ID: 1140777572

View in Genome Browser
Species Human (GRCh38)
Location 16:78264160-78264182
Sequence TCATCACCACAGAGGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140777572 Original CRISPR TCATCACCACAGAGGGCCCC AGG Intronic
900322682 1:2092924-2092946 CCTTCAGCATAGAGGGCCCCAGG + Intronic
900427678 1:2587871-2587893 ACAGCACCACAGAGGGCAGCAGG - Intronic
900478868 1:2888762-2888784 TCATCACCTCACAGGTTCCCTGG + Intergenic
901600361 1:10418965-10418987 ACATCACAACTGATGGCCCCAGG - Intronic
901740146 1:11336305-11336327 CCAGCACCAGAGTGGGCCCCTGG + Intergenic
902514915 1:16984969-16984991 TCATCTCACCAGCGGGCCCCTGG - Intergenic
903215541 1:21841621-21841643 TCATCACCATCGTGGGCACCCGG - Exonic
903678691 1:25082875-25082897 TCCTCACCCCAGAGCACCCCTGG + Intergenic
904366126 1:30011974-30011996 TCATCACCCCAAAGGGCACCCGG + Intergenic
905035325 1:34914389-34914411 TCTTCTCCAAAGAAGGCCCCTGG - Intronic
908939069 1:69410200-69410222 TCTTCACCAAACAGAGCCCCTGG - Intergenic
909873947 1:80779449-80779471 TCTTCACCAAGGAGGGCCCCTGG + Intergenic
910065211 1:83143530-83143552 TCTTCACCAGGCAGGGCCCCTGG - Intergenic
912756948 1:112332601-112332623 TCATCACCACAGAAGACTCTGGG + Intergenic
913410224 1:118542751-118542773 TCATCACCAGAGAGGGCCCCTGG + Intergenic
917055642 1:170978461-170978483 TCCTCACCAGCCAGGGCCCCTGG - Intronic
917734040 1:177904366-177904388 CCATCAGCACACAGGTCCCCAGG + Intergenic
918576708 1:186069446-186069468 TCATCACCACAGAGCACCACTGG + Intronic
920673238 1:208020751-208020773 TCAACAACACAGTGGGCCTCAGG - Intergenic
922726721 1:227926225-227926247 TCATCAGCTCAGAGGCCCCCAGG - Intronic
922989793 1:229896901-229896923 TCTTTTCCACAGAGAGCCCCAGG - Intergenic
924855711 1:247873260-247873282 TCATCAACACGGAGGTCCCTGGG + Intronic
1064714879 10:18166669-18166691 TAAAAACCACTGAGGGCCCCAGG + Intronic
1067094735 10:43292891-43292913 TCATCTCCAGGGAGGGCCCCAGG + Intergenic
1067776240 10:49166862-49166884 CCCTCACCACTGAGGCCCCCAGG + Exonic
1067944067 10:50679489-50679511 ACACCTCCACAGAGGGCGCCTGG - Intergenic
1070762111 10:79030313-79030335 TCACCAGCAGAGAGGGGCCCAGG - Intergenic
1070870618 10:79748443-79748465 TCATCACCAGAGAGAACCCCTGG + Intergenic
1071637537 10:87270655-87270677 TCATCACCAGAGAGAACCCCTGG + Intergenic
1071657708 10:87467296-87467318 TCATCACCAGAGAGAACCCCTGG - Intergenic
1072033004 10:91539186-91539208 TCATCCCCACCAAGGGGCCCTGG - Intergenic
1076445346 10:130510256-130510278 TCACCACCACAGAGGCCTCCGGG - Intergenic
1076646757 10:131959163-131959185 TCATCTCCACAGGGGGACCGGGG - Intronic
1076646827 10:131959459-131959481 TCATCTCCACAGGGGGACCGGGG - Intronic
1077415716 11:2423387-2423409 TCATCCCCACAAAAGGCCTCTGG - Intergenic
1077550560 11:3198224-3198246 CCATCTCCCCAGAGGACCCCTGG - Intergenic
1078514624 11:12010935-12010957 TCATCTCTACAGCTGGCCCCAGG - Intergenic
1081614007 11:44579730-44579752 TGCTTCCCACAGAGGGCCCCTGG - Intronic
1083899425 11:65636526-65636548 CTATCCCCACAGAGGGTCCCCGG + Exonic
1084068349 11:66718413-66718435 TCGTCCCCACAGGGGGCCCCCGG + Intronic
1084273424 11:68040538-68040560 TGATTCCCACAGAGGGGCCCTGG + Intronic
1084683325 11:70679658-70679680 TCAGCACGACAGATGGCACCGGG - Intronic
1084774993 11:71369199-71369221 TTCACACCACAGAGGGCCCCGGG - Intergenic
1085388192 11:76169133-76169155 AGGCCACCACAGAGGGCCCCTGG + Intergenic
1085880759 11:80463941-80463963 TCTTCACCAGACAGGGCTCCTGG + Intergenic
1089360913 11:117885861-117885883 TTATCAGCACAGTGGGGCCCAGG - Intergenic
1089689218 11:120176504-120176526 TCATCTCCACCGCTGGCCCCTGG + Intronic
1092579266 12:9820916-9820938 TCTTCACCAGGCAGGGCCCCTGG + Intergenic
1093430829 12:19083027-19083049 TCATCTCCACAGAAAGGCCCTGG - Intergenic
1093498051 12:19779888-19779910 TCTTCACCAGGCAGGGCCCCCGG - Intergenic
1093690258 12:22101990-22102012 TCTTCACCAGGCAGGGCCCCTGG - Intronic
1094849928 12:34377775-34377797 TCATGCCCACAGAGAGCCTCAGG - Intergenic
1094851364 12:34383730-34383752 TCATGCCCACAGAGAGCCTCCGG - Intergenic
1096878721 12:54649999-54650021 TCATCTCCACAGTGTGACCCAGG + Intergenic
1099170101 12:79353760-79353782 TCATCCCAACACAGTGCCCCAGG + Intronic
1100865566 12:98853385-98853407 TGAACACCACCGAGGGCCCATGG + Intronic
1101300032 12:103470043-103470065 TCATCACTACAGAGTGGCCTGGG - Intronic
1101441593 12:104708326-104708348 TCATCCCCACAGCCGCCCCCGGG - Intronic
1102828484 12:115972081-115972103 GCATCACTACAAAGGACCCCTGG + Exonic
1103797371 12:123513610-123513632 TGCTCACAACAGAGGGGCCCAGG + Intronic
1104262479 12:127197215-127197237 TCAGCTCCTCAGAGGTCCCCTGG - Intergenic
1104410127 12:128550879-128550901 TCATCAGCAAAGAGGATCCCAGG - Intronic
1104904782 12:132207403-132207425 CCAGCGCCACAGAAGGCCCCGGG - Intronic
1108129872 13:47287318-47287340 TCATCACCACAAAGGCCTGCTGG + Intergenic
1108715686 13:53075718-53075740 TCATCACCATAGAGGGGGCAGGG - Intergenic
1110060575 13:71033657-71033679 TCTTCACCAGGCAGGGCCCCTGG + Intergenic
1113209807 13:107963638-107963660 TCAGCAACTCAGAGCGCCCCAGG + Intergenic
1116858818 14:49977638-49977660 CCTTCACCACTGAGGGCCCCAGG - Intergenic
1118909627 14:70050376-70050398 TCAGCACCACTGAGGCCTCCTGG - Intronic
1120719777 14:87878339-87878361 TCCTCACCTCAGAGGGACCCAGG - Intronic
1121225282 14:92317265-92317287 TCATCATCACTTAGGGACCCAGG - Intergenic
1122244471 14:100392460-100392482 TCATCTCCACAAAGGGCCAAAGG - Intronic
1122810241 14:104284174-104284196 GCAGCACCACAGAGGGGCCCTGG - Intergenic
1122858133 14:104569858-104569880 TCAGGACCCCAGAGGGCTCCTGG + Intronic
1122981769 14:105195314-105195336 TCATGAGTACAGCGGGCCCCGGG - Intergenic
1126700264 15:51360516-51360538 TCACCATCACAGAGAGCCCCAGG + Intronic
1127866645 15:63038680-63038702 TCATAACTATAGAGGGCCCCAGG + Intergenic
1130741951 15:86610427-86610449 TCTTCACAACTAAGGGCCCCAGG - Intronic
1131743933 15:95424421-95424443 TCATCCCCACAGAAGTTCCCTGG + Intergenic
1132995576 16:2820766-2820788 GCAGCATCACAGAAGGCCCCGGG - Intronic
1135836715 16:25832331-25832353 CCATGAACACAGAGAGCCCCTGG + Intronic
1135985250 16:27179237-27179259 CCATCTCCACAGAGAGCCCCAGG - Intergenic
1137396324 16:48118140-48118162 TCAGCCCCACAGCGGTCCCCAGG + Intronic
1137716090 16:50599099-50599121 TCATCACCCCAGAAGGCCTCAGG - Intronic
1137758238 16:50919515-50919537 GACTCACCAGAGAGGGCCCCAGG + Intergenic
1137830503 16:51539194-51539216 TCATAACCACAGAACGTCCCAGG + Intergenic
1140777572 16:78264160-78264182 TCATCACCACAGAGGGCCCCAGG + Intronic
1144494464 17:15737601-15737623 TCACCACCACACAGGCCCACAGG - Intronic
1144640757 17:16935325-16935347 ACATCACCCCAGAGGGCTACTGG - Intronic
1144703139 17:17351471-17351493 TCTCCACCCCAGAGGGCCCAGGG + Intergenic
1144905802 17:18639075-18639097 TCACCACCACACAGGCCCACAGG + Intronic
1144955193 17:19015525-19015547 GCTGCGCCACAGAGGGCCCCCGG + Intronic
1146696008 17:34909591-34909613 TGCTCCCCACAGAGGGCCCTTGG + Intergenic
1146744392 17:35314661-35314683 TCCTCACCAGACAGGGTCCCAGG - Intergenic
1147175348 17:38652662-38652684 TCGTGACCACAGAGGGCAGCTGG + Intergenic
1147247502 17:39131991-39132013 ACATCACCATAGCAGGCCCCAGG - Intronic
1147791343 17:43015925-43015947 TCATCACCACAGAGACCTTCGGG + Exonic
1147967799 17:44202901-44202923 TCACCACCACAGAGCAGCCCAGG - Intergenic
1148859958 17:50599640-50599662 CCATCGCCACAGGGGGTCCCTGG + Exonic
1149495223 17:57113192-57113214 TCAGCAGCACACAGGGGCCCTGG - Intronic
1150316652 17:64174758-64174780 TCATAACCACTGAGGGCCCTAGG + Intronic
1150438078 17:65169488-65169510 TCCTCACCACAGAGTGCTTCTGG - Intronic
1150525394 17:65917215-65917237 TGATCACCACTGAGGACCACAGG + Intronic
1150725550 17:67648731-67648753 TCATCTCCACATAGGGCCTAGGG - Intronic
1152049966 17:77965979-77966001 TCATCCCCAGAGAGGGCCTGTGG + Intergenic
1152072994 17:78143396-78143418 TCCTGATCACAGGGGGCCCCAGG - Intergenic
1152117349 17:78396634-78396656 TCCTACCCACACAGGGCCCCAGG + Intronic
1152865598 17:82720950-82720972 TCCTCACCACACAGGCCGCCTGG - Intronic
1154024665 18:10696216-10696238 CCATCACCAAAAACGGCCCCGGG + Exonic
1154050677 18:10953858-10953880 TCAACAGCACAGGGTGCCCCTGG + Intronic
1155769003 18:29673027-29673049 TCATCACCAGGGAGGGACCCTGG + Intergenic
1156468702 18:37364000-37364022 GCCTCTCCTCAGAGGGCCCCTGG - Intronic
1160499992 18:79396671-79396693 TCAGGACCACAGAGGGCACGTGG + Intronic
1163644830 19:18483251-18483273 TCATGACCACAGATGCTCCCTGG + Intronic
1163658497 19:18562234-18562256 TTATCACCAGTGTGGGCCCCGGG - Intronic
1163790913 19:19305689-19305711 TCCTCACCTCAGAGGGCCTGAGG + Intronic
1165092706 19:33395174-33395196 GCCTCACCACAGAGGCCCACAGG - Intronic
1165312026 19:35034218-35034240 TCATCACCACAGAGGGCAGCAGG - Exonic
1166798035 19:45439846-45439868 TCGCGACCACTGAGGGCCCCGGG - Intronic
1167087744 19:47321851-47321873 TCATCACCACAGGGATCCCCAGG + Exonic
1167384091 19:49153965-49153987 TCACCACCACAGAGTCCCCAGGG - Exonic
1167771863 19:51525742-51525764 TCTTCACCAGGCAGGGCCCCTGG + Intronic
1167783375 19:51615517-51615539 TCCTCACCCCAGTGGGCCTCTGG - Intronic
1167986837 19:53325452-53325474 TCATCAACCCAGAGGCTCCCTGG + Intergenic
1168412410 19:56147960-56147982 TGATGACCACAGAGGGCCCGAGG + Intronic
925148488 2:1599077-1599099 TCATCTCACCAGAGGGCACCAGG + Intergenic
925423368 2:3729268-3729290 TCCTCCCCACAGAGGAGCCCTGG - Intronic
925646869 2:6044832-6044854 TCTTCACCAGGTAGGGCCCCAGG + Intergenic
925807056 2:7660906-7660928 TCACCACCAGGGAGGGCCCTGGG + Intergenic
926357803 2:12057211-12057233 TGTTCTCCACAGAGGGCCTCTGG + Intergenic
928234415 2:29527453-29527475 TCATCTCCACAGTGGCACCCTGG - Intronic
930705722 2:54502965-54502987 TCATGACCACAGAGGGAACATGG - Intronic
933484133 2:82896773-82896795 TCTTCACCAGGCAGGGCCCCTGG + Intergenic
933698904 2:85240310-85240332 TCATCTCCACAGCAGTCCCCCGG - Intronic
935215867 2:100974997-100975019 ACAGCCCCACAGAGGGTCCCGGG + Intronic
938188404 2:129253616-129253638 ACATCAGCACAGAGAGCTCCTGG - Intergenic
938377923 2:130820623-130820645 TCATCACCAGCGGTGGCCCCAGG - Intergenic
938382536 2:130844606-130844628 TCACCATCACAAAGGGACCCTGG - Intronic
940089255 2:149897554-149897576 TCCTAATCACAGAGGGCTCCTGG - Intergenic
941344284 2:164348381-164348403 TCATCACCACACAGAGCCCCTGG - Intergenic
941771555 2:169350810-169350832 GCACAACCAAAGAGGGCCCCAGG - Intronic
942649171 2:178149183-178149205 TCATCTCCTCAGAGAGGCCCAGG - Intergenic
943351872 2:186805881-186805903 CCTTCACCAGATAGGGCCCCTGG - Intergenic
946276328 2:218634444-218634466 TCATGGCCACTGAGGGCCCCAGG - Exonic
946495519 2:220192135-220192157 TCCTCTCCAGAGAGGGCACCAGG - Intergenic
946495725 2:220193379-220193401 TCCTCTCCAGAGAGGGCACCAGG + Intergenic
947929435 2:233951425-233951447 TATTCACCAAAGATGGCCCCAGG + Intronic
948787163 2:240358670-240358692 CCACCACCCCAGAGGACCCCAGG - Intergenic
1169784419 20:9343918-9343940 TCATCACGACACAGTGGCCCAGG + Intronic
1170155737 20:13267606-13267628 TCACCACCACAGAGTGCTTCTGG - Intronic
1171286809 20:23946383-23946405 TCATAACAACAGAGGGGCCAAGG - Intergenic
1171371367 20:24664434-24664456 TCCTGACCACAGGGGGCCCGCGG + Intronic
1172520058 20:35560430-35560452 TCAGCACCACGGAGGGCCTGGGG + Intergenic
1172968757 20:38858296-38858318 CCAGCACCACAGAGAACCCCAGG - Intronic
1173078396 20:39843001-39843023 TCATCCCCACAGATCTCCCCTGG + Intergenic
1174258480 20:49277189-49277211 TCATCACCAGAGTGGGACGCAGG + Intronic
1174295838 20:49544423-49544445 TCTTCTCCACAGAGAGCTCCAGG - Exonic
1175183529 20:57165000-57165022 TGAGGACCACAGAGGGACCCTGG - Intergenic
1175268170 20:57714979-57715001 TCAGCTCCACGGAGGCCCCCGGG + Intergenic
1175987373 20:62770722-62770744 TCATCCCCACAGAGTCCCCAGGG + Intergenic
1176213017 20:63934448-63934470 GCACGACCCCAGAGGGCCCCTGG - Exonic
1180078676 21:45476103-45476125 CCGTCACCACAGAGGCCTCCCGG - Intronic
1180724968 22:17940048-17940070 AGATCACCAGAGAAGGCCCCTGG + Intronic
1181467044 22:23115919-23115941 TCATCTTCACACAGGGCCCAGGG - Intronic
1182458575 22:30468656-30468678 TCATAGCCACACAGGCCCCCAGG + Exonic
1183606104 22:38867472-38867494 TTAGCTCCACAGAGGGCCCTGGG + Intronic
1184775111 22:46619223-46619245 TCAGGACCCCAGAGGGCCCAGGG + Intronic
1184871339 22:47240300-47240322 TCAGCACCACTGACGGTCCCAGG + Intergenic
1185228751 22:49668224-49668246 TCCTGACCACCCAGGGCCCCCGG + Intergenic
950942313 3:16905178-16905200 TCCTTGCCACAGAAGGCCCCAGG + Intronic
951053854 3:18124803-18124825 TCATAACCACTCAGGGACCCTGG - Intronic
951054108 3:18127421-18127443 TCAGCACCACACAAGCCCCCAGG - Intronic
951816557 3:26761543-26761565 TCATCACCACAGAGCCCAGCCGG - Intergenic
953031908 3:39185118-39185140 ACCTCACCACAGTGGGGCCCCGG - Exonic
953963424 3:47283653-47283675 TCACCACCACAAAGGTCCCCGGG + Intronic
954134213 3:48574711-48574733 TCATCCCCACAGGGGGAGCCGGG - Exonic
954157970 3:48698026-48698048 TCATCACCACAAAAGCCTCCAGG + Intronic
954881446 3:53838448-53838470 TCTGCAGCACAGAGGGCCTCGGG + Intronic
955325821 3:58008876-58008898 TCGGCACCACAGTGGGCGCCTGG - Intronic
956799507 3:72744119-72744141 CCACCAGCCCAGAGGGCCCCTGG - Intergenic
958594380 3:96202182-96202204 TCTTCACCAAGCAGGGCCCCTGG + Intergenic
959476468 3:106818258-106818280 TGATCACCACAGAGCTCACCAGG - Intergenic
961577947 3:127853896-127853918 TCATCACCAGCGAGGGGCCATGG - Intergenic
965811082 3:172592353-172592375 TCTTCACCAGGCAGGGCCCCTGG - Intergenic
966152283 3:176877737-176877759 TCTTTACCACACAAGGCCCCTGG + Intergenic
968284160 3:197498598-197498620 CCAGCCGCACAGAGGGCCCCAGG + Intergenic
969258705 4:6020691-6020713 TCATCACCACAGTGGGGAGCGGG - Intergenic
972071095 4:35020009-35020031 TGATCACCTCAGAAGCCCCCTGG - Intergenic
974686894 4:65242437-65242459 TCCTCACCAGAGTGGGCGCCAGG + Intergenic
975770183 4:77711937-77711959 TCAGCTCCACAGAGGGTCCTTGG + Intergenic
981337312 4:143581725-143581747 TCTTCACCAGACAGGGCTCCTGG + Intronic
983576878 4:169270516-169270538 TCAGCCCCACAGAGTGCCACGGG + Intronic
987052093 5:14155734-14155756 TCATCACCACAGTGGGACAGTGG - Intronic
987818845 5:22935652-22935674 TCATCAACACAGAGGACTTCTGG - Intergenic
994273024 5:97804455-97804477 TAATTACTACAGAGGGCCCCTGG - Intergenic
994443219 5:99836687-99836709 TCATTACCACAGTGGTACCCAGG - Intergenic
995112819 5:108446353-108446375 TCATCCCCACAGAGGGGCTTTGG + Intergenic
998457393 5:142283973-142283995 GCAGCACCACAGAGGGTCGCAGG - Intergenic
1003098029 6:3157378-3157400 TCACCGCCACGGAGGGGCCCGGG - Intronic
1007291551 6:40791048-40791070 TCATCACCACTTGGTGCCCCTGG - Intergenic
1009587538 6:65626850-65626872 TCATAAGAACAGAGAGCCCCTGG + Intronic
1009946525 6:70347414-70347436 TCTTCACCAGGTAGGGCCCCTGG - Intergenic
1011229405 6:85143182-85143204 CCATCACCAGAGAGGGCCCTGGG - Intergenic
1011636149 6:89375637-89375659 TCATTGCCTAAGAGGGCCCCAGG + Intronic
1014460679 6:121691484-121691506 TCATCATCACAAAGGGCCTTTGG + Intergenic
1017493317 6:154962882-154962904 GGATCACCACAGAGGGCACATGG + Intronic
1018388818 6:163327807-163327829 CAATCTCCACAGAGGGCCCAGGG - Intergenic
1019572688 7:1720300-1720322 ACGTCTCCACAGTGGGCCCCAGG + Intronic
1021820603 7:24494296-24494318 TTATCACCATAGAGAGCCCCAGG + Intergenic
1022040923 7:26580446-26580468 CCAGCAACACAGAAGGCCCCGGG + Intergenic
1027278897 7:76591217-76591239 TCTTCACCAGGCAGGGCCCCTGG + Intergenic
1029431208 7:100531916-100531938 TCAACACCCCAGAGGCCTCCAGG - Intergenic
1029796231 7:102897291-102897313 CCTTAAGCACAGAGGGCCCCAGG - Intronic
1031972505 7:128074782-128074804 TCATCCCCACAGAGTAGCCCAGG + Intronic
1034018936 7:147619549-147619571 TCATCACCACAACGGGCCACAGG - Intronic
1035672782 8:1432948-1432970 TCAGCAGCACAGCGGGCCCTGGG - Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1040676097 8:49751982-49752004 GCATCACCACAAATGTCCCCTGG - Intergenic
1040971371 8:53140357-53140379 TCATCACCTCACTGAGCCCCGGG - Intergenic
1043084793 8:75815817-75815839 TCATCACCACATACGACCTCTGG - Intergenic
1045002242 8:97888367-97888389 TCACCACCAGTGAGGACCCCAGG - Intronic
1047428383 8:124767365-124767387 TCCTCACCACAGGAGGCACCAGG + Intergenic
1047834879 8:128678279-128678301 TCATCCCAGCTGAGGGCCCCTGG + Intergenic
1048976971 8:139678572-139678594 TCAACACCCCCGAGGGCCTCAGG + Intronic
1049291890 8:141807720-141807742 TAAGAAGCACAGAGGGCCCCGGG + Intergenic
1049807490 8:144547544-144547566 CCACCCCCACTGAGGGCCCCGGG - Exonic
1053272988 9:36762830-36762852 TAATCCCCACAGAGGAACCCAGG - Intergenic
1053415954 9:37946845-37946867 CCAGCACCCCAGAGGGTCCCTGG + Intronic
1053472646 9:38357952-38357974 TCATAACCACACAGGGCCTGGGG - Intergenic
1055931549 9:81564614-81564636 TCATGACCACATAGAGTCCCTGG - Intergenic
1056317378 9:85403138-85403160 TGATGATCACAGAGGGTCCCAGG + Intergenic
1057127660 9:92631849-92631871 TGATCACCACAGGGATCCCCTGG + Intronic
1057485987 9:95484665-95484687 ACATCAACTCAGAGGTCCCCTGG + Intronic
1057956535 9:99413355-99413377 TCATTTCCAAAGAGAGCCCCAGG + Intergenic
1061271639 9:129547104-129547126 CCCTCTCCCCAGAGGGCCCCAGG + Intergenic
1061632539 9:131882218-131882240 TTATCACCAAAAAGGGGCCCAGG + Intronic
1061679643 9:132236646-132236668 CCATCACCACAGAGGACACCAGG - Intronic
1062138006 9:134939856-134939878 TCATCTCCGCAGCAGGCCCCGGG - Intergenic
1062155415 9:135045610-135045632 TCATCCCCAGCGAGGGCACCAGG - Intergenic
1185519537 X:728486-728508 ACCTCACCACAGATGGGCCCAGG + Intergenic
1185519624 X:728905-728927 ACCTCACCACAGACGGGCCCAGG + Intergenic
1188660400 X:32751779-32751801 TGCACACCACAGAGGGACCCTGG - Intronic
1188711811 X:33410296-33410318 TCATCACCACAGGGAGCTCCAGG - Intergenic
1190626525 X:52343131-52343153 TCATCATCCCAGAAGTCCCCAGG - Intergenic
1192865914 X:75132032-75132054 TCTTCACCAGGCAGGGCCCCGGG + Intronic
1193317099 X:80077107-80077129 TCTTCACCAGGGAGGGCCCCTGG - Intergenic
1193563445 X:83048157-83048179 TCATCTTCACTGAGGACCCCAGG + Intergenic
1194234942 X:91372017-91372039 TCATCAACAGACAGCGCCCCTGG + Intergenic
1195208197 X:102625152-102625174 TCTTCACCAGGCAGGGCCCCAGG - Intergenic
1195254888 X:103081448-103081470 GCATCAGCACAGAGGGGCACAGG - Intronic
1195884822 X:109626669-109626691 TTCTCACCTCAGAGGGCCTCAGG + Intronic
1197623944 X:128781820-128781842 TAATCACCAGGCAGGGCCCCTGG + Intergenic
1197724632 X:129768383-129768405 TCAACAGCACACAGAGCCCCTGG + Exonic
1197913852 X:131513978-131514000 TCTTCACCAGGCAGGGCCCCTGG - Intergenic
1200360765 X:155604102-155604124 TCTTCACCAAGCAGGGCCCCTGG + Intronic
1200919562 Y:8601250-8601272 CCATCACTACAGACGGCCTCTGG + Intergenic
1201937173 Y:19421452-19421474 TGATCACCTCAGAAGCCCCCTGG + Intergenic
1202076486 Y:21042311-21042333 TGATCACCTCAGAAGCCCCCTGG - Intergenic