157584007 18:48789944-48789966 GTACCCTGCCCAAGGTCATGAGG - Intronic
1160461242 18:79040386-79040408 AAAACCTGCTCAAGATCACATGG + Intergenic
1160595641 18:79972260-79972282 GTACCCTGCCCAAGGTCACTTGG + Exonic
1160806457 19:994274-994296 GCAACCTGCGCAAGATCAATCGG + Exonic
1162376967 19:10310525-10310547 TCACCCTGCCCAAGATCACCAGG - Exonic
1164463661 19:28469774-28469796 GCATCTTGCTCAAGATCATTCGG + Intergenic
1164836671 19:31359424-31359446 GTGACCTGCTCAGGCTCACTGGG - Intergenic
1164969134 19:32515817-32515839 GTACCTTCCTCCAGATCTCTTGG - Intergenic
1165255722 19:34576459-34576481 GTTCCCTGCTCAAGTCCTCTGGG - Intergenic
1166305997 19:41937320-41937342 GGACCAAGCTCAAGTTCACTGGG - Intergenic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
1167740930 19:51324590-51324612 CTTCCCTGCTCAAGGTCCCTGGG - Intronic
926876005 2:17479602-17479624 GTACTTTGCTCAATTTCACTTGG - Intergenic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928540871 2:32282401-32282423 GTAGCTTGCCCAAGATCACATGG - Intronic
929324866 2:40597009-40597031 TTAGCCTGCTCAAGATCACATGG - Intronic
929598612 2:43191373-43191395 GTGACCTGCCCAAGGTCACTGGG + Intergenic
930030680 2:47056460-47056482 GTACCCTGCTCATTAGCACAGGG + Intronic
930139207 2:47934547-47934569 CTACCCTGCTCAGAATCACCAGG - Intergenic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
934042183 2:88136738-88136760 CTGTCCTGCTCTAGATCACTGGG + Intergenic
934846640 2:97665088-97665110 GTAACCTGCCCAAGATTATTGGG + Intergenic
935585102 2:104793469-104793491 GTAATCTGCTGAAGATCACCTGG - Intergenic
936264126 2:110987543-110987565 GTACCTTGCTCAAGGTTACATGG + Intronic
937358726 2:121214316-121214338 GTAGCCTGCTCAAAATCATACGG + Intergenic
941351826 2:164447505-164447527 GTAAACTGCTCAAGGTCACAAGG + Intergenic
945314111 2:208352074-208352096 GCAACTTGCTCAAGATCACTTGG - Intronic
945922213 2:215766595-215766617 GTGATCTGCTCAAGATCTCTTGG - Intergenic
946558971 2:220891253-220891275 GGACCCTGCTCAAAATCCATTGG - Intergenic
946949721 2:224860520-224860542 GTAACTTGCCCAAGCTCACTTGG + Intronic
1170499089 20:16956224-16956246 GTTCCCTCCTCAAGAGCATTTGG - Intergenic
1170995141 20:21348224-21348246 GTACCCTTCTCAAAATCAGATGG - Exonic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1181975918 22:26729583-26729605 GTAGCTTGCTCAAGAGCACACGG + Intergenic
1182723540 22:32424205-32424227 GTAACTTGCTTAAGGTCACTAGG + Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1184006134 22:41710691-41710713 GTATTCTGCACAACATCACTTGG - Intronic
1184945376 22:47798984-47799006 ATATCCTTCTCAAGATCACATGG + Intergenic
949197112 3:1324843-1324865 GTAACCTGTTCAAGATGACATGG - Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
951312595 3:21146801-21146823 GTTCCCTGCTTAAAATCCCTCGG + Intergenic
951546128 3:23827530-23827552 GTACCTTGCCCAAGGTCACTAGG + Intronic
954169171 3:48786492-48786514 GTACTTTACTCAAGATAACTTGG + Intronic
954184750 3:48908372-48908394 GTTCCCTGCCCAAGGTCACATGG + Intergenic
955601239 3:60647594-60647616 GTCCCCTGCTCAAAATAACAAGG + Intronic
956573288 3:70721273-70721295 GTAGACTGCTTAAGATCACATGG + Intergenic
956737602 3:72250045-72250067 GTACCTTGCCCAAGATCAGATGG - Intergenic
960356539 3:116660584-116660606 GTAACTTACTCAAGGTCACTTGG + Intronic
961647956 3:128402542-128402564 GTACCTTGCCCAAGGTCACACGG - Intronic
964429259 3:156587753-156587775 GTAGCCTGTCCAGGATCACTTGG + Intergenic
967290734 3:187917368-187917390 GTGCCTTGCACAAGGTCACTTGG - Intergenic
968228568 3:196991035-196991057 GTAACTTGCCCAAGATCACTCGG - Intronic
970214543 4:13745326-13745348 GTCCTCTGATCAAGACCACTTGG + Intergenic
970708377 4:18832521-18832543 GTTCCATGCTCAAGATCTATGGG - Intergenic
972356405 4:38283052-38283074 GAAGCCTGGTCAAGATCACTAGG - Intergenic
972763885 4:42133502-42133524 GTAACCTGCCCAGGATCACATGG - Intronic
978553378 4:109951712-109951734 GTACCCTGTTGAAGGTCACAGGG + Intronic
979513892 4:121584959-121584981 GAAACTTGCTCAAGGTCACTTGG - Intergenic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
983381077 4:166994362-166994384 GTAACCTGTCCAAGATCACATGG + Intronic
983906473 4:173188232-173188254 TTACCTTGCCCAAGGTCACTTGG + Intronic
993456487 5:88132956-88132978 GTAACTTGCCCAAGATCACTTGG - Intergenic
993523624 5:88937109-88937131 GCAAACTGCCCAAGATCACTTGG + Intergenic
995542394 5:113197777-113197799 GTAATCTGCTCAAGGTCACAGGG + Intronic
996032738 5:118724069-118724091 GTGGCTTGCCCAAGATCACTTGG - Intergenic
998489600 5:142534799-142534821 GTACCCTATTCAAGGTCACAAGG - Intergenic
998904291 5:146888074-146888096 GTACACTCCTCAGGCTCACTTGG + Intronic
1000196058 5:158958971-158958993 GTAGCCAGTTCAAGATGACTTGG - Intronic
1001115245 5:168933946-168933968 GTACCCTGCTCAAGAAGTATTGG - Intronic
1001181966 5:169528859-169528881 GTGGCCTGCTCATGATCTCTGGG + Intergenic
1003560582 6:7176582-7176604 GTCCTCTGCTCAACATCACCGGG - Intronic
1003771891 6:9313897-9313919 GTAATCTGCTGAAGATCACAAGG + Intergenic
1003916681 6:10793351-10793373 GTAGCCTGCCCAAGATCTCACGG + Intronic
1006215833 6:32441915-32441937 ATAATCTGCTCAGGATCACTAGG + Intronic
1007717363 6:43865091-43865113 GTACCCTGGTCAAGCCCCCTGGG + Intergenic
1010104663 6:72152537-72152559 ATACACTGCACAAGAACACTGGG - Intronic
1011055493 6:83199450-83199472 GTACCCTGCTCAAATTCATTCGG - Intergenic
1011554476 6:88560334-88560356 GTAGCCTGCCCAGGATCACATGG + Intergenic
1018345009 6:162891285-162891307 TTCCCCTTCTCAAGATCACTTGG - Intronic
1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG + Intergenic
1019303820 7:322836-322858 GTCTCCTGCTCAACATCCCTGGG - Intergenic
1020708168 7:11571551-11571573 GTAACCTGTCCAAGATCACATGG + Intronic
1022045983 7:26622787-26622809 GCATCTTGCTCAAGGTCACTGGG - Intergenic
1023254995 7:38304504-38304526 GTGCCCTGCTCAAAGTCACTTGG - Intergenic
1023700768 7:42889945-42889967 GTTACCTGCTCAAGATTACATGG - Intergenic
1024880782 7:54083090-54083112 GTCCCCTGCTAAAGGACACTTGG + Intergenic
1026076113 7:67170212-67170234 GTACCCTTGTCAAAATCAATTGG + Intronic
1026700745 7:72642085-72642107 GTACCCTTGTCAAAATCAATTGG - Intronic
1027162429 7:75812479-75812501 GTAACTTGCTCAAGGTCACGTGG - Intronic
1029614910 7:101650216-101650238 GTTCACTGCTCAAGAGCACCTGG + Intergenic
1030271477 7:107673408-107673430 GTACCTTGATCAATATCACAGGG - Intronic
1031829683 7:126611247-126611269 TTAACCTGCTCGAGGTCACTAGG - Intronic
1032637668 7:133727616-133727638 GTCACCTGCTCACTATCACTAGG + Intronic
1034025073 7:147693131-147693153 GTTCCTTCGTCAAGATCACTTGG + Intronic
1035218961 7:157393555-157393577 TCACCCTCCTCAAGATCACAGGG - Intronic
1039364419 8:36915365-36915387 ATACCATGCCCAAGATCACAAGG - Intronic
1039391353 8:37183321-37183343 GTACCCAGCTCAAGCTCATTTGG - Intergenic
1041625564 8:60022318-60022340 GTAGCCTGCTAAAAATCACTCGG - Intergenic
1042202598 8:66294047-66294069 GTACCTTGGTCAAAATCAGTTGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1050442192 9:5676532-5676554 GTAACCTGCTCAAGAATACATGG + Intronic
1051380378 9:16451966-16451988 GTATCTTGCTCAAGATCAGGAGG + Intronic
1052423371 9:28272761-28272783 GTCCTCTGCTCATGATTACTGGG - Intronic
1053773112 9:41503323-41503345 GTACTTTGCTCAAGGTCATTTGG + Intergenic
1056184566 9:84120950-84120972 GTAACCTGCCCAAGATCTCACGG - Intergenic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1058886791 9:109327721-109327743 GTACCCTCCTCAAGATCACCAGG - Intergenic
1058953667 9:109926320-109926342 GTACCTTCCTAAAGATCACCTGG - Intronic
1059902677 9:118945631-118945653 GCACCCGGCTCAAGATCATGGGG - Intergenic
1060880604 9:127115545-127115567 GTCGCTTGTTCAAGATCACTTGG + Intronic
1061165127 9:128917767-128917789 CCACCCTGCTTTAGATCACTCGG + Exonic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1194382855 X:93216755-93216777 GTATCCTGTTGAAGAGCACTAGG + Intergenic
1195387541 X:104327200-104327222 GTAACATGCCCAAGGTCACTTGG + Intergenic
1196815154 X:119659726-119659748 GTACCTTGTTCAAGATCCCTGGG + Intronic
1199297280 X:146173542-146173564 GGAACCTGCTCAAGGCCACTAGG - Intergenic
1199665656 X:150094566-150094588 GTAACTTGCCCAAGATCTCTTGG - Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic