ID: 1140781989

View in Genome Browser
Species Human (GRCh38)
Location 16:78305340-78305362
Sequence TTGTGAGCAAGGAGGCCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140781989_1140781999 22 Left 1140781989 16:78305340-78305362 CCCTCCGGCCTCCTTGCTCACAA 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1140781999 16:78305385-78305407 TAACCTCTGGATGAGTCCCTTGG 0: 1
1: 0
2: 0
3: 5
4: 97
1140781989_1140781997 9 Left 1140781989 16:78305340-78305362 CCCTCCGGCCTCCTTGCTCACAA 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1140781997 16:78305372-78305394 GGAAAAAGCCATGTAACCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140781989 Original CRISPR TTGTGAGCAAGGAGGCCGGA GGG (reversed) Intronic
900244251 1:1630251-1630273 GTGTGAGCTGGGAGGCCGGGTGG - Intronic
900496870 1:2979717-2979739 TTCTCAGGAAGGAGGCGGGAAGG - Intergenic
900745324 1:4356801-4356823 ATGTGAGCCAGGAGTCGGGATGG + Intergenic
901003701 1:6161440-6161462 TTGGGAGCAGGGAGGCTGGTGGG - Intronic
901440214 1:9273224-9273246 TGGTCAGCAAGGCGGCTGGAGGG + Intergenic
903997766 1:27318502-27318524 CTGTGAGAAATGAGGCTGGAAGG + Intergenic
905999263 1:42409903-42409925 TTATGGACAAGGAGGCCAGATGG + Intronic
906126819 1:43432008-43432030 TGGTGAGCAGGGAGACAGGAGGG - Intronic
906539556 1:46574791-46574813 TTGGGAGAAGGGAGGCCGGAGGG - Intronic
909398320 1:75195542-75195564 TTGTGAGCCAAGAGGCATGAGGG - Intergenic
910934602 1:92477111-92477133 TTTTTAGCAAGGAGGACAGAGGG - Intronic
915740324 1:158113966-158113988 GGGTGAGGAAGGAGGCAGGAGGG + Intergenic
917962917 1:180158577-180158599 CTGTCAGCAAGGAGGAAGGAAGG + Intronic
918428490 1:184434800-184434822 TCGTGAGCAAGGAGAATGGAGGG + Intronic
918570076 1:185979903-185979925 TTGTGAGCAATCAGGAAGGAAGG - Intronic
920106851 1:203559607-203559629 TCCTGAGCAATGAGGCTGGAAGG + Intergenic
921261613 1:213389474-213389496 TTGTGAGCAGGGAGGTGGCATGG - Intergenic
923499801 1:234555246-234555268 TCCTGAGCATGGAGGCCGGCTGG - Intergenic
924440861 1:244083957-244083979 TTGTAAGCTAGGATGCCTGAAGG + Intergenic
924928119 1:248703269-248703291 TAGTGAGCAAGGAGGACAGCTGG - Intergenic
1062941326 10:1423375-1423397 TCAGGAGCCAGGAGGCCGGAGGG - Intronic
1063183711 10:3631249-3631271 TGGTGAGCATGCAGGCCAGATGG + Intergenic
1063608007 10:7539961-7539983 TTGTAAGCAAGGAGATGGGAGGG - Intergenic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1065822129 10:29535572-29535594 ATGAAAGCAAGGAGGCTGGAAGG + Intronic
1069047992 10:63763277-63763299 TTGTGAGGAAGGAGTCCTAACGG + Intergenic
1069219161 10:65861712-65861734 TTGAAAGCTAGGAGGCAGGAGGG - Intergenic
1071922290 10:90364282-90364304 TTGGGAGCCAGGAGGCTTGATGG - Intergenic
1072892562 10:99337370-99337392 TGGTGAGCGATGAGGCTGGAGGG - Intronic
1077120346 11:904603-904625 CTGTGAGCCAGGAGGCTCGAGGG - Intronic
1077217081 11:1399402-1399424 TTGTGGGCCAGGATGCCCGAGGG + Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077577923 11:3398438-3398460 TTCTCAGCAAGGAGGAAGGAAGG + Intergenic
1078423544 11:11231408-11231430 ATGTGAGCAAGGAGGTTGGCTGG + Intergenic
1079986803 11:27208359-27208381 ATGGGAGCAAGGAGGAGGGACGG + Intergenic
1080445098 11:32331292-32331314 TTGCCAGCAAGCAGGCCAGACGG + Intergenic
1080857100 11:36121818-36121840 TTGTGAGGAAGAAGGCCTCACGG - Intronic
1082757399 11:57091745-57091767 TGGTGAGGAAGGAGGAAGGATGG - Intergenic
1083289578 11:61682356-61682378 TTGGGAGGAAGGGAGCCGGAAGG + Intronic
1083942404 11:65903443-65903465 TTGGGGGCAGGGAGGCCTGAGGG + Intergenic
1084144873 11:67259769-67259791 TGGTGGGCAATGAAGCCGGAGGG - Intergenic
1084598701 11:70132381-70132403 TTTAGAGCAGGGAGGCCCGAGGG + Intronic
1089716043 11:120360207-120360229 TGGTGAGAAAAGAGGCTGGAAGG + Intronic
1090026367 11:123170824-123170846 CTGTGACCAAGGAGGCAGCAGGG - Intronic
1093709536 12:22314205-22314227 TAGTGAGCATGGAGGAAGGAGGG - Intronic
1097195071 12:57238621-57238643 TGGGGAGCCAGGACGCCGGAAGG + Intronic
1098781299 12:74690174-74690196 TTGTGGGCAAGGATGAAGGAGGG - Intergenic
1101708526 12:107243314-107243336 TTGAGGACAAGGAGGCAGGAAGG + Intergenic
1104552126 12:129766789-129766811 TTGTGAGGTAGGAGGCAGGCAGG + Intronic
1108538519 13:51412438-51412460 TTCTGAGAAAGGAGGCAGCATGG - Intronic
1109316801 13:60758823-60758845 TTGAGAGCTAGGAGGCTGAAGGG - Intergenic
1114614251 14:24059872-24059894 TGATGAGCAAGGGGGCTGGAGGG + Intronic
1117467342 14:56006520-56006542 TGGTGAGAAAGAAGGCCTGAGGG + Intergenic
1117752858 14:58941486-58941508 TTCTGACCAAGGAGACAGGATGG - Intergenic
1120253178 14:82085227-82085249 TTGTGAGTAGGGATGCCTGAGGG + Intergenic
1121137353 14:91510506-91510528 GTGCGTGCAAGGAGGCGGGAGGG - Intronic
1121417267 14:93788261-93788283 GTGTGCGCAATGAGGCCGGCTGG - Intronic
1121660699 14:95632917-95632939 TGGTGAGCAAGGAGCCTGGGAGG + Intergenic
1121885104 14:97535631-97535653 TTGTGAACAAGGAGCCTGGAGGG + Intergenic
1122156511 14:99753392-99753414 TCCTGGGCAGGGAGGCCGGAGGG - Intronic
1122221389 14:100240534-100240556 CGGGGAGCAAGGAGGCCGGAGGG - Intronic
1122276838 14:100594984-100595006 TGGTGAGGAAGGAGCCCAGATGG - Intergenic
1122440273 14:101727029-101727051 TTGGGAGTAAGGAGGCCTGGAGG - Intergenic
1122925744 14:104898955-104898977 CTGTGAGCAAGGCGGGCGGTCGG - Intergenic
1124879813 15:33631529-33631551 TTTTGAGCCAGGAGGTCAGATGG + Intronic
1127643841 15:60940513-60940535 TTGAGAGCCAAGAGGCCCGAGGG + Intronic
1127856749 15:62959955-62959977 AAGTGAGCAGAGAGGCCGGAGGG - Intergenic
1129692351 15:77721046-77721068 ATGTGAGCATTGAGGCAGGAGGG - Intronic
1130289608 15:82586059-82586081 TTGTGAGCAAGGTGCTAGGAAGG + Intronic
1131069760 15:89458801-89458823 TGGTGAGGCATGAGGCCGGAGGG - Intergenic
1133211614 16:4266265-4266287 TGGAGAGGAAGGAGGCAGGATGG - Intronic
1133403264 16:5504111-5504133 CTGTGAGCAATGAGGCTGGTTGG - Intergenic
1133492108 16:6280278-6280300 TTGTGAGAAGCGAGGACGGAGGG - Intronic
1134006406 16:10821296-10821318 TTGGGAGGAAGGAGGCAGGAGGG + Intergenic
1138005232 16:53328957-53328979 TTGTGATAAAGGAGACCGGAGGG + Exonic
1138130537 16:54475727-54475749 TTCTAAGTAAGGAGGCCGGTGGG - Intergenic
1138663660 16:58543762-58543784 TTGTGAGCAAATAGTCAGGAAGG - Exonic
1139355337 16:66364240-66364262 TTGGGAGCAAGGAAGGCGGCTGG - Intergenic
1140781989 16:78305340-78305362 TTGTGAGCAAGGAGGCCGGAGGG - Intronic
1140923255 16:79558891-79558913 TTGAGAGAAAGGAAGCCTGAGGG - Intergenic
1141284399 16:82658229-82658251 TTGTGAGCAGGGAGGCCACCAGG + Intronic
1141999506 16:87656128-87656150 CTGTGAGCCAGGAGCCCTGAGGG + Intronic
1142333744 16:89473198-89473220 TTGGGAACATGGAGGCCTGAAGG + Intronic
1143690578 17:8561027-8561049 TTGTGAGCAAGTGGGATGGAGGG - Intronic
1144628680 17:16858546-16858568 TTTTGAGCATGGAGGCCACAGGG - Intergenic
1144652722 17:17017554-17017576 TTTTGAGCATGGAGGCCACAGGG + Intergenic
1147571263 17:41572437-41572459 GTGGGAGCAAGGAGGCATGAGGG - Intergenic
1151344825 17:73495105-73495127 TTATGAGAAAGGGGGCTGGAGGG + Intronic
1151553157 17:74833663-74833685 TGGTGAGCAAGCAGGCAAGAAGG - Intronic
1154344804 18:13532849-13532871 TTGGGAGCCTGGAGGACGGAAGG - Intronic
1155062264 18:22239082-22239104 TTGAGAGAAAGGTGGCAGGAGGG + Intergenic
1156693678 18:39739960-39739982 TTGGGGGCAAGGAAGCCAGAGGG - Intergenic
1159184686 18:64953661-64953683 ATGTGAACAATGAGGCAGGAGGG - Intergenic
1159218783 18:65431714-65431736 TTATGAGCAAGGTGACCTGATGG - Intergenic
1159938349 18:74386452-74386474 ATGTGAGCAGAGAGGCCAGACGG + Intergenic
1159942496 18:74419053-74419075 TTGGGAGCAGCGAGGCAGGAGGG - Intergenic
1160706200 19:531450-531472 CTGTGCGCAAGGAGGCGGGCAGG - Intergenic
1164868807 19:31626330-31626352 TTGTGAGAGAGACGGCCGGATGG - Intergenic
1165747816 19:38240722-38240744 TTGTGAGCAAGGATGGGGAAAGG + Intergenic
1165882451 19:39053498-39053520 TTGTGAGCCAGGATGCAGCACGG - Intergenic
1166742505 19:45122880-45122902 GGGTCAGCAAGGAGGCTGGAGGG - Intronic
1167096647 19:47378091-47378113 TAGTGAGCCAGGAGGCAGGAGGG - Intronic
930089781 2:47523362-47523384 GTGTGAGCAAGGATGACTGATGG - Intronic
932967698 2:76496918-76496940 TTGAGAGGATGGAGGCAGGAGGG - Intergenic
935625592 2:105169832-105169854 TAGTGAGCAAGGGGGACTGATGG + Intergenic
937265481 2:120612409-120612431 TTGTGACCAGGGAAGCCGGGGGG - Intergenic
939468093 2:142584217-142584239 TTGTTATCAAGGAGGCAGTATGG + Intergenic
941270318 2:163418351-163418373 TAGTGAACAAGGAAGCAGGAGGG + Intergenic
942277608 2:174334555-174334577 TTGTAGGAAAGGAGGCAGGAGGG - Intergenic
946803328 2:223444335-223444357 TTGTGAGCAAGGTGGAGGAATGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1170009079 20:11701177-11701199 TTGTGGGCAAGGAAGGCGGGAGG - Intergenic
1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG + Intronic
1171152813 20:22842665-22842687 CTGGGAGCAAGGTGGCTGGATGG + Intergenic
1175689203 20:61053440-61053462 ATGTCAGGAAGGAGGACGGAAGG + Intergenic
1177234365 21:18367820-18367842 TTGTAAGCTAGGAGGCCTTATGG - Intronic
1177530121 21:22347501-22347523 ATTTGAACAAGGAGGCCAGAAGG - Intergenic
1178497790 21:33101749-33101771 TTGGGAGCGAGGACGCCGGAGGG + Intergenic
1178848996 21:36197634-36197656 GAGTTAGCAAGGTGGCCGGAAGG + Intronic
1182490427 22:30668040-30668062 TTGGGCGCACGGAGGCCGGTTGG - Intronic
1182737773 22:32543228-32543250 TTGTGAGCAGGCAGGCAGGCTGG + Intronic
1184596609 22:45517766-45517788 TTGGGAGCAAAGGGGCAGGAGGG - Intronic
1184873735 22:47258937-47258959 GGGTGAGCAGGGAGGCAGGAAGG + Intergenic
1185162272 22:49237102-49237124 TTTTGTGCAGGGAGGCCGGCCGG - Intergenic
952710627 3:36428727-36428749 TGATCAGCAAGGAGGCCAGAGGG + Intronic
953676793 3:45009029-45009051 TTATGAGCAGGGAGGCCTGTAGG - Intronic
955771280 3:62387137-62387159 TTATGAGCAAGGAGGGGGGCAGG - Intergenic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
966852724 3:184174761-184174783 TTGCAAGCAAGGAGGCCGCGAGG + Intronic
967858145 3:194133952-194133974 TGGGGAGCTGGGAGGCCGGAAGG + Intergenic
967887288 3:194341840-194341862 GTGTGGGCAAAGAGGCCGGCAGG + Exonic
970577053 4:17437682-17437704 TGGTGAACAAGGACGCTGGATGG - Intergenic
971215498 4:24658568-24658590 TTGTAAGCAATGAGGCCAAAGGG - Intergenic
971828453 4:31659083-31659105 TTGTTAGCCAGGAGGACAGAAGG + Intergenic
972160873 4:36225674-36225696 TTGAGAGGAAGGAGGCAGGAGGG + Intronic
975721862 4:77255928-77255950 ATGTAAGCATGGAGGCCAGATGG + Intronic
975736778 4:77389011-77389033 ATGTAAGCATGGAGGCCAGATGG + Intronic
984607599 4:181803632-181803654 TAGTGAGCATGGAGGTCAGAGGG + Intergenic
984926926 4:184815262-184815284 CTGTGAGCAAAGAGGCAGGGAGG + Intronic
987158852 5:15118872-15118894 TTGTGAGCATGGGGGTCGCATGG - Intergenic
997589919 5:135066260-135066282 GTGTGGCCAAGGAGGCGGGAAGG + Intronic
997670291 5:135665819-135665841 TTGGGAGCAAAGAGGCCTCACGG - Intergenic
1001685309 5:173590300-173590322 TGGTGAGCAAGCAGGAGGGAAGG - Intergenic
1001701888 5:173712676-173712698 TTGGAAGCAGGGAGGCTGGATGG + Intergenic
1001804403 5:174570989-174571011 TTCTCAGCCAGGAGGCCTGAGGG + Intergenic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1006154011 6:32004439-32004461 TTGTGAGTAAGGAGGCAGTTTGG - Intergenic
1007744622 6:44035857-44035879 TTGTGAGCAAGGAGGGTGCACGG + Intergenic
1011727606 6:90226144-90226166 GTGAGAGCCAGGAGGACGGACGG + Intronic
1013488346 6:110619463-110619485 TTGTCTGCAAAGAGGCTGGAGGG + Intronic
1014303501 6:119712547-119712569 TGCTGAGCAAGGAGGCTGAATGG + Intergenic
1017099521 6:150835255-150835277 TTGAGAGCAAGGAGGCCTTTGGG + Intronic
1019104433 6:169656963-169656985 TTGTGAGAATGAAGGCCGGGGGG - Intronic
1019906228 7:4067248-4067270 GTGTTAGCAAGGGGGCCGCAGGG + Intronic
1021226173 7:18029013-18029035 TAGTGAGGAAGGAGGCAGAAAGG + Intergenic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023287721 7:38636712-38636734 TTGTGTTCAAGGAGGGCGGGAGG - Intergenic
1024541059 7:50475494-50475516 CTGTGAGCCAGGAGGCAGGGGGG - Intronic
1025480904 7:60981620-60981642 AAGTGAGAAAGGAGGCAGGAAGG + Intergenic
1026361067 7:69600591-69600613 TTGGGAGAAAGGAGGGAGGAGGG + Intronic
1032529334 7:132607329-132607351 TGGTGAGCAGTGAGGCAGGAGGG - Intronic
1035029315 7:155847159-155847181 TTGTGAGGTAGGAGACCGGGCGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035903286 8:3480738-3480760 TTGGGATCATGGAGGCCAGAAGG + Intronic
1036926656 8:12913524-12913546 TTGTGAGGCAGGAGACCGGCAGG - Intergenic
1041161089 8:55044458-55044480 TGGTGTGGAAGGAGGGCGGAGGG + Intergenic
1046579782 8:116077974-116077996 TGGGGAGAAAGGAGGCCTGAGGG + Intergenic
1047349746 8:124062264-124062286 ATGTCAGCATGGAGGCAGGAAGG - Intronic
1051894731 9:21975194-21975216 CTGGGAGCAGGGAGGCCGGAGGG - Intronic
1052989413 9:34510377-34510399 TTCTGGGGAAGGAGGCAGGAAGG + Intronic
1056246434 9:84700003-84700025 TTGTGAGCATGGAGGATGCAAGG + Intronic
1056841083 9:89998473-89998495 TCTTGAGGAAGGAGGCCGGCAGG - Intergenic
1061847258 9:133394719-133394741 TTGTGAGCATGAAGGCTGCACGG + Intronic
1061955851 9:133960947-133960969 TGGTGAGCACAGAGGCAGGAGGG + Intronic
1186953144 X:14650532-14650554 TTGTTAGAGAGGAGGCTGGAAGG - Intronic
1188876693 X:35439532-35439554 TTGTGAGAGAGGAGACAGGAAGG - Intergenic
1195751415 X:108164515-108164537 TGGTGAGCAATGATGCCTGAAGG + Intronic
1196185954 X:112745169-112745191 TTGTGAGCAAGCAGGACAGTGGG - Intergenic
1197628195 X:128827121-128827143 TAGGGAGCAGGGAGGCCCGAGGG - Intergenic
1198318726 X:135497182-135497204 TTGTAAGCAAGGAGTCCACACGG - Intergenic
1199932326 X:152536149-152536171 TGGTGAGAAAGAAGGCCTGATGG + Intergenic
1200169384 X:154061221-154061243 TTGGGAGCCATGAGGCTGGACGG + Intronic