ID: 1140782903

View in Genome Browser
Species Human (GRCh38)
Location 16:78312842-78312864
Sequence TAAGTGGTCAGCCTCCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 5, 3: 5, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140782896_1140782903 4 Left 1140782896 16:78312815-78312837 CCAACCAGACAGGCCTAGGCTCT 0: 1
1: 0
2: 1
3: 14
4: 141
Right 1140782903 16:78312842-78312864 TAAGTGGTCAGCCTCCGAGGTGG 0: 1
1: 0
2: 5
3: 5
4: 64
1140782892_1140782903 29 Left 1140782892 16:78312790-78312812 CCTTAGGTCCAGTCTTGTGACTG 0: 1
1: 0
2: 3
3: 22
4: 140
Right 1140782903 16:78312842-78312864 TAAGTGGTCAGCCTCCGAGGTGG 0: 1
1: 0
2: 5
3: 5
4: 64
1140782897_1140782903 0 Left 1140782897 16:78312819-78312841 CCAGACAGGCCTAGGCTCTGCCC 0: 1
1: 0
2: 3
3: 31
4: 260
Right 1140782903 16:78312842-78312864 TAAGTGGTCAGCCTCCGAGGTGG 0: 1
1: 0
2: 5
3: 5
4: 64
1140782899_1140782903 -9 Left 1140782899 16:78312828-78312850 CCTAGGCTCTGCCCTAAGTGGTC 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1140782903 16:78312842-78312864 TAAGTGGTCAGCCTCCGAGGTGG 0: 1
1: 0
2: 5
3: 5
4: 64
1140782893_1140782903 21 Left 1140782893 16:78312798-78312820 CCAGTCTTGTGACTGAACCAACC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1140782903 16:78312842-78312864 TAAGTGGTCAGCCTCCGAGGTGG 0: 1
1: 0
2: 5
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140782903 Original CRISPR TAAGTGGTCAGCCTCCGAGG TGG Intronic
905214524 1:36397532-36397554 TAAGTGATCGCCCTCCTAGGAGG - Intronic
905338002 1:37258525-37258547 TAATGGGTCGGCCTCAGAGGCGG - Intergenic
908153081 1:61324591-61324613 TTAGTGGTCAGCCTCCTGTGTGG + Intronic
915145328 1:153793334-153793356 TAAGTGGTCAGCCTGGCAAGGGG + Intergenic
915303373 1:154963978-154964000 TAAGACCTCAGCCTCCAAGGTGG + Intronic
915305604 1:154975711-154975733 TAAGAGGTCAGCCTCCAAGGCGG - Intronic
1069888703 10:71639558-71639580 TAAGAGCTCTGACTCCGAGGCGG + Intronic
1072568346 10:96636928-96636950 TAAGTGGTCTGTGTCCCAGGAGG - Intronic
1074185813 10:111098693-111098715 GAAGTGGTCACCCTACAAGGTGG - Intergenic
1074718866 10:116247603-116247625 TCAGTGCCCAGCCTCAGAGGTGG - Intronic
1076638462 10:131898824-131898846 TGAGTGAGCAGCCTGCGAGGTGG - Intergenic
1084084219 11:66847503-66847525 TCAGTGGCCAGCCTCAGAGAAGG - Intergenic
1089282098 11:117381741-117381763 TCAGTGGCCAGGCTGCGAGGGGG - Exonic
1100717345 12:97319702-97319724 TAAATGCTCAGCCTCAGAGGCGG - Intergenic
1102222319 12:111202854-111202876 TAAGAGCTAAGCCTCCGAGCAGG + Intronic
1104353307 12:128063731-128063753 TAAGTGGTCTTCCTACCAGGTGG - Intergenic
1104428035 12:128694029-128694051 TAAGAGGTGAGCCTCGGATGGGG + Exonic
1119105452 14:71919175-71919197 TAAGGACTCAGCCTCAGAGGGGG + Intergenic
1124202624 15:27691351-27691373 TAGGAGGTCAGCCACAGAGGAGG - Intergenic
1124957315 15:34367653-34367675 AAGGTGGTCCGCCTGCGAGGAGG - Intergenic
1135220656 16:20611857-20611879 TCATTGGCCAGCCTCCCAGGTGG - Intronic
1139958650 16:70705307-70705329 TGAGTGTTCAGCCTGGGAGGAGG + Intronic
1140782903 16:78312842-78312864 TAAGTGGTCAGCCTCCGAGGTGG + Intronic
1154487518 18:14885748-14885770 TAAGTTGTCAGCCTTTGAGTTGG - Intergenic
1156220879 18:35050894-35050916 TAATTGGTCAGTCTCCCTGGGGG - Intronic
1158796469 18:60852247-60852269 TGAGTGGTCAGCCTTGGAGAGGG + Intergenic
1161687641 19:5711313-5711335 CAAGGAGTCAGCTTCCGAGGTGG - Intronic
1164394274 19:27850286-27850308 TAAGAGGTCAACCTCCAAGGCGG - Intergenic
933114617 2:78452515-78452537 GAAGTGGGGAGCCTCAGAGGAGG + Intergenic
938539288 2:132273218-132273240 TAACAGGTGAGCCTCCAAGGCGG + Intergenic
943022851 2:182596392-182596414 TAAGTCTTCAGCCTCCCTGGGGG - Intergenic
945178367 2:207066364-207066386 TAATTGGCCAGGCTCCCAGGTGG - Intergenic
945721871 2:213428176-213428198 TAAGTGGGCAGCCTGTGTGGTGG + Intronic
947107615 2:226684154-226684176 TATGTGGTCAGCCTCCTCAGAGG + Intergenic
948814007 2:240500428-240500450 TAGGTGGTGAGCCTCCCATGAGG - Intronic
1171769421 20:29311043-29311065 TAAGAGGTCAGCCTCCAAGGCGG + Intergenic
1171868229 20:30506071-30506093 TAACAGGTGAGCCTCCAAGGCGG + Intergenic
1171907128 20:30908349-30908371 TAAGAGGTCAGCCTCCAAGGCGG - Intergenic
1172908861 20:38390614-38390636 CAAGTGGTCAGACTTCAAGGTGG + Intergenic
1173233802 20:41225347-41225369 TCAGTGGCCAGCCTCTGAGTGGG - Intronic
1173805888 20:45925172-45925194 TTAGTGCTCAGCATCCCAGGCGG - Intergenic
1176546180 21:8201221-8201243 TAAGAGTTCAGCCACCAAGGCGG - Intergenic
1176551832 21:8226493-8226515 TAAGAGGTGAGCCTGCAAGGCGG - Intergenic
1176565131 21:8384267-8384289 TAAGAGTTCAGCCACCAAGGCGG - Intergenic
1176570741 21:8409492-8409514 TAAGAGGTGAGCCTGCAAGGCGG - Intergenic
1176578650 21:8453639-8453661 TAAGAGGTGAGCCTGCAAGGCGG - Intergenic
1180340535 22:11614288-11614310 TAAGAGGTCAGCCTCCAAGGCGG - Intergenic
1181634004 22:24166047-24166069 TAAGCAGCCAGCCTACGAGGTGG + Intronic
1185239723 22:49736017-49736039 TTTGTGGGCAGCCTCCCAGGGGG - Intergenic
1203251052 22_KI270733v1_random:117458-117480 TAAGAGTTCAGCCACCAAGGCGG - Intergenic
950396640 3:12738667-12738689 TAAGTGGGAAGTCTCCGAGCAGG - Intronic
952751838 3:36831191-36831213 TGAGGGGGCAGCTTCCGAGGTGG - Exonic
969428724 4:7140705-7140727 TGACTGGGCAGCCTCCCAGGAGG + Intergenic
969595107 4:8144264-8144286 TAAGTTGTCAACCTCCTAGGAGG + Intronic
990996216 5:61734588-61734610 CAGGTGGGCAGCCTCCCAGGTGG - Intronic
991576646 5:68111119-68111141 CAAGTGCTCAGCCTCTGGGGTGG - Intergenic
991994547 5:72374430-72374452 TTGGTGGCCAGTCTCCGAGGTGG + Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1000381329 5:160632228-160632250 AAGGTGCTCAGCCTCTGAGGAGG - Exonic
1009513340 6:64581245-64581267 TAAGTGGTCAGCATGTGAAGAGG + Intronic
1012616771 6:101286987-101287009 TAAGTGTTCACCCTCCAATGTGG - Intergenic
1020474035 7:8574064-8574086 TAAGTGTTCAGGCTCTGAGCAGG + Intronic
1032866336 7:135928935-135928957 TAAGTAATCAGCCTCCAAGATGG + Exonic
1035426533 7:158779933-158779955 TAAGTGGTCAGCATCCAACTTGG + Intronic
1035897415 8:3419208-3419230 TAAGTGGTCATCCTCACAGAAGG + Intronic
1039468953 8:37802012-37802034 TAGGTGGGCAGCCTGCGTGGTGG - Intronic
1042744750 8:72095823-72095845 TAAGTGGTCAGGGTCCCAGAAGG + Intronic
1044519530 8:93182469-93182491 TAAGTGAACAGCCTGGGAGGAGG - Intergenic
1059768147 9:117403340-117403362 TAAGTGTGCAGCCTCCCATGGGG + Intronic
1203467457 Un_GL000220v1:100725-100747 TAAGAGTTCAGCCACCAAGGCGG - Intergenic
1203473011 Un_GL000220v1:125097-125119 TAAGAGGTGAGCCTGCAAGGCGG - Intergenic
1203363149 Un_KI270442v1:235427-235449 TAAGAGGTCAGCCTCCAAGGCGG + Intergenic
1186614067 X:11168188-11168210 TAAGTGGACAGCCTTCCAGGTGG - Intronic
1187987193 X:24827137-24827159 TAAGTTATCATCATCCGAGGAGG + Intronic
1201075175 Y:10181361-10181383 TAAGAGGTAAGCCTCCAAGGCGG - Intergenic