ID: 1140786744

View in Genome Browser
Species Human (GRCh38)
Location 16:78349496-78349518
Sequence TCCTGGCTTCTTCTAAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140786744_1140786752 30 Left 1140786744 16:78349496-78349518 CCACCCTTTAGAAGAAGCCAGGA 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1140786752 16:78349549-78349571 ATGGCCCTGACTGTCTTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 162
1140786744_1140786751 11 Left 1140786744 16:78349496-78349518 CCACCCTTTAGAAGAAGCCAGGA 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1140786751 16:78349530-78349552 TCAGCTGATGTGAGATTACATGG 0: 1
1: 0
2: 0
3: 15
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140786744 Original CRISPR TCCTGGCTTCTTCTAAAGGG TGG (reversed) Intronic
901174334 1:7287781-7287803 TCCTGGCTCCTTCTATTGTGTGG + Intronic
901501505 1:9655234-9655256 GCCTGGCTTGTTTGAAAGGGAGG + Intronic
901925650 1:12564628-12564650 TCCTGGCTTTTCCTCAAGTGAGG + Intergenic
902743622 1:18458157-18458179 CCCTGGCTCCTTCTAGAGTGTGG + Intergenic
902793765 1:18786931-18786953 TCATCGCTTTTTCTAAAGAGAGG - Intergenic
903737916 1:25542136-25542158 GCCTGGCTTCTTTTAGAAGGGGG - Intergenic
904938168 1:34146493-34146515 TCCTAGCTTCTTCCAATAGGTGG - Intronic
906463830 1:46058473-46058495 TCCTGGCTGCTTTCACAGGGTGG - Intronic
907616716 1:55933840-55933862 TCCTGGCTTCTGCCACAGGCTGG + Intergenic
909439782 1:75684735-75684757 TCCTGGCTTCTTTCACAGGCTGG + Intergenic
911582047 1:99645295-99645317 GCCTGCCTTTTTCTAAAGGATGG + Intergenic
912649485 1:111425204-111425226 TCCTGGCCTCTTCTCCATGGTGG - Intronic
915928010 1:160038999-160039021 ACCTGGCTGCTTCTAAAGCTCGG + Exonic
917029089 1:170669838-170669860 GTATAGCTTCTTCTAAAGGGGGG - Intronic
918718096 1:187817856-187817878 TCCTGGCTGCTTTTACAGGCTGG + Intergenic
920736930 1:208541337-208541359 TCCTGTATTCTTCTAAATGCAGG + Intergenic
921355049 1:214278096-214278118 TGCTGGCTTATTCTTGAGGGTGG - Intergenic
922223316 1:223625325-223625347 TCCTGGCTGCATCTAAGGAGAGG + Intronic
922800085 1:228361163-228361185 TCCTGGCCTTTTCTGCAGGGTGG + Intronic
1062823670 10:552982-553004 TACTGGCTTCTTCCCTAGGGTGG - Intronic
1068582736 10:58760773-58760795 AGCTGGCTTTTTCTAATGGGAGG + Intronic
1068972461 10:62974239-62974261 TCCTGGCTGCTTTTACAGGCTGG + Intergenic
1078444778 11:11395955-11395977 TCCTGGCTACTGCTAAGTGGTGG + Intronic
1078609676 11:12809577-12809599 TCCTGGCTGAGTCTCAAGGGTGG - Intronic
1079876333 11:25861909-25861931 TCATTGCCTTTTCTAAAGGGAGG - Intergenic
1080751882 11:35158235-35158257 TCCTATCTTCTTCCAAAGGCCGG + Intronic
1082934807 11:58645572-58645594 TCCTGGCTGCTTTTACAGGCTGG + Intronic
1089752368 11:120660806-120660828 TCCTGGCTTCTTCCAAGTTGTGG - Intronic
1091647084 12:2282084-2282106 CCCTAGGTTCTTCTAAAGGAAGG - Intronic
1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG + Intronic
1092519708 12:9256516-9256538 TCCCAGCTACTTCTAAAGGCAGG - Intergenic
1096543530 12:52321857-52321879 TCCTGTCTTTTTCTCAAAGGCGG + Intergenic
1096844004 12:54395530-54395552 TCCTGGCTTCTCCTAAATCAGGG + Exonic
1096844404 12:54397680-54397702 TCCTGGCTTCTCCTAAATCAGGG + Intronic
1100618087 12:96247251-96247273 TCCTGACTTCTTCCACGGGGGGG - Exonic
1101070377 12:101068569-101068591 TGGTGGCTTCTTCAAAAGTGTGG + Intronic
1103858637 12:123993266-123993288 CCCTGGCTTCTTCAAGAGTGGGG + Intronic
1104710602 12:130982995-130983017 TTCTGGCTCATTCTTAAGGGAGG + Intronic
1108586058 13:51870873-51870895 TCCTGTCTTCTACAAAATGGAGG - Intergenic
1111856260 13:93641245-93641267 TGATGGCTTCTTCTAAAAGTGGG - Intronic
1114917738 14:27288758-27288780 TCCTGGCTGCTTTTACAGGCTGG + Intergenic
1114950303 14:27742605-27742627 TCCTGACTTATTTTAAAGTGAGG + Intergenic
1124104016 15:26720730-26720752 TTCTAGCTACTTCAAAAGGGAGG + Intronic
1126736812 15:51738358-51738380 TCCTGGCTGCCTCGAAAGGCTGG + Intronic
1131117263 15:89803075-89803097 TCCCGGCTTCCACTATAGGGAGG + Intronic
1132763939 16:1525051-1525073 CCCTGGCTTTGTCCAAAGGGAGG + Intronic
1133008383 16:2897013-2897035 TACTGGCTCCTTCACAAGGGAGG + Intronic
1133141028 16:3744251-3744273 TGCTGGCTTCTGCTACAGTGGGG - Intronic
1133999969 16:10775308-10775330 TACTGGATTCTTCGAAGGGGAGG - Intronic
1134323115 16:13181733-13181755 TGCTGGTTTCATCTAAAGAGGGG + Intronic
1134455237 16:14390570-14390592 TTCAGGCTTTTTCTAAAGAGAGG + Intergenic
1138065071 16:53932299-53932321 TCCAGGCTTCTTCACAATGGAGG + Intronic
1138165200 16:54794846-54794868 TCCTGGCTTCTTCTAATTAAAGG + Intergenic
1138563553 16:57816355-57816377 TCCTGGCTTCCTCTTGAGGAAGG + Intronic
1138567173 16:57841907-57841929 TCCTCCCCTCTTCTCAAGGGTGG + Intronic
1140786744 16:78349496-78349518 TCCTGGCTTCTTCTAAAGGGTGG - Intronic
1140904082 16:79395619-79395641 TCCTGGCTTCTGCTGGTGGGTGG - Intergenic
1142372676 16:89691754-89691776 TCCGGCCTTCTCCTAAGGGGTGG - Intronic
1145771645 17:27497504-27497526 TCCTTGCTTTTTAGAAAGGGAGG - Intronic
1146056587 17:29584475-29584497 TCCGGGGTTCTTCTCAAGGGTGG + Intronic
1146100031 17:29972369-29972391 TCCTGGCTCCTTTTAAAATGGGG + Intronic
1147337241 17:39734571-39734593 TCCTGGCCTCTTATTAATGGTGG + Intergenic
1147910918 17:43855461-43855483 TCGTGGCTCCTTCAGAAGGGAGG - Intronic
1148519148 17:48253122-48253144 TCCTAGCTCTTACTAAAGGGGGG + Intronic
1153706171 18:7748019-7748041 TACTGCCTTCTTCTACAGGAAGG + Intronic
1156502776 18:37570132-37570154 TCTTGGCTGCTTCCAGAGGGAGG - Intergenic
1157626084 18:49052309-49052331 TGCTGGCTTTCTCTATAGGGAGG - Intronic
1158061451 18:53348427-53348449 TCCTGGCTGCTTTTATAGGCTGG + Intronic
1158223062 18:55169644-55169666 TCCTGGCTGCTTCCACAGGTTGG - Intergenic
1158428302 18:57359633-57359655 CCCTGGGTTTTTCTAAAGAGTGG - Intronic
1160624864 18:80196724-80196746 CCCTGGATTCTTCTGGAGGGGGG + Intronic
1162317208 19:9946801-9946823 TCCTGGCCTCTACTACAAGGTGG - Intergenic
1164776257 19:30855831-30855853 TCCTGGCTCCTTCTAAATGGAGG + Intergenic
1165321150 19:35085925-35085947 TGCTGGCCTATTCTAGAGGGGGG - Intergenic
925771773 2:7289199-7289221 TCCTGGTTTCTTTTAGAGTGTGG + Intergenic
926165048 2:10517017-10517039 TCCTTGTTATTTCTAAAGGGGGG + Intergenic
929764243 2:44831028-44831050 TCCGGGCTTCCTCTGAAGGCAGG - Intergenic
930731540 2:54733026-54733048 TCCTTTCTTCCCCTAAAGGGAGG + Intronic
933102868 2:78282415-78282437 TCCTGGCTGCTTCCACAGGCTGG - Intergenic
934917903 2:98315368-98315390 TCCTGGCCTATTATATAGGGTGG - Intergenic
935451094 2:103210400-103210422 TTTTGACTTCTTCTTAAGGGTGG + Intergenic
937504254 2:122518618-122518640 TACTGGCTCCTTCTGAAGGCAGG - Intergenic
941499019 2:166245668-166245690 TCCTGCCTTCATCTAAAATGAGG - Intronic
942316102 2:174697713-174697735 TACTGTTTTCTTCTAAGGGGAGG + Intergenic
942369514 2:175267437-175267459 TCCTGGCTTCTTGTTAAGAATGG - Intergenic
944827267 2:203497195-203497217 TGCTGGCTTCCTCCACAGGGAGG - Intronic
944941105 2:204628172-204628194 TCCTGTAGTCTTCAAAAGGGTGG - Intronic
946732201 2:222720559-222720581 TCCTGGCTGCTTTTAAGGGCTGG + Intergenic
947903146 2:233739401-233739423 TCCTGGCTGCTTTCAGAGGGTGG - Intronic
948004082 2:234592857-234592879 TCCTGGGTTCTTGTATAAGGTGG + Intergenic
948201579 2:236133347-236133369 TCCAGGCTTCTTCTTTTGGGAGG - Intergenic
948721340 2:239902833-239902855 TCCTGGCTGTTTCCAAAGAGTGG - Intronic
1170615982 20:17951538-17951560 TGGTGGCTTCTTCAAAAGTGTGG - Exonic
1171329104 20:24321784-24321806 TCTAAGCTTCTTCTAAAGTGTGG + Intergenic
1171494440 20:25545591-25545613 GCCTGAATTATTCTAAAGGGAGG - Intronic
1172631489 20:36381508-36381530 TCCCTGCTTCTTCTGAAGGGAGG - Intronic
1175318151 20:58066353-58066375 TCCTGAGTTCTTATAATGGGAGG - Intergenic
1177630245 21:23717730-23717752 TGCTGGCTTCTTCCAGAGGCAGG - Intergenic
1178339201 21:31771364-31771386 GCCTGGCTTCTTATAAAGAAAGG - Intergenic
1179063698 21:38004395-38004417 TCCTGTCTTCTCCCAGAGGGTGG + Intronic
1179786563 21:43733618-43733640 GCCTGACTTCTTCCAAGGGGTGG + Intronic
1183019545 22:35016207-35016229 ATCTGGCTTCTTCTAATGGAGGG + Intergenic
1183126340 22:35784949-35784971 TCCAGGCCTCTTGCAAAGGGTGG + Intronic
1185132414 22:49046705-49046727 TCCGGGCTTCCTCCAGAGGGCGG + Intergenic
1185180943 22:49362789-49362811 TCCTGTCTTCTGCTTAAAGGTGG - Intergenic
949491274 3:4591540-4591562 TCCTTGTTTCTTCCTAAGGGAGG + Intronic
949985124 3:9534553-9534575 CCTTGGCTCCTTCTAAAGAGGGG + Intronic
950873057 3:16245740-16245762 TCCCGGCTTCTTCCACATGGAGG + Intergenic
951163394 3:19454229-19454251 TCCTGGCCTCTTCTCAAGTTTGG + Intronic
952022515 3:29040550-29040572 TCCTGGCTGCTTTCACAGGGTGG - Intergenic
952739760 3:36723989-36724011 TCCTGGCTTCTTTCACAGGCTGG - Intronic
952819431 3:37473284-37473306 TGCTGGCTGCTTTCAAAGGGTGG - Intronic
953548224 3:43880332-43880354 CACTGGCTTCTTCTAAATGGAGG + Intergenic
956408001 3:68948868-68948890 TCCTGTCTTCCTCTATAAGGTGG + Intergenic
957656380 3:83082973-83082995 TCCTGGCTTCTTACCTAGGGTGG + Intergenic
961661693 3:128472327-128472349 TCCTGGCTACTTCTGGAGGCGGG + Intergenic
962223855 3:133587790-133587812 CCCAGGATTCTTCTAAGGGGTGG + Intronic
962421544 3:135233486-135233508 TCCTGGCTACTTCCACAGGCTGG + Intronic
963509353 3:146227647-146227669 TCCTGGCCTCTCCACAAGGGAGG + Intronic
966697533 3:182806811-182806833 TCCAGGCTTCTTTCAAAGGTGGG + Intronic
970343988 4:15135689-15135711 TCTTGGCTGCTTTCAAAGGGTGG + Intergenic
974101532 4:57422670-57422692 TCCTGGCTGCTTTTACAGGCTGG - Intergenic
975625737 4:76344923-76344945 TGGTGGCTTCTTCAAAAGTGTGG + Intronic
977030517 4:91876762-91876784 TCCTGGCTGCTTTTATAGGCTGG - Intergenic
977046169 4:92071331-92071353 TCCTGGCTTCTTTCACAGGCTGG + Intergenic
978880841 4:113700818-113700840 TCCTAGGCTCATCTAAAGGGTGG - Intronic
981205858 4:142039440-142039462 ACCTGGCTTCTTCTGATGAGAGG - Intronic
982478319 4:155878853-155878875 TCCTGGCTGCTTTTACAGGCTGG + Intronic
987119696 5:14755357-14755379 TCCTGGTTCCTTCTAAATGTGGG + Intronic
987457515 5:18165411-18165433 TCCTGGCTTCTTTCACAGGCTGG + Intergenic
987662494 5:20894833-20894855 TCCTGGCTTCTTTCACAGGCTGG - Intergenic
988787087 5:34575067-34575089 TCCTGGGGTTTTCTAAAGGGAGG + Intergenic
995253064 5:110016448-110016470 TCCTAGTTTCTTCCCAAGGGTGG + Intergenic
995431487 5:112084130-112084152 TCCTGGGTTCTACTAACAGGAGG + Intergenic
999945930 5:156595505-156595527 TCCTGGATTCTTTTAAAGCAAGG + Intronic
1001833663 5:174811462-174811484 TCCTGGCCTCTTCTACATAGGGG - Intergenic
1009995998 6:70895662-70895684 TCCTGGCTAATTCCAAAGAGGGG + Intronic
1011741884 6:90369869-90369891 GACTGGTTTCTTCTAAAAGGAGG - Intergenic
1012450794 6:99350638-99350660 TCCTTGCCTGTTCTAAGGGGCGG - Intergenic
1014292131 6:119570973-119570995 TGCTGCCTTCTTCTTCAGGGTGG - Intergenic
1016142221 6:140626705-140626727 TCCTGGATGCTTTTAAAGGCTGG + Intergenic
1018960821 6:168447484-168447506 TCCTTCCTTCTGCTAAAGTGTGG + Intronic
1019139462 6:169934392-169934414 TTCTGGCTGCTACTAAAGCGGGG - Intergenic
1020193027 7:6015022-6015044 TAATGTCTTCTTTTAAAGGGTGG + Intronic
1020537817 7:9424020-9424042 TCCTGGCTGCTTTCAAAGGCTGG + Intergenic
1021930397 7:25575574-25575596 TCCTGGGTTCTTAGAAAAGGGGG - Intergenic
1028365798 7:90029858-90029880 TCGTGGCTGGTTCTAAAGGCTGG - Intergenic
1028745259 7:94320200-94320222 TCCTGGCTGCTTTTACAGGCTGG + Intergenic
1028957818 7:96713435-96713457 TCCTGGCTGCTTTCAAAAGGTGG - Intergenic
1031193687 7:118587079-118587101 TCCTGGCTGCTTTCAAAGGCTGG - Intergenic
1033031549 7:137832100-137832122 TCCTGGCTGCTTCCACAGGCTGG + Intronic
1034980599 7:155473646-155473668 TCCTGGCTTTTTGTGAAGGCTGG + Intergenic
1035167877 7:157002525-157002547 TCCTCCCTTCTTAGAAAGGGGGG - Intronic
1037879002 8:22563976-22563998 TCCCAGCTTCTTCTAAAGAAAGG - Exonic
1037913201 8:22756620-22756642 TCCTGGCATCTTTTTAAGGCAGG - Intronic
1040487134 8:47884196-47884218 TCCTGCCTTCTCCTCAAGTGGGG + Intronic
1042728302 8:71902853-71902875 TCCTGGCTTCTTTCATAGGCTGG + Intronic
1046888498 8:119395919-119395941 TCATGGGCTCTTCTAAAGAGAGG - Intergenic
1049416968 8:142499708-142499730 CCCTGTCTGCTTCTAAAAGGCGG - Intronic
1051326970 9:15982564-15982586 CCCTTGCTTCCTCTAAAGGCTGG - Intronic
1055715103 9:79108932-79108954 TCCTGGCTGCTTCCACAGGCTGG - Intergenic
1055801717 9:80044685-80044707 TACAGGCTTCTTCTAGAAGGGGG - Intergenic
1056012506 9:82346674-82346696 TCCTGGCTACTTTTACAGGCTGG - Intergenic
1056718450 9:89053361-89053383 TACTGGCTTCTCCTATAGGGAGG - Intronic
1057810351 9:98252578-98252600 TCCTGGATTCTTCAGGAGGGAGG + Intronic
1058792484 9:108464159-108464181 TCTTGGCTTATTCAAAAAGGTGG + Intergenic
1059217871 9:112583150-112583172 TTCTGGCTTCTCCTATGGGGAGG - Intronic
1061421216 9:130473687-130473709 TCCTGGCTTCTTTTGGAGAGGGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1186335898 X:8587637-8587659 TCATGGGGTCTTCTAAAGAGAGG - Intronic
1187070067 X:15879314-15879336 TCCTGGCTTCTTTCACAGGCTGG + Intergenic
1187833616 X:23408238-23408260 TCCTGGGTTCCGCTAAAGGGTGG + Intergenic
1188616558 X:32165249-32165271 TCCTGGCTGCTTTTACAGGCTGG - Intronic
1188773911 X:34189420-34189442 TCCTGGCTGCTTTTACAGGCTGG + Intergenic
1188863392 X:35285411-35285433 TCCTGGCTGCTTCTACAGGTTGG + Intergenic
1189835946 X:45022908-45022930 TATTGGCTTTTTCTAAAGGCTGG + Intronic
1190405922 X:50087498-50087520 TTCTGGCTTCTTCTGAAACGTGG - Intronic
1191864753 X:65694982-65695004 GCCTGGCTTCTGCAAAGGGGTGG - Intronic
1192271806 X:69587767-69587789 TCCTGCCTTCTTCTGAACTGAGG - Intergenic
1192278994 X:69663732-69663754 TCCTGGCTGCTTTAACAGGGTGG - Intronic
1192335667 X:70217265-70217287 TCCTGGCTTCTTTCACAGGCTGG - Intergenic
1194082513 X:89486406-89486428 TCCTGGCTTCTTTCAAAGGTTGG + Intergenic
1194416963 X:93626097-93626119 TCCTGGCTTCTTTCATAGGACGG - Intergenic
1195755679 X:108196630-108196652 TCCTGGCTTCATCCAAAGCAAGG + Intronic
1197662970 X:129193773-129193795 TCCTTGGTTCAGCTAAAGGGAGG - Intergenic
1200435160 Y:3142287-3142309 TCCTGGCTTCTTTCAAAGGTTGG + Intergenic