ID: 1140780551

View in Genome Browser
Species Human (GRCh38)
Location 16:78292829-78292851
Sequence CTTTGTAAGGTATTCAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140780551 Original CRISPR CTTTGTAAGGTATTCAAGGA TGG Intronic
904785317 1:32978146-32978168 ATTTTTAAGGTTTCCAAGGATGG - Intergenic
906815534 1:48874517-48874539 CTTAGTTTGGCATTCAAGGAGGG + Intronic
907900677 1:58738610-58738632 CTTTAGAAGGAATTCAAGGTGGG - Intergenic
909409109 1:75328668-75328690 CTTTGTTAGGGAATTAAGGAGGG - Intronic
910933650 1:92467300-92467322 CATTTTTTGGTATTCAAGGAAGG - Intergenic
911617788 1:100033909-100033931 TTCTGTAGAGTATTCAAGGAGGG + Intergenic
916999147 1:170337208-170337230 CTTTGGAAGTGAGTCAAGGAAGG - Intergenic
917347168 1:174040210-174040232 TTTTCTAAGGTAATCAAGGAGGG - Intergenic
917449108 1:175132021-175132043 CTTTGTAATGCATTCTAGGGGGG + Intronic
918052904 1:180990270-180990292 CTATTTAAGGAATTCCAGGAAGG + Intronic
919284505 1:195538262-195538284 CTTTGGAATGTTTTTAAGGAAGG + Intergenic
920939293 1:210466179-210466201 AATTGCAAGGAATTCAAGGAAGG + Intronic
922342316 1:224667718-224667740 CTTTGAAGGGCAGTCAAGGAGGG + Intronic
922691498 1:227695659-227695681 CTTTTTAATGGATTCAAAGACGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1064555622 10:16544389-16544411 CATTGGAAGGTAGGCAAGGAGGG + Intergenic
1064961222 10:20967050-20967072 CTTGGCAATGAATTCAAGGATGG + Intronic
1065315437 10:24459216-24459238 CTTTCTTAGGTATTCCAGGCAGG - Intronic
1068432004 10:56945869-56945891 CTTTGTAATGTTTTCATGGCAGG - Intergenic
1068727522 10:60320032-60320054 AGTTTTAAGGCATTCAAGGAAGG - Intronic
1069733602 10:70635973-70635995 CTTTGGAAAGGATGCAAGGATGG + Intergenic
1070002446 10:72390316-72390338 CTCTGTAAGTTATTAAAAGATGG + Intronic
1072474696 10:95749095-95749117 CTTTGTGAGGTATTGCAAGATGG + Intronic
1073988622 10:109238597-109238619 CTTTGAAAGGCATTCAGTGAAGG + Intergenic
1076293280 10:129364278-129364300 TTTTTTAAGGTTTTCAGGGAAGG - Intergenic
1077724748 11:4662947-4662969 CTTTGCCAGGTATACAAAGAAGG + Intergenic
1077818315 11:5709893-5709915 CTTTCTGAGGTCTGCAAGGAAGG + Exonic
1081214119 11:40373216-40373238 ATTTGTAAGGTAATATAGGAAGG + Intronic
1081524301 11:43914321-43914343 CCTTGTAAGGGAGGCAAGGAAGG - Intronic
1082768584 11:57187878-57187900 CTTTGTCAGGTAGGCAAAGAAGG + Exonic
1084854607 11:71974468-71974490 CTCTGTAAGGTAGTCAGGGTAGG + Intronic
1084932230 11:72565705-72565727 TTTTCTAAGGGATGCAAGGATGG - Intergenic
1085135957 11:74088497-74088519 CTGTGTCATATATTCAAGGAGGG - Intronic
1085949519 11:81312841-81312863 TTTTGTAAAATATACAAGGATGG - Intergenic
1087021245 11:93605585-93605607 CTTTTTTTGGTATTCATGGAAGG + Intergenic
1089882460 11:121787808-121787830 TTTTGTCAGGTATTCAGGCAAGG + Intergenic
1090202627 11:124867010-124867032 CTTAGTGAGGTATGCAAGGAAGG + Intronic
1095590610 12:43899242-43899264 CTTTGTAAGGTAGTGAAAGTTGG + Intronic
1095798178 12:46243838-46243860 CCTTGTGAGGTACTTAAGGAAGG + Intronic
1097768133 12:63548769-63548791 GTTTGGAGGGAATTCAAGGAAGG + Intergenic
1097784493 12:63743835-63743857 GTTTGGAGGGAATTCAAGGAAGG + Intergenic
1098968819 12:76826113-76826135 CTATGTAAGATATTCAAGGCAGG - Intronic
1100939218 12:99707008-99707030 GTGTGTCAGGTATTCAAGCATGG - Intronic
1103187738 12:118975652-118975674 CAGTGCAAGGTTTTCAAGGAAGG + Intergenic
1105654324 13:22419586-22419608 CTATGTACGGTATTTAAAGAAGG + Intergenic
1105933799 13:25078809-25078831 CTTTGTCAGGTATTAAATGAGGG - Intergenic
1106170017 13:27280725-27280747 CTTTGAAAGCCATTCTAGGATGG + Intergenic
1106294514 13:28398844-28398866 TTTTGTATGATCTTCAAGGAGGG - Intronic
1108978241 13:56476879-56476901 ATTTGTGACGTTTTCAAGGAAGG - Intergenic
1109886967 13:68555853-68555875 CTTTATACGTCATTCAAGGATGG + Intergenic
1110248598 13:73356266-73356288 CTTTGTCAGAGAGTCAAGGAAGG + Intergenic
1110663140 13:78082248-78082270 TTTTCCAAGGAATTCAAGGATGG - Intergenic
1114644062 14:24243886-24243908 CCTTGTAAGGTGGTCAAGGCAGG - Intergenic
1115857235 14:37643479-37643501 CTTTGGATGTTATTTAAGGAGGG + Intronic
1115960317 14:38829346-38829368 CTTAGGAAGTTGTTCAAGGAAGG + Intergenic
1125376339 15:39033798-39033820 CATTGTAGGATATTAAAGGAGGG - Intergenic
1127067074 15:55251877-55251899 CTTTGTAATGGTTTCAAGCAAGG - Intronic
1128235690 15:66065804-66065826 CTGTGGAGGGTATTTAAGGAGGG + Intronic
1129406025 15:75318668-75318690 CTTGGGAAGGTCTTCAAGGCCGG - Intergenic
1130833002 15:87620915-87620937 CTTTGTCAGGATTTCAAGGGTGG - Intergenic
1138323234 16:56137540-56137562 CTTTGTAAGATAGACCAGGAAGG - Intergenic
1139258037 16:65562340-65562362 CTTTATAAGTTATTTAATGATGG + Intergenic
1139926831 16:70493042-70493064 CGGTGTAAGGCATTCAAGGAAGG + Intronic
1140089332 16:71824719-71824741 CTTTGCAATGTTTTTAAGGATGG - Intergenic
1140780551 16:78292829-78292851 CTTTGTAAGGTATTCAAGGATGG + Intronic
1145954985 17:28848456-28848478 CTTGGTAAGAAATTCAAGTAGGG + Intronic
1148735733 17:49863928-49863950 CTTTGTTAGGTATTGGAGGAAGG + Intergenic
1154359605 18:13648390-13648412 CTTTGAAAGGTCTTCGAGGCTGG + Exonic
1160671614 19:367344-367366 GTTTGTAATGTATTCATGAAAGG + Intronic
1162660060 19:12161881-12161903 ATTATTAAGGTATTGAAGGAGGG + Intergenic
1163696256 19:18765052-18765074 CTTTGGATGGAATTCCAGGAAGG - Intronic
930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG + Intronic
931791923 2:65671436-65671458 CTTTGCCAGGGATACAAGGAAGG + Intergenic
932009168 2:67958297-67958319 CATCTTAAGGTCTTCAAGGATGG + Intergenic
933121668 2:78545908-78545930 ATTTCTAAGATATACAAGGATGG + Intergenic
935600540 2:104917629-104917651 CTTTGTAAGGAAGTGAGGGAAGG + Intergenic
936017326 2:108969530-108969552 CTTTATATGCTATTCAGGGAGGG + Intronic
939056138 2:137366665-137366687 CTTTGCAAGATTTGCAAGGAAGG - Intronic
939088896 2:137755687-137755709 CTTTGTATGATGTTCTAGGATGG + Intergenic
939681924 2:145146830-145146852 CTTTGTAGGGTAGCCAAGTAGGG + Intergenic
946368397 2:219265279-219265301 CTCTGTAAGGTAGGCAAGGCAGG - Intronic
946904143 2:224400033-224400055 CTATGTTAGGTTTTCGAGGATGG + Intronic
947565440 2:231190382-231190404 CTTTGTAAGGAGTTCAGGCAGGG + Intergenic
948021698 2:234738577-234738599 CCATGTAAGGTCTTCAAGGAAGG - Intergenic
1173753167 20:45492558-45492580 CTTTGCAAAGTAGTCAGGGAAGG + Intergenic
1182551400 22:31102742-31102764 CTTTATAAGGTCTCCAGGGAAGG + Intronic
1183268756 22:36847634-36847656 CTTTGTCACCTATTCAAAGATGG - Intergenic
953700740 3:45193763-45193785 ATGTATAAGGTATTCAAGGTTGG - Intergenic
957349285 3:79002109-79002131 GTAAGTAAGGAATTCAAGGAAGG + Intronic
962734706 3:138315639-138315661 GTTTGTAACGTATTCTAGGGAGG - Intronic
965387893 3:168067208-168067230 CTTTATTAGTTATTCAATGATGG + Intronic
965475918 3:169155017-169155039 CATTGTAAGATTTTTAAGGACGG + Intronic
965835494 3:172846958-172846980 CTTTGGGAGGTCTTCATGGATGG + Intergenic
968021763 3:195398175-195398197 GTTTCTAAGGTTATCAAGGAAGG + Intronic
969599152 4:8165687-8165709 CTTTGTAAGTTATGCAGGCAAGG - Intergenic
970086205 4:12349004-12349026 CTTTGTAAGGAAGTGAAAGAAGG - Intergenic
970363172 4:15330694-15330716 CTTTGTAAGGTAATTAAGTTTGG - Intergenic
971130682 4:23806153-23806175 CTTTGTAAGGTAGTGAGGCATGG - Intronic
971133874 4:23845151-23845173 CTTTGTGAGGTATTCACAGCAGG - Intronic
972870534 4:43292429-43292451 CTTGGTAAGTTGTTCAGGGATGG - Intergenic
975448032 4:74490541-74490563 CTTTGTGAGGTAACTAAGGATGG - Intergenic
979879559 4:125938400-125938422 CTTTGTAATGCAGTAAAGGAAGG + Intergenic
980622536 4:135327541-135327563 CATAGTAAAGAATTCAAGGAAGG + Intergenic
981465143 4:145060326-145060348 CATTCTAGGGTATTAAAGGAAGG + Intronic
981905064 4:149913205-149913227 GTCTGTACGGTATTCAATGAAGG - Intergenic
984761298 4:183365059-183365081 TTTTGTGAGGTTTTCACGGATGG + Intergenic
986877436 5:12128508-12128530 CTTTCTAAGCTATTTAATGAAGG - Intergenic
987614221 5:20251583-20251605 GTTTGTAATGTAATCAAGGTTGG + Intronic
990113393 5:52356840-52356862 TTTTGTAAAGTAGTCATGGATGG - Intergenic
990917697 5:60929158-60929180 CTTTTAAAGGTATTTAAAGACGG + Intronic
994056810 5:95426539-95426561 CTTTGTAGGTTATTTAGGGATGG - Intronic
994105756 5:95946485-95946507 ATTTGGAAGGACTTCAAGGAAGG - Intronic
999990954 5:157049325-157049347 CTTAGAAATGTATTCAAAGATGG + Intronic
1000282594 5:159794923-159794945 CTTTGGAAGGTTTTTAAGCAGGG - Intergenic
1001515763 5:172354265-172354287 CTGTATAAGGTGGTCAAGGAAGG - Intronic
1004076139 6:12345779-12345801 CTTTGGAAGGGATTTAAGCAGGG + Intergenic
1004435459 6:15588614-15588636 CTGTGTATGGCATTCAAGGCTGG + Intronic
1004627258 6:17388731-17388753 ATTTCAAAGGTATTTAAGGAAGG + Intergenic
1005776787 6:29142009-29142031 CTTTTTAAAAAATTCAAGGATGG - Intergenic
1006887004 6:37390309-37390331 CTTGATAGGGTAATCAAGGAAGG + Intronic
1009520256 6:64672475-64672497 CCTTTTAAAGTATTCAAGGGAGG + Intronic
1013140583 6:107329838-107329860 CTTTGTGAGGTATAGAAGCAGGG + Intronic
1018267828 6:162044079-162044101 CTTTGCCAGGGATTCAAGGAAGG + Intronic
1021679675 7:23117438-23117460 TTTTGTTATTTATTCAAGGAAGG - Intronic
1028984356 7:96998217-96998239 TTTTGGAAGGTTTTCAAGAAGGG + Intergenic
1030388862 7:108900576-108900598 CTTTGAAAGGTGATCAAGGAAGG + Intergenic
1030439362 7:109567371-109567393 TTTAATAAGGTAGTCAAGGAAGG - Intergenic
1031755363 7:125634389-125634411 CTAGGAAAGGTATTCGAGGAAGG + Intergenic
1034666044 7:152819145-152819167 ATTTGTAAGGTATTTTAAGATGG - Intronic
1036891426 8:12599937-12599959 CTTTGGAAGGTTTTCCAGGGCGG - Intergenic
1038587084 8:28799730-28799752 CTTTGTAAGGTATTTTAAGTTGG - Intronic
1041288295 8:56283171-56283193 CTTAGTATGGTCTTCAAGTATGG + Intergenic
1044765204 8:95564757-95564779 TTATGTCAGGTATGCAAGGATGG + Intergenic
1046196751 8:110874067-110874089 CTGTGGTATGTATTCAAGGAAGG - Intergenic
1048031641 8:130638830-130638852 CTGTGTAAGGTATTCTAGTAAGG + Intergenic
1048654137 8:136516383-136516405 CTTTGAAAGGTTTTTAAGCAGGG - Intergenic
1051503523 9:17803681-17803703 CTTTGCAAGGTCTTCAAGCAAGG + Intergenic
1057417182 9:94874960-94874982 CTGTGTAAGGGGCTCAAGGATGG + Intronic
1058586422 9:106511460-106511482 CTTTTTAAGAAATTCAAGGGTGG - Intergenic
1059496691 9:114715826-114715848 CTTTTTAAGGCTTTCAATGAAGG - Intergenic
1059962948 9:119584601-119584623 ATTTTTAAGATACTCAAGGAAGG - Intergenic
1060081373 9:120649952-120649974 CTTTTTAATGTATTCACGGTAGG - Intronic
1061254523 9:129446651-129446673 CTTTGTAAAGTACTGAAGGTGGG + Intergenic
1186976893 X:14917199-14917221 CTTTATAGGGTAGTTAAGGATGG + Intronic
1187129853 X:16492040-16492062 CTTGGTTAGGCATTGAAGGATGG - Intergenic
1189079463 X:37955120-37955142 CATTGTGAGGTATACAAGAAGGG - Intronic
1189431760 X:40953217-40953239 CTGTGAAAGGAGTTCAAGGATGG - Intergenic
1192275851 X:69630162-69630184 CTGTGTGAGGGAGTCAAGGAAGG + Intronic
1199488553 X:148373799-148373821 CTTTATGAGGTACTCAAGGGTGG - Intergenic
1201794688 Y:17882311-17882333 CTTTCTGAAGTATTTAAGGAAGG - Intergenic
1201806867 Y:18023674-18023696 CTTTCTGAAGTATTTAAGGAAGG + Intergenic
1202356062 Y:24050090-24050112 CTTTCTGAAGTATTTAAGGAAGG - Intergenic
1202514716 Y:25620019-25620041 CTTTCTGAAGTATTTAAGGAAGG + Intergenic