ID: 1140783930

View in Genome Browser
Species Human (GRCh38)
Location 16:78321964-78321986
Sequence CTGCAGAGACAGGTTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140783926_1140783930 -5 Left 1140783926 16:78321946-78321968 CCTGCATAAGTGACAGACCTGCA 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG 0: 1
1: 0
2: 3
3: 24
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140783930 Original CRISPR CTGCAGAGACAGGTTGTGGA TGG Intronic
900565314 1:3329143-3329165 CTGCTGGGACAGGATGTGGTTGG - Intronic
901912645 1:12472999-12473021 GTAAAGAAACAGGTTGTGGAAGG + Intronic
902218096 1:14947317-14947339 CTGCACAGTGAGGATGTGGAGGG + Intronic
902745340 1:18470047-18470069 CAGGAGAGACAGGCTGTGGGAGG - Intergenic
902838688 1:19062069-19062091 CTGCAGATGCAGGGTGTGGCTGG - Intergenic
903668707 1:25022915-25022937 CTGCAGAGAGAAGTGGAGGAGGG - Intergenic
905470509 1:38188229-38188251 CTGCAGGGAGAGGTTTGGGAAGG + Intergenic
906992558 1:50754847-50754869 AAGCAGAGAGAGGTTGTGTAGGG + Intronic
907240680 1:53079335-53079357 CTGCAGATACAGGTTTGAGAAGG + Intronic
909355860 1:74709067-74709089 CTGCAGTGAGAAGTGGTGGAAGG + Intronic
909978510 1:82071407-82071429 TTGCTGGGACAGGTTGGGGAGGG + Intergenic
910015681 1:82520393-82520415 CTGGAGAGAAAGGCTGTGGAGGG + Intergenic
912554814 1:110508309-110508331 CAGCAGAGTCAGGGTGTGGTGGG + Intergenic
915118705 1:153615560-153615582 CAGCAGCTACAGGTTGGGGAAGG + Intronic
915545650 1:156595913-156595935 CTGCAGGGAAAGTTGGTGGAGGG + Intronic
916602038 1:166302655-166302677 CTCCAGAGTCAGGTTGTTGCGGG - Intergenic
917968313 1:180192263-180192285 CTGCAGAGACAGGCCGGGGGCGG + Intronic
918073003 1:181147523-181147545 CTGCAGAGGAAGATTTTGGAAGG - Intergenic
918542857 1:185650214-185650236 GTGAAGAGACAGGTTATGGGAGG + Intergenic
920655030 1:207868614-207868636 ACGCAGAGACAGGTGGTTGAGGG - Intergenic
920760568 1:208780138-208780160 CTGGAAAGACAGGTTTGGGAAGG - Intergenic
922469631 1:225867973-225867995 CTGGAAGGACAGGTAGTGGATGG + Exonic
922721125 1:227900778-227900800 GTGGAGAGACAGGACGTGGAGGG - Intergenic
923874286 1:238030449-238030471 CTTCATAGACTGGTTTTGGAGGG - Intergenic
924594578 1:245434410-245434432 CTGCAGAGACAGGGAGAGAAAGG - Intronic
1065177624 10:23095233-23095255 ATGCAGAGATGGGTTGGGGAGGG + Intergenic
1065454511 10:25892937-25892959 CTGCAGATACAGGTTCTAGGAGG + Intergenic
1065472305 10:26095001-26095023 TTGCAGATAAAGGCTGTGGAGGG + Intronic
1069914829 10:71781008-71781030 CTGCAGCAGGAGGTTGTGGAGGG + Intronic
1070105586 10:73427769-73427791 CTGCAGAGACAGCATGGAGAAGG + Intronic
1070635218 10:78120147-78120169 GGGCAGAGACAGGTAGTGGTGGG + Intergenic
1071048087 10:81408587-81408609 GGGCAGAGAGAGGTTTTGGAGGG - Intergenic
1074496021 10:113980791-113980813 CTGGAGAGAAAGGATCTGGAGGG - Intergenic
1074711387 10:116180829-116180851 CTGCAGACACAGCTTATAGAAGG - Intronic
1075259365 10:120949445-120949467 CTGCAGACACAGGGTGTGCAAGG - Intergenic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1075730310 10:124631826-124631848 CTGCAGAGGCGGGTTTTGGTGGG - Intronic
1075835010 10:125445544-125445566 GAGAAGGGACAGGTTGTGGATGG - Intergenic
1076100527 10:127774155-127774177 GTCCAGAGACAGGCTGTGCAGGG - Intergenic
1077137628 11:1009111-1009133 CTGCACAGACACGTTCTGGAAGG - Exonic
1077182096 11:1221320-1221342 CCGCAGAGACGGAGTGTGGACGG - Intergenic
1077223288 11:1426771-1426793 GTGCAGACACAGGATGTGGCGGG + Intronic
1077893807 11:6439059-6439081 CTGCCTAGAGAAGTTGTGGAAGG + Intronic
1078551743 11:12285948-12285970 CTGGAGAGAAAGGATGGGGACGG - Intronic
1078798390 11:14617084-14617106 CTGCTGAGAGTGGGTGTGGAGGG + Intronic
1079604642 11:22349587-22349609 GTGCAGAGGCAGCTTCTGGAGGG + Intronic
1081720475 11:45285349-45285371 CTGCAGAGACATCTTGGGGGAGG + Intronic
1082009684 11:47441734-47441756 CTGCAGAGCCAGGTGGGGGATGG + Intronic
1082731024 11:56797879-56797901 GTGCAGTCACAGGTTGAGGAGGG - Intergenic
1083821167 11:65172223-65172245 CTGCAGAGACAGATCGGGGTGGG - Intronic
1084526585 11:69702175-69702197 CTGCAGAGAAAGGGGGTGGTCGG - Intronic
1085042807 11:73336539-73336561 CAGCAGGGACAGTTTCTGGAAGG + Intronic
1086411540 11:86549418-86549440 CTTTAGAGTCAGGTTGTGGTAGG - Intronic
1086906463 11:92423673-92423695 CTGTAGAGAGAGGGTGGGGAGGG + Intronic
1087013843 11:93537846-93537868 CGGCAGAGACAGCTTGTTGCTGG + Intronic
1089215864 11:116834322-116834344 CTGCAGAGAGAGGGTAGGGAAGG + Intergenic
1090269718 11:125377616-125377638 CAGCAGAGAAAGGTGGTGGCTGG - Intronic
1093059666 12:14589426-14589448 CTGCAGAGACAGGGTGGGGGGGG + Intergenic
1093290182 12:17310043-17310065 CTGCAGTGCCAGGCTTTGGAAGG + Intergenic
1095561775 12:43574328-43574350 CAGGAGAGAAAGGTTGTGTAGGG + Intergenic
1095957208 12:47813629-47813651 GTGCGGAGACAGGGTGGGGATGG + Intronic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1099149443 12:79090770-79090792 CTGTGGTGACAGGTTATGGAAGG + Intronic
1102282654 12:111630522-111630544 CTGCAGAGTCACATTGTGGGGGG + Intergenic
1102880749 12:116482708-116482730 CTGCAGAGAGAGGCTAGGGATGG + Intergenic
1104987400 12:132604619-132604641 CTGAAGAGCCAGGGAGTGGATGG - Intronic
1105431427 13:20340753-20340775 CTGCTGAGGCGGGTTGTGGGTGG - Intergenic
1105654080 13:22415521-22415543 CTGCAGAGATAGGGCTTGGAAGG + Intergenic
1106408874 13:29497257-29497279 CCGCAGAGACTGGCTCTGGAAGG - Exonic
1107425733 13:40291037-40291059 ATGCACAGAAAGGATGTGGAAGG + Intergenic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1107771794 13:43794627-43794649 CTGCAGAGGCAGTATGTAGATGG - Intergenic
1108428201 13:50326488-50326510 GTGCAGGGACAGGTTGGGGGTGG + Intronic
1108520715 13:51244710-51244732 CTGCAGAGAGTGGTTGTGAGGGG + Intronic
1109994359 13:70103930-70103952 CTGTAAAGACAGTTTATGGATGG + Intronic
1111038032 13:82704957-82704979 GTGCAGAGATAAGTGGTGGAGGG + Intergenic
1113596439 13:111537375-111537397 TTGCAGAGGCAGGGTCTGGAAGG + Intergenic
1113643040 13:111971904-111971926 CAGCAGAGTCAGTTTGTTGAAGG - Intergenic
1114222557 14:20709893-20709915 CTGCTGTGTCAGGTTGGGGAGGG + Intergenic
1114259243 14:21025383-21025405 TTGCAGATCCAGGTCGTGGATGG - Intronic
1114452141 14:22834339-22834361 ATCCAGAGACAGGGTGAGGAAGG - Exonic
1115417936 14:33158596-33158618 CTGCAGAGAGAGGGTGTTCATGG + Intronic
1120210248 14:81627100-81627122 GGGCAGGGAAAGGTTGTGGAGGG - Intergenic
1120865719 14:89293802-89293824 CTGGAGAGACTGCATGTGGAAGG - Intronic
1121111105 14:91313743-91313765 CTGCAGGGACACGTTCTGCAAGG + Exonic
1121458147 14:94052359-94052381 CAGCAGAGGCAGTTTGTGCAGGG - Intronic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1123077156 14:105673051-105673073 CTGCAGAGACTGGATGGTGAAGG + Intergenic
1125233138 15:37481399-37481421 ATACAGAGACATGTTTTGGAGGG + Intergenic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128241080 15:66101366-66101388 CTGGAGATGCAGGTTGTAGATGG - Intronic
1128257680 15:66210643-66210665 CTGCAGAGACAGGATTTTAAAGG + Intronic
1128601336 15:68997857-68997879 CTGCACACACATGTTTTGGAGGG + Intronic
1129315375 15:74739906-74739928 CTTCACAGACAGGGTCTGGAGGG + Intergenic
1130445299 15:83995157-83995179 CGGCGGAGACAGATTGTGAAGGG + Intronic
1130552076 15:84895636-84895658 CAGGAGAGGGAGGTTGTGGAGGG + Intronic
1132152487 15:99472709-99472731 CACCTGAGCCAGGTTGTGGAGGG - Intergenic
1132177174 15:99725043-99725065 TTCCAGAGACAGGTTATGGCTGG - Intronic
1132558425 16:582809-582831 CTGCAGAGAGAGGGTGGGGGCGG - Intronic
1132825748 16:1904418-1904440 GTTCAGAGGCAGGTTCTGGAGGG - Intergenic
1133723788 16:8519021-8519043 CTGCAGAAATAGCTTGAGGAAGG - Intergenic
1136135139 16:28251719-28251741 GTGCAGAGAAATGTTCTGGAAGG + Intergenic
1136155590 16:28380061-28380083 CTGCAGAGCCAGGTTCTGCTGGG + Exonic
1136207494 16:28735228-28735250 CTGCAGAGCCAGGTTCTGCTGGG - Exonic
1137222547 16:46470445-46470467 TTCCAGAGACAGGCTGTGGTAGG + Intergenic
1137420771 16:48331894-48331916 CTGCAGAGAGAGGTAGTGAGAGG + Intronic
1137570945 16:49566022-49566044 TTGCAAAGACAGGTTAAGGATGG - Intronic
1137698431 16:50478494-50478516 GGGCAGAGACAGGGTGGGGAAGG + Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1139535624 16:67571232-67571254 CTGCAAAGTCAGTTTGAGGAGGG - Exonic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1141274053 16:82568972-82568994 ATGCAGTCACAGCTTGTGGATGG - Intergenic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142284706 16:89167018-89167040 CTCCAAAGACAGGCTGTGGCTGG - Intergenic
1142934417 17:3316076-3316098 CTGGGGGGACAGGTTGTTGATGG - Intergenic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143314719 17:6023650-6023672 CTGCAGAGACTGGCTGTGAAGGG + Intronic
1144680242 17:17188442-17188464 CTGCAGAAACAGGTTCTTGCTGG - Exonic
1146977304 17:37124989-37125011 CTGCAGAGACATGCTGCTGAGGG - Intronic
1147158782 17:38559033-38559055 TAGCAGAGACAGGCTGGGGAGGG - Intronic
1147174740 17:38647848-38647870 CTGTAGGGACAGGTTTGGGATGG + Intergenic
1147835493 17:43328029-43328051 CTGCTGAGAGAGGTCGGGGAAGG + Intergenic
1148159720 17:45443032-45443054 GTGCAGAAACAGGTGGTGGTGGG + Intronic
1148678175 17:49457169-49457191 CCACAGAGACTGGATGTGGAGGG - Intronic
1149451496 17:56753430-56753452 CTGCACCGACAGGTTATGGAAGG - Intergenic
1149650999 17:58276438-58276460 CTGCAGAGAAGGGTTCTGGGAGG - Intronic
1151919803 17:77145749-77145771 CTCCAGAGCCTGGTAGTGGAGGG + Intronic
1153107721 18:1547234-1547256 CTGGGGAGACAGGTTGGGAAAGG - Intergenic
1153891902 18:9524770-9524792 ATGCAGAGGCAGGCTGTGGCAGG - Intronic
1155512125 18:26588754-26588776 AAGCAGAGAGAGGTTCTGGAAGG + Intronic
1156036132 18:32770208-32770230 CTGCAGCACCAGGTTGTTGATGG + Exonic
1156053645 18:32970910-32970932 TTGCACAGAAAGGTTGGGGAAGG + Intronic
1156640436 18:39088949-39088971 CTTGAGAGATTGGTTGTGGAGGG + Intergenic
1157310187 18:46546902-46546924 CTCCAGGGCCAGGTTGTCGAGGG + Exonic
1157776306 18:50399341-50399363 CTCCATAGACAGGATCTGGATGG - Intergenic
1157910806 18:51615750-51615772 CTGTAGAGATAGGAAGTGGAGGG - Intergenic
1160427490 18:78788129-78788151 CTGCAGAGCCAGGAGGTGGATGG - Intergenic
1160438715 18:78871987-78872009 CTGCAGAGAAAGGTGGGGGCTGG - Intergenic
1160955697 19:1690843-1690865 CTCCAGAGCCTGGATGTGGAAGG + Intergenic
1161214638 19:3087862-3087884 TGGCAGAGACTGGTTGAGGAGGG + Intergenic
1161669453 19:5597230-5597252 CTGTTCAGAAAGGTTGTGGAGGG - Intronic
1161715777 19:5875496-5875518 CAGAAGAGAAAGGATGTGGAAGG + Intronic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163786170 19:19275966-19275988 CTGCAGAGGGAGGTTGGGGAGGG - Intergenic
1164022051 19:21316474-21316496 CTGCAGATTCAGATTCTGGATGG + Intronic
1164271153 19:23673193-23673215 CTGCAGATTTAGGTTCTGGATGG + Intronic
1164435841 19:28228594-28228616 CTGGAGGGAGAGGCTGTGGATGG - Intergenic
1167034669 19:46988045-46988067 CTGCAGAGACAGTTTGATCAAGG + Exonic
1167927348 19:52832303-52832325 CTGCAGAGACAGGCCGGGCACGG + Intronic
1168722235 19:58560488-58560510 CAGCCGTGACAGGGTGTGGAGGG + Intergenic
925538391 2:4940462-4940484 CTGCACAGAGAGTTTGTGGAAGG - Intergenic
925654105 2:6126303-6126325 CTGGAGAGCCAGGAAGTGGATGG + Intergenic
926052032 2:9751489-9751511 CTCCAGGGACAGAGTGTGGACGG - Intergenic
926155919 2:10454032-10454054 CTGAAGACCCAGGTTGTGCAAGG - Intergenic
927141817 2:20136124-20136146 GTGCAGAGACAGGTCCTGGGGGG + Intergenic
928450557 2:31374711-31374733 CTGCAGAGATGGAGTGTGGAGGG - Intronic
928986923 2:37191081-37191103 TTGCAGAGTCAGGATTTGGAGGG + Intronic
931311347 2:61084026-61084048 CTGAAGGTACAGGTTGTGGCTGG - Intronic
931643255 2:64399814-64399836 CTGCAGCTACAGTGTGTGGAAGG + Intergenic
933552846 2:83795959-83795981 CTGCAGTGACAGCTTGATGAAGG - Intergenic
934657449 2:96123544-96123566 CTCCAGGGACAGGTCCTGGAAGG - Intergenic
935614808 2:105066849-105066871 TTGCTGAGACAGGTTGTGTTTGG + Intronic
936072345 2:109379659-109379681 CCGCAGCGACAGCCTGTGGAAGG + Intronic
937199459 2:120189447-120189469 ATGTAGACACAGGTTGTGTAGGG + Intergenic
937213100 2:120290399-120290421 CTGAAGAGCAAGGCTGTGGAAGG - Intronic
937451158 2:122003067-122003089 CTGCAGAGACTGGGTGGGAAGGG + Intergenic
937451196 2:122003208-122003230 CTGCAGAGACTGGGTGGGAAGGG + Intergenic
937491384 2:122371636-122371658 CTGCAGGGACAGGTCCTGCATGG - Intergenic
942379240 2:175371185-175371207 AGGCAGAGACAGGTTGTGACTGG - Intergenic
945691085 2:213037058-213037080 CTGCAGACTCATGGTGTGGAAGG + Intronic
946301131 2:218824577-218824599 CTGCAGAGGGTGGTTGTGGGGGG + Intronic
946560092 2:220903115-220903137 GTGCACAGAGAGGTTTTGGAGGG - Intergenic
947817120 2:233045076-233045098 CTCCAGAGACAGGCTGAGCAGGG - Intergenic
947927932 2:233937983-233938005 CTGCAGGAACAGCCTGTGGACGG - Intronic
948349242 2:237324705-237324727 CTACAGAGACAAGTTGGCGATGG + Exonic
948365481 2:237451935-237451957 TTCCAGAGACAGATTCTGGATGG - Intergenic
948771801 2:240255053-240255075 CTGCAGGGTCAGGCTCTGGAAGG + Intergenic
1168811314 20:706469-706491 CTGCAGAGACAGGCAGTGCCAGG - Intergenic
1169146397 20:3255285-3255307 CTGCAGAGATGGGGAGTGGAGGG + Intronic
1169544138 20:6633609-6633631 GTGCAGATACAGGTTTTGTAAGG + Intergenic
1169858574 20:10129118-10129140 CTACATAGACAGGTTGTGGAGGG + Intergenic
1170110142 20:12796050-12796072 CTGCAGGGCCAGGTTCTGCAGGG - Intergenic
1172355395 20:34276392-34276414 CACGAGAGACAGGTTGAGGAGGG + Intergenic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1173498066 20:43533408-43533430 CTGCAGGGTCACCTTGTGGAGGG - Exonic
1174812914 20:53662693-53662715 CTGAAGAGACAGGTACTGGCTGG - Intergenic
1175183379 20:57164070-57164092 CAGCAGAGAGAGCTTGTGCAGGG - Intergenic
1175217103 20:57397095-57397117 CTGCAGAGACAGGCTGGGCCTGG - Intronic
1175816983 20:61888310-61888332 CTGCAGAGATGGGCTGGGGACGG - Intronic
1176186645 20:63783879-63783901 CTGCTGAAACAGGCTGTGAAAGG + Intronic
1176311086 21:5149832-5149854 CTACAGAGACATCTTGTGAAAGG - Intronic
1177006731 21:15682556-15682578 CAGCAGAGGGAGGTTGTGGTCGG - Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1179845965 21:44112203-44112225 CTACAGAGACATCTTGTGAAAGG + Intronic
1179913009 21:44460162-44460184 CGGCAGAGAAAGGAAGTGGAGGG - Exonic
1180025489 21:45158860-45158882 CTGCAGAGACAGCTTGTGGTGGG + Intronic
1180163813 21:46010030-46010052 CTGCAGAGACAGCTTCTAGATGG + Intergenic
1180855394 22:19041874-19041896 CAGCAGTGACAGGATGAGGAAGG + Exonic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182736286 22:32533879-32533901 CTGCAGGTACAGGCTGTGGGTGG - Exonic
1183353593 22:37346881-37346903 GTGCAGAGACAGGGCGTGGCTGG + Intergenic
1184122394 22:42460593-42460615 TAGAAGAGACAGCTTGTGGAAGG + Intergenic
1184643557 22:45884554-45884576 CTGCAGGGACAGCTTGGGAAGGG + Intergenic
949295542 3:2518009-2518031 CTGCAGGGAGAGGTAGGGGAGGG - Intronic
950873525 3:16249660-16249682 GTGCAGGGACAGGCTGGGGAGGG + Intergenic
952100752 3:30010418-30010440 ATCCAGAGACTGGTTGTGGGAGG + Intergenic
952159731 3:30681593-30681615 CTGCAGAGAGAGGTGGCGGGAGG + Intronic
953788713 3:45930264-45930286 CTGCAGAGAAAGGGTGTAGAGGG - Intronic
954205766 3:49057729-49057751 CTGCAGAGACGGGGTCTGAATGG + Exonic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
957513372 3:81218929-81218951 ATGCAGAGACAGGTTTTGAAAGG + Intergenic
957963056 3:87284599-87284621 CTGCAGAGACAGTTCCTGCAGGG - Intergenic
959671083 3:108978333-108978355 ATCCAGAGACAAGTTGTTGATGG - Intronic
960340401 3:116468067-116468089 CTCCAGTGACAGATAGTGGAAGG + Intronic
961505730 3:127369563-127369585 CTGCAGAGGGAGGTGGTGGGAGG - Intergenic
962257223 3:133880755-133880777 CTGCAGAGCCAGGTGGTGAGGGG + Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
965699062 3:171440709-171440731 CTGCAGGAAGAGGGTGTGGAGGG + Intronic
966407110 3:179609402-179609424 CTGCAGAGTCAGGGACTGGAGGG + Intronic
967605589 3:191441988-191442010 CGGCAGTGACAGACTGTGGAGGG + Intergenic
967952711 3:194853251-194853273 ATGCAGCCACAGGCTGTGGAAGG + Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
972458696 4:39279293-39279315 AAACAGAGAGAGGTTGTGGAGGG - Intronic
976721935 4:88177706-88177728 CTGCCGAGAGAGATTGGGGAGGG - Intronic
976790287 4:88870651-88870673 CTGCAGAGGCAGGCTGCGGTAGG - Intronic
980427349 4:132643728-132643750 CTTCAGAGACACTTCGTGGAAGG - Intergenic
980674173 4:136052856-136052878 AAGCAGAGACAGGTGGTGAAAGG + Intergenic
980720268 4:136686619-136686641 AGGCAGAGACAGCTTGTGCAGGG + Intergenic
982116856 4:152105204-152105226 CTGCAGAGCCAGGCTGGGGCCGG + Intergenic
982284614 4:153722241-153722263 TTGCTGAGACATGCTGTGGATGG - Intronic
990376272 5:55173575-55173597 CTGCAAAGGCAGGGTGTGGTTGG - Intergenic
990794231 5:59521725-59521747 CTGTAGAGATGGGTTGGGGAGGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992553651 5:77882991-77883013 CTGCAGAGGCAGATTCTGCAAGG - Intergenic
996543062 5:124649561-124649583 CTGCAAAGAGAGGATGGGGAAGG + Intronic
996819129 5:127606363-127606385 CTGCAAAGTCAGACTGTGGAGGG - Intergenic
997300219 5:132798208-132798230 GTGCAGAAACAGGTTGAAGAGGG - Intronic
997431104 5:133841820-133841842 CTGCTGAGAGAGGAGGTGGAAGG + Intergenic
997510295 5:134449372-134449394 TTGCAGTGACAGGTTGTGCTAGG - Intergenic
998602507 5:143599463-143599485 CTGCAGAGACCGGCCTTGGAGGG + Intergenic
1000420381 5:161031920-161031942 TAGCAGAGACAGATGGTGGAGGG - Intergenic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1000631398 5:163595042-163595064 CTGGAAAGAGAAGTTGTGGAGGG - Intergenic
1001325925 5:170723989-170724011 CAGCAGAGTCAGATGGTGGAGGG + Intronic
1001764434 5:174234297-174234319 CTGCAGCATCAGGTTGTGGTAGG - Intronic
1002292295 5:178208187-178208209 CTGCAGTGGCAGGGTGTGGCAGG + Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009513999 6:64590838-64590860 CTGAAGAGATAGTTTGTGAAGGG + Exonic
1010004453 6:70980464-70980486 CTGCAAAGATAGGTTGTAGTAGG - Intergenic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1011077342 6:83450951-83450973 TTGAAGAGACAGTTTATGGAAGG + Intergenic
1011954283 6:93005913-93005935 CTGCATAGACAAGCTGTTGAGGG + Intergenic
1012253666 6:97008177-97008199 CAGCAGAGGGAGGTTGTGGTGGG + Intronic
1012541141 6:100363141-100363163 TTGCAGAGAGAGGATCTGGATGG + Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013148832 6:107424605-107424627 CTGAAGATACAGGCTGTGTAAGG + Intronic
1018655690 6:166033805-166033827 CTGCAGAGAGAGGTTTAAGAGGG + Intergenic
1019352917 7:563329-563351 CTGCAGAGGCAGCCTGTGGAGGG - Intronic
1019480760 7:1265657-1265679 TTGGAGAGACAGATTGTGTATGG + Intergenic
1022257669 7:28675529-28675551 ATGCAGAGAGAGGTAGTGAAAGG + Intronic
1023777795 7:43625788-43625810 CAGCAGAAACAGGCTGTGGTTGG - Exonic
1024596421 7:50941302-50941324 CTGCAGAGCAAGGATGTCGATGG + Intergenic
1024629397 7:51235008-51235030 CCCCAGAGACAGGTTGTGGAGGG - Intronic
1024832032 7:53472321-53472343 CTGGTGAGAAAGGATGTGGACGG - Intergenic
1025943996 7:66092624-66092646 CTGCAGTGACAGCTGGTTGAGGG - Exonic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1026959209 7:74398011-74398033 CTGCAGAGACGGGTTGGGGTAGG + Intronic
1028833533 7:95349995-95350017 CTGAAGAGAAAGGATGTTGAGGG - Intergenic
1029692740 7:102193048-102193070 CTGCAGCCCCAGGTTGGGGAAGG - Intronic
1031495199 7:122438465-122438487 CTACAGAGAGAGGAAGTGGAAGG + Intronic
1031970140 7:128058871-128058893 CTGCTGAGACAGATCGGGGATGG - Intronic
1032952039 7:136925671-136925693 CTGCAGAGACAGGAGGTGCCAGG - Intronic
1033732234 7:144191274-144191296 AGGCAGAGCCAGGTTGTGCAGGG - Intronic
1033743085 7:144289859-144289881 AGGCAGAGCCAGGTTGTGCAGGG - Intergenic
1033750813 7:144359740-144359762 AGGCAGAGCCAGGTTGTGCAGGG + Intronic
1034860292 7:154589170-154589192 ATGCTGAGAAAGGTTGAGGAGGG - Intronic
1034878830 7:154748631-154748653 CTCCAGAGGCAGGCTGTGCAGGG - Intronic
1035392145 7:158511539-158511561 CTACAGAGACAGGTATGGGAGGG - Intronic
1035470713 7:159107005-159107027 GTGCAGAGAAAGGTTGTGGGGGG + Intronic
1036682635 8:10886578-10886600 CTGCAGAGATTGGTGGTGCAGGG + Intergenic
1037623467 8:20587592-20587614 CTACAGAGACAGGGTGGGGGGGG + Intergenic
1037706734 8:21321735-21321757 CTAGAGAGCCAGGTAGTGGAGGG - Intergenic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1040068296 8:43167304-43167326 CTGCAGAGAAATCTTGTGAAAGG + Intronic
1041881097 8:62750750-62750772 ATCCATAGAAAGGTTGTGGATGG + Intronic
1043663821 8:82782555-82782577 TTTCAGAGACAGGTTGTAAAAGG + Intergenic
1047408753 8:124606950-124606972 CTGCTAAGACAGGTTGCGGAGGG - Intronic
1048318159 8:133377201-133377223 CTGCAAAGTCAGGCTGTGCAAGG + Intergenic
1048810017 8:138277071-138277093 CTGCAGACACAGGTCTTGGCAGG - Intronic
1049187614 8:141266283-141266305 CTGCAGACACCGCTTGTGGGCGG + Intronic
1049825874 8:144667410-144667432 CTGCAGAGACAGGATGAGGGAGG - Intergenic
1053093829 9:35306687-35306709 CTCCAGAGCCAGGGTGTGCAGGG + Intronic
1053219397 9:36299394-36299416 CAGTTGAGACAGGTTTTGGAAGG - Intronic
1055614869 9:78061272-78061294 CTGCAGAGAAATGTAATGGAAGG - Intergenic
1056898359 9:90573357-90573379 CTGGAGACAGAGGTTGTGAATGG - Intergenic
1057796539 9:98161864-98161886 GTGCACAGACAGGCTGTGGAGGG - Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1059354102 9:113686525-113686547 CTGCAGAGAAGGGATGTGGCAGG + Intergenic
1060402233 9:123355765-123355787 CAGCAGAGACAGGGTCTGGGAGG + Intergenic
1060685049 9:125602645-125602667 TTGCAGAGAGAGCTTGTGGTGGG - Intronic
1061201802 9:129142401-129142423 CTGAAGAGACAGGTTCTGGCTGG - Intronic
1062541649 9:137044270-137044292 CTGCTGCCCCAGGTTGTGGAGGG - Intronic
1186030016 X:5357918-5357940 CGACAGAGACAGGATGTGAAGGG + Intergenic
1186083855 X:5964686-5964708 TTGTAGAGACAGGGTGGGGAGGG + Intronic
1186273390 X:7914411-7914433 CTTCAGAGAAAGGTTGTTTACGG + Intronic
1186656531 X:11617749-11617771 CTGCAGAGTCAGGGGCTGGAAGG + Intronic
1187940035 X:24372361-24372383 CTGGTGAGACAGGTTTTGGAAGG + Intergenic
1188297128 X:28463251-28463273 GGGCAGAGAGAGGTTGGGGAGGG - Intergenic
1188856481 X:35202292-35202314 CTACAGAGACATGATGAGGAAGG - Intergenic
1189223789 X:39395822-39395844 CTGCAGACACTGGCTGTTGAGGG + Intergenic
1190000829 X:46685005-46685027 GTGCAGAGACAAGTGATGGAGGG - Intronic
1190118144 X:47639045-47639067 CTGCAGAGACTGGATGGTGAAGG + Exonic
1192450850 X:71243981-71244003 CTGCAGTGATATGTTGTGCAGGG + Intronic
1198334011 X:135649931-135649953 CAGCATAGAAAGTTTGTGGAAGG - Intergenic