ID: 1140787765

View in Genome Browser
Species Human (GRCh38)
Location 16:78360287-78360309
Sequence TAGAAGTTGGAGAAGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 1, 2: 4, 3: 45, 4: 434}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140787762_1140787765 30 Left 1140787762 16:78360234-78360256 CCATTTCACTGGTGTTCTGTCAA 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1140787765 16:78360287-78360309 TAGAAGTTGGAGAAGTAGGCTGG 0: 1
1: 1
2: 4
3: 45
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140787765 Original CRISPR TAGAAGTTGGAGAAGTAGGC TGG Intronic
900364112 1:2303823-2303845 TAGAAGCTGGAGGGGCAGGCGGG - Exonic
901275327 1:7986752-7986774 GTGAAGTTGGAGAGGTAGCCAGG + Intergenic
902959244 1:19950651-19950673 AAAAAGTTTGAGAAGCAGGCTGG - Intergenic
902970202 1:20042886-20042908 TAGATGTTGGAGGAGCAGGAGGG + Intronic
904025978 1:27504118-27504140 TAGAAGGTGGCCAAGTGGGCAGG + Intergenic
904073331 1:27818977-27818999 TAAAAGTTGCAAAAATAGGCTGG + Intronic
905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG + Intronic
905177606 1:36147672-36147694 TAGAGGTTAGAGAATTAGGCAGG + Intronic
905908675 1:41638973-41638995 AAGAAAGTGGAGAAGAAGGCTGG + Intronic
905945829 1:41900836-41900858 GTGAGGCTGGAGAAGTAGGCAGG + Intronic
906378910 1:45319060-45319082 TAGATGTTGGAGGAGCAGGAGGG - Intergenic
906559816 1:46748261-46748283 ATGAACTTGGAGAAGTAGGATGG - Intergenic
907233785 1:53025894-53025916 ATGAAATTGGAGAACTAGGCAGG - Intronic
907258020 1:53195045-53195067 TGGGAGCTGGAGAAGTAGGTAGG + Intergenic
907937439 1:59055380-59055402 CTGAAGTTGGAGAAGTTAGCAGG + Intergenic
908274057 1:62450927-62450949 TAGAAGTAGGAGATGTAGAAGGG - Exonic
908448459 1:64225374-64225396 TGGAGGTAAGAGAAGTAGGCTGG + Intronic
908793319 1:67804650-67804672 CAAAAGTTGGAGAGATAGGCAGG + Intronic
909341669 1:74538892-74538914 TTGAAGTTTGAGAAGTAGGAAGG + Intronic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
909701876 1:78534053-78534075 TAGAATTCTGAGAAGTAGACAGG - Intronic
909862885 1:80631762-80631784 TAAAAATTGTAGAAGTAGGTAGG + Intergenic
910326375 1:86012811-86012833 ATGAAGTTGGAAAAGTAGGCAGG - Intronic
911698686 1:100925289-100925311 ATAAAGTTGGAGAAATAGGCTGG + Intronic
911753771 1:101529257-101529279 TACAAGTTGGAGAACCAGGGAGG + Intergenic
912387448 1:109278892-109278914 TAGAAATTGGAGCAGGGGGCTGG + Intergenic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
913613671 1:120533945-120533967 TTAAAGTAGGAAAAGTAGGCAGG - Intergenic
914372896 1:147045796-147045818 TCAAAGTAGGAAAAGTAGGCAGG - Intergenic
914576596 1:148976936-148976958 TTAAAGTAGGAAAAGTAGGCAGG + Intronic
914858390 1:151368378-151368400 TAGAAGTAGGGGAAGTATGGAGG - Intronic
915141387 1:153770703-153770725 TCGGAGTTGAAGCAGTAGGCAGG - Exonic
915704309 1:157829157-157829179 ATGAGGTTGGAGGAGTAGGCAGG + Intergenic
916294070 1:163197413-163197435 CAGAAGTTGGGGTGGTAGGCGGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916693262 1:167211272-167211294 TAGAAGCTTGAGAAGTAGGGTGG - Intergenic
916833874 1:168521580-168521602 TAGAGGTTGGAGATGGAGGCAGG + Intergenic
916884487 1:169053755-169053777 GAGAGGTTGGAGAGGTTGGCAGG - Intergenic
916942795 1:169693844-169693866 TTGAAGTTGGAAAGGAAGGCTGG - Intronic
919491042 1:198205043-198205065 TGGAAGTAGGAGAAGAAGGAAGG - Intronic
919999623 1:202787589-202787611 TAAAAGTATGTGAAGTAGGCCGG + Intronic
920092152 1:203462392-203462414 GAGAAGCTGGAGAACCAGGCTGG - Intergenic
920433002 1:205930656-205930678 AAGAGGATGGAAAAGTAGGCAGG - Intronic
921026506 1:211287911-211287933 AAGAAATTGGAGTATTAGGCCGG + Intronic
921245464 1:213234645-213234667 AGGCTGTTGGAGAAGTAGGCAGG + Intronic
922498451 1:226079210-226079232 TAGAAATTAGAGAGGAAGGCCGG + Intergenic
922932958 1:229404278-229404300 TAGAAATTGGATAAGCAGCCAGG + Intergenic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
924743918 1:246815109-246815131 ATGAAGTTGGAGAGGTAGGTGGG + Intergenic
1064529045 10:16288444-16288466 GAGTAGTTGAACAAGTAGGCTGG + Intergenic
1065217848 10:23467469-23467491 GTGAAGTTGGAGATGTGGGCAGG + Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1067279337 10:44859517-44859539 TAGAACTGGGAGAAGTGGGGAGG + Intergenic
1068375806 10:56178761-56178783 TAGAATTTGGAGCAGTTGGGTGG + Intergenic
1069252693 10:66290098-66290120 TAGTAGTAGGAGAAGTTGGGTGG + Intronic
1069470951 10:68688732-68688754 TAGAAGTTAAGAAAGTAGGCCGG - Intronic
1070293490 10:75138354-75138376 GATAAGTTGGAGAGGTAGGGTGG + Intronic
1070644451 10:78191990-78192012 TGGAAGTGGGAGAAGGAGGAAGG + Intergenic
1071053564 10:81480880-81480902 TAGAAGTTGCAAAAGTGGCCGGG + Intergenic
1071102438 10:82054641-82054663 TAGAGGCTGGAGAAGTGGGGAGG + Intronic
1071703922 10:87976114-87976136 TAAATTTTGGAGAAGTAGGCAGG + Intergenic
1071825645 10:89322782-89322804 GAGAAGTAGGACCAGTAGGCTGG - Intronic
1072314024 10:94184303-94184325 GTTAAGTTGGAGAAGTAGGCAGG - Intronic
1075613547 10:123874157-123874179 TAGAAATGTGAGAAATAGGCTGG - Intronic
1075963310 10:126587815-126587837 TAGATCTTTGAAAAGTAGGCAGG + Intronic
1078200352 11:9176956-9176978 TAAAAGTGGGAAAAATAGGCTGG + Intronic
1078241437 11:9534303-9534325 TAAAAGTGGGAAAAGCAGGCTGG - Intergenic
1078522279 11:12073116-12073138 TAGAAGTGGAAGAGGGAGGCAGG + Intergenic
1078631230 11:13006577-13006599 GAGAAGCTGGAGAAGTGGGCTGG + Intergenic
1078785826 11:14491372-14491394 TAGAACTGGGAGAAGGAGCCGGG + Intronic
1079124143 11:17707165-17707187 TACAAGGGGAAGAAGTAGGCAGG + Intergenic
1079192542 11:18292488-18292510 TTGAAATTGAAGAAGTAGGCTGG - Intronic
1079489128 11:20967882-20967904 ATGAATTTGGAGAAGTAGGCAGG - Intronic
1079868726 11:25768307-25768329 TACAGGTTGCAGAAGTAGACAGG + Intergenic
1079927139 11:26508245-26508267 TTGATGTTGGAGAAGGAGGTAGG + Exonic
1080048747 11:27836785-27836807 TAGGAGTTGGCAAAGAAGGCAGG - Intergenic
1080112850 11:28588445-28588467 TAAAAGTGGGAGAAGTGGGGAGG - Intergenic
1080181024 11:29426431-29426453 AAGAGGTTGGAGAAGCAGCCTGG + Intergenic
1080538723 11:33246241-33246263 TAGCAGTTGGAGAAGTATCAAGG + Intergenic
1080665323 11:34330913-34330935 AAGAAGTTGGAGAATCAGGAAGG - Intronic
1080799610 11:35598186-35598208 AAGGGGTTGGAGAAGCAGGCGGG - Intergenic
1081546951 11:44078341-44078363 TAGATTTTTGAAAAGTAGGCTGG - Intronic
1084532601 11:69737348-69737370 TAGAAGTTGAAGAAGACAGCCGG - Intergenic
1085144507 11:74181342-74181364 TAGGAGTTGAAAAAGTGGGCCGG - Intronic
1086338968 11:85827559-85827581 TAGAATATGGAGGAGTTGGCAGG - Intergenic
1086609023 11:88731206-88731228 ATGAAGCTGGAGAAGTGGGCAGG - Intronic
1087018460 11:93578037-93578059 AAAAGGTTGGAGAAGGAGGCAGG + Intergenic
1087114886 11:94514104-94514126 TAGAATTTGAAGTAGGAGGCTGG - Intergenic
1088977719 11:114830576-114830598 ACGAGGCTGGAGAAGTAGGCTGG + Intergenic
1089891030 11:121880915-121880937 TACATCTTGGAGAAGTAGGCAGG + Intergenic
1089938647 11:122392694-122392716 AAGAAGTGGGAGAGGCAGGCGGG - Intergenic
1091265061 11:134264046-134264068 TAAAATTAGGAAAAGTAGGCTGG + Intronic
1091678029 12:2505502-2505524 TAGAAGTGGTAGAAGTAACCGGG + Intronic
1092175275 12:6400466-6400488 ATGAAGCTAGAGAAGTAGGCGGG + Intergenic
1092305242 12:7293515-7293537 TAGAAGCTGGAGCACTAGTCAGG + Intergenic
1092317959 12:7439881-7439903 AAGGAGTTGGAGTAGTGGGCGGG - Intronic
1092374341 12:7942891-7942913 TAGAAGTTGTGGAAGTTGGAGGG + Intergenic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1095949021 12:47771633-47771655 TAGAAGCTGGAAAAGGCGGCCGG + Intronic
1096252917 12:50044796-50044818 TAGAGGTAGGAGATGGAGGCCGG - Intergenic
1096345224 12:50840540-50840562 TAAAAGGTGAAGAAGTAGGCTGG + Intergenic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1097593957 12:61604503-61604525 GAAAAGTGGGAGAAGTAGGGGGG - Intergenic
1097633441 12:62092612-62092634 TAGAAGTTGGAGAGGAGAGCAGG - Intronic
1098164638 12:67681495-67681517 GGGAAGTGGGAGAAGTAGGGAGG + Intergenic
1098330501 12:69347459-69347481 AAGTAGTTGGTAAAGTAGGCCGG + Intergenic
1098416452 12:70240622-70240644 GGGAAGATGGAGAAGTGGGCAGG + Intergenic
1098622175 12:72614984-72615006 TATAAATTGGAGAAGGAGGAGGG + Intronic
1098954624 12:76677013-76677035 TGGAGTCTGGAGAAGTAGGCAGG + Intergenic
1099133213 12:78862802-78862824 AAGAAGTTGGAGGAGGAGGAAGG - Intergenic
1099186506 12:79521240-79521262 TAGAATTAGCCGAAGTAGGCTGG - Intergenic
1099497463 12:83368306-83368328 GAGAAGATGCAGAAGTAAGCAGG - Intergenic
1100510082 12:95262046-95262068 AAGGAGTTGGAGAAGTGGGATGG - Intronic
1101374431 12:104158553-104158575 TAAAAGTTGAAGAAGAAGGCTGG - Intergenic
1101545686 12:105710284-105710306 ATGAAGTTGGAGAAGTAGGCAGG - Intergenic
1102095509 12:110237433-110237455 TAAAAGTAGGCGAAGGAGGCTGG - Intergenic
1102361535 12:112292125-112292147 ATGAAGTTGGAGACGTAGCCAGG - Intronic
1103250720 12:119497654-119497676 TTGAACTTCGAGAAGAAGGCTGG + Intronic
1103891473 12:124242185-124242207 TTCTAGTTGGTGAAGTAGGCTGG - Intronic
1106245344 13:27944885-27944907 TAGAAGTTGGAAAGGGTGGCCGG + Intergenic
1106906058 13:34409949-34409971 TAGAATTTGGATGAGTAGCCTGG + Intergenic
1107213241 13:37884310-37884332 TAGTGGTGGGGGAAGTAGGCAGG - Intergenic
1107343338 13:39433100-39433122 TAGAGGTAGGAGAACTAAGCTGG + Intronic
1107486006 13:40828220-40828242 TAGAAATTAGAAAAATAGGCCGG + Intergenic
1107780549 13:43897423-43897445 TAGAAATTAAAGAAGTATGCAGG - Intergenic
1109351515 13:61188444-61188466 TAGAAATAGGAAAAGTAGCCGGG + Intergenic
1109892274 13:68631038-68631060 CAAAAGTTAGAGAAATAGGCTGG + Intergenic
1110775485 13:79404522-79404544 AACAAGTTGGACAAGTAGGTAGG - Intronic
1111085361 13:83369983-83370005 GAGAAGTTGGAGAGGAAAGCAGG - Intergenic
1112017205 13:95341216-95341238 TTGCAGTTGGAGAGGTAGGGTGG - Intergenic
1112256850 13:97841966-97841988 TGAAAATTGGAGAAATAGGCTGG - Intergenic
1112606309 13:100910147-100910169 ATGAAGCTGGAGAGGTAGGCAGG + Intergenic
1112746678 13:102534654-102534676 AAGAAGTTGGAGAAGTACATGGG + Intergenic
1113506992 13:110823856-110823878 TAGAAATTGGAGATTCAGGCTGG + Intergenic
1113536965 13:111075956-111075978 CAGCAGTGGGAGAGGTAGGCTGG + Intergenic
1114055136 14:18961815-18961837 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
1114107406 14:19439963-19439985 TAGAAAATGCAGAAGTAGCCTGG + Intergenic
1114259330 14:21025725-21025747 GAGAAGTTGGACAACAAGGCGGG + Intronic
1115160479 14:30388114-30388136 GAGAAGTTGGAAAAGTACACAGG - Intergenic
1115185351 14:30682207-30682229 TAGAAATTGAAGAAATAAGCTGG + Intronic
1115616830 14:35103222-35103244 ATGAAGTTGGAGAAGTAGGCAGG - Intronic
1115864534 14:37729703-37729725 GAGAAGGTGCAGGAGTAGGCAGG - Intronic
1117101271 14:52350774-52350796 TAGAAGTTGTAGAATTAGTATGG + Intergenic
1117174348 14:53131799-53131821 TAGATGTTGGAGGAGCAGGAGGG - Intronic
1117648527 14:57878449-57878471 TTGAGGTTGGAGATGTAGACTGG - Intronic
1117656675 14:57962802-57962824 TAGAAGTTGCAGCAGCAGGGAGG - Intronic
1118110756 14:62716435-62716457 CAGAGGTTAGAGAAGTAGGTAGG - Intronic
1118464398 14:66017546-66017568 TAAAAGCTGGAGAAGTAAGCAGG - Intergenic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119829160 14:77685566-77685588 CAGAAGTTGGAGAACCAGCCTGG + Intronic
1120071539 14:80108800-80108822 TAGAACTCTGTGAAGTAGGCAGG - Intergenic
1122034271 14:98936071-98936093 TAGAGGATGGAGAACAAGGCTGG + Intergenic
1124035523 15:26050514-26050536 TAGCAGCTGGAGAAGCACGCTGG - Intergenic
1124231981 15:27953617-27953639 TTGGAGGTGGAGGAGTAGGCAGG + Intronic
1124877524 15:33609270-33609292 TAGAATTTGTTCAAGTAGGCTGG + Intronic
1125972556 15:43923617-43923639 ATGAAGCTGGAGAAATAGGCAGG + Intronic
1126061027 15:44782777-44782799 TAGCAGGTGGAGCAGTAGTCTGG - Intergenic
1126507267 15:49419667-49419689 AAGAGGTTGGAGAGGCAGGCAGG - Intronic
1126676425 15:51162579-51162601 TAGTAGCTGGAGAAGTAGCATGG + Intergenic
1127352913 15:58170697-58170719 TAAAAGCTGAAGAAATAGGCAGG - Intronic
1127359692 15:58234308-58234330 TAGAAGTTGGGGAAAAAGGCAGG - Intronic
1127918186 15:63472485-63472507 TAGAAGGTGGGGAAGTGGGCTGG + Intergenic
1128225488 15:65998624-65998646 CAGAAGTTGGAGACGTAAGAGGG + Intronic
1128687229 15:69695815-69695837 TGGAAGTTGGAGAAGAAGACAGG - Intergenic
1128985038 15:72213727-72213749 AAGAAGTTGAAAAAGTGGGCTGG - Intronic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1130536271 15:84787145-84787167 TAGAAGATGCACAAGGAGGCGGG - Intronic
1131286453 15:91062991-91063013 TAGAAGCTGAACGAGTAGGCTGG + Intergenic
1131302411 15:91211062-91211084 ATGAAGTTGGAGAGGTGGGCAGG + Intronic
1132954981 16:2586859-2586881 TTGTTGTTGGAGAAGCAGGCTGG + Exonic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135345067 16:21681892-21681914 GGTAAGTTGGAGAAGTGGGCTGG + Intronic
1136116371 16:28097441-28097463 TAGAGGTTGGAGAGGGAGGGAGG - Intergenic
1136360818 16:29778581-29778603 GAGAAGTTGCAGAAGGAGTCGGG - Intronic
1137929355 16:52572141-52572163 TAGAAGTTTGAGAACCAGCCTGG - Intergenic
1139101099 16:63767887-63767909 TGTAAGTTGGAGAAGGAGGAAGG + Intergenic
1140237951 16:73175421-73175443 ACCAAGTTGGAGAAGCAGGCAGG - Intergenic
1140787765 16:78360287-78360309 TAGAAGTTGGAGAAGTAGGCTGG + Intronic
1140817265 16:78632852-78632874 AAGAATTTGGCCAAGTAGGCCGG - Intronic
1142322475 16:89392995-89393017 TAGAATGTGAAGAAATAGGCTGG - Intronic
1142358960 16:89617283-89617305 TGGAGGTGGGAGAGGTAGGCAGG + Intronic
1142499692 17:325373-325395 AGGAAGATGGAGAGGTAGGCAGG - Intronic
1143194405 17:5064546-5064568 TAAAATTTGGAGGAGGAGGCTGG - Intergenic
1143332636 17:6148897-6148919 TTGGAGTTAGAGAAGGAGGCTGG - Intergenic
1143515159 17:7415902-7415924 TAGAAGGTGTAAAAGTAGACGGG - Exonic
1143643989 17:8217743-8217765 TAAAATTTCAAGAAGTAGGCCGG + Intergenic
1145901380 17:28492583-28492605 ATGAAGCTGGAGAAGTAGGCAGG + Intronic
1146393103 17:32441023-32441045 TCGAAGTTGGAGAAGTAGGCAGG + Intergenic
1148546559 17:48523725-48523747 TAGAAGATGGATAAGAAGTCTGG - Intergenic
1148593441 17:48833830-48833852 TAGAAAGAGCAGAAGTAGGCTGG + Intronic
1148891870 17:50813432-50813454 ACGGAGCTGGAGAAGTAGGCAGG + Intergenic
1149556288 17:57575648-57575670 TAGAAATTGGAAAAGGAGCCGGG + Intronic
1149680892 17:58506483-58506505 TAGAAGTTGCATATGTAGGCTGG - Intronic
1150564747 17:66328870-66328892 AAGAGGCTGGAGAGGTAGGCAGG + Intronic
1150727482 17:67663271-67663293 TAAAAGTTGAAGCAGTAGGCCGG + Intronic
1150739915 17:67771108-67771130 TTGAAGATGGTGAAGTGGGCTGG - Intergenic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1151883518 17:76909733-76909755 GAGTAGTGGGAGAAGGAGGCTGG + Intronic
1152334737 17:79694212-79694234 TAGAAGTGGAAGACGGAGGCGGG + Intergenic
1152607938 17:81302461-81302483 TAGAAGTTGGAGACCCAGGTGGG - Intergenic
1153266792 18:3279195-3279217 TACAACTTGGGGCAGTAGGCTGG + Intergenic
1153401441 18:4687691-4687713 TATTAGTTGGAGAAGGAGTCGGG - Intergenic
1153592273 18:6686228-6686250 AAGAGGCTGGAGAAGTAGACTGG - Intergenic
1154157177 18:11952764-11952786 AAGAAATTGGTGAAGCAGGCAGG - Intergenic
1154195703 18:12264847-12264869 TAGAAAGTGGAGAAGTTGGCCGG - Intronic
1155147211 18:23094046-23094068 TAGAAGGTGCAGTGGTAGGCTGG - Intergenic
1155714632 18:28926249-28926271 TAGAAGTTGGAGAATTACTCAGG + Intergenic
1155923438 18:31628924-31628946 TTGAAGATGGAAAAGGAGGCAGG - Intronic
1158526152 18:58216230-58216252 GAGAGGTTTGAGAAGTAGCCAGG + Intronic
1159138763 18:64367902-64367924 GAGAAGTTCAAGAATTAGGCAGG - Intergenic
1161185319 19:2914737-2914759 TAGAAGTTGGAGGGGCAGGAAGG - Intronic
1161519400 19:4715317-4715339 TAGAAGCTGGCCAAGCAGGCTGG - Intronic
1161528381 19:4771525-4771547 TAAAAGTTCCAGAAGTGGGCTGG + Intergenic
1161712325 19:5855928-5855950 TAGATGTTGGAGGAGCAGGAGGG - Intergenic
1162216646 19:9140244-9140266 TAGAAATTGGAGAAATATGCTGG + Intergenic
1162576295 19:11500949-11500971 CAGAAGTTGGAGAAGTGGACAGG - Intronic
1162585031 19:11553235-11553257 TAGAAGGTGGAGAAGGAGAGCGG + Exonic
1162789648 19:13056166-13056188 AAGGAGTTGGGGAAGCAGGCGGG + Intronic
1163032099 19:14551485-14551507 TACTAGTTGGAGAAGCAGACAGG + Intronic
1163386661 19:17004200-17004222 TAGAAACTGGTGAAGAAGGCCGG - Intronic
1163771257 19:19192583-19192605 AAGAAGTAGGGGAAGTACGCGGG - Exonic
1164081002 19:21861309-21861331 TAGATGTTGGAGGAGCAGGAGGG - Intergenic
1166905575 19:46106255-46106277 TAGATGTTGGAGGAGCAGGAGGG + Intergenic
1168164701 19:54538677-54538699 TAGAAGATGGACAATAAGGCTGG - Intronic
1168225757 19:54993836-54993858 CAGAAGTTGGAGAAGTAAAAAGG - Intronic
1168429003 19:56262313-56262335 TAGAAGTTAGAAAAGTGGGCCGG - Intronic
927205584 2:20608276-20608298 TAGAAGTAGCAGAAACAGGCCGG + Intronic
927377690 2:22437365-22437387 TAAAAGTTAGGAAAGTAGGCTGG + Intergenic
927775000 2:25895884-25895906 AAGATGTGGGAGAGGTAGGCAGG + Intergenic
928389116 2:30895494-30895516 TAGAGGTTGGAGAAGAACACTGG - Intergenic
929041810 2:37751596-37751618 GAGAAGTTGGAGAGGTGGCCAGG - Intergenic
929622021 2:43364828-43364850 ATGAGGTTGGAGAGGTAGGCTGG + Intronic
930290916 2:49491425-49491447 TAGCAGTTGCAGCAGTAGGCTGG - Intergenic
932917566 2:75874721-75874743 TATTAGTTGGAGAAGGAGTCGGG - Intergenic
932942941 2:76190565-76190587 TAGAAGTAGAAGAAGACGGCAGG - Intergenic
933247226 2:79989324-79989346 TACAAATTGGAGTATTAGGCTGG + Intronic
935416066 2:102820745-102820767 ATGAAGTTGGAGAAGCAGGAAGG + Intronic
936466199 2:112753440-112753462 ACGAGGTTGGAGAGGTAGGCAGG - Intronic
936732148 2:115395619-115395641 TAGGAGTTAGAGAAGAAGGTGGG - Intronic
937002453 2:118479875-118479897 AAAAACTTTGAGAAGTAGGCAGG - Intergenic
937594796 2:123660311-123660333 TAGATGTTGGAGGAGCAGGAAGG + Intergenic
938276698 2:130032389-130032411 TAGAAGTTCAACAAGAAGGCTGG + Intergenic
938327656 2:130423158-130423180 TAGAAGTTCAACAAGAAGGCTGG + Intergenic
938362291 2:130698320-130698342 TAGAAGTTCAACAAGAAGGCTGG - Intergenic
938421100 2:131147500-131147522 TAAAACTTGGAGAAGCTGGCTGG + Exonic
938438688 2:131305009-131305031 TAGAAGTTCAACAAGAAGGCTGG - Intronic
938473146 2:131584604-131584626 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
938785666 2:134626399-134626421 TAAAAGCTGGAAAAGGAGGCTGG - Intronic
939251394 2:139685377-139685399 GTGAAGTTAGAGAAGTAGGAGGG + Intergenic
940391200 2:153134616-153134638 TAGAAGTTTGAGAAGGAGATTGG - Intergenic
942211894 2:173679453-173679475 TAAAAGTTTGAGGAGTAGGAGGG + Intergenic
942257243 2:174115637-174115659 TTGAAGTTGGAGAAGGAAACAGG - Intronic
942426482 2:175865841-175865863 TATAAGTGAGAGAAGGAGGCAGG + Intergenic
942909523 2:181226383-181226405 GAGAAGGTGGAAAAGGAGGCAGG - Intergenic
943779759 2:191810302-191810324 TAGAAGTTGGAAAAGGAAACAGG - Intergenic
944274262 2:197818192-197818214 TAGAAGTTGGTGTACTAGGATGG + Intronic
945549781 2:211206619-211206641 TAGAAGATAGATAAGTAGGTAGG + Intergenic
945853307 2:215035803-215035825 CAAAAGCTGGAGAAGTAAGCAGG - Intronic
946253548 2:218428060-218428082 TGGTAGCTGGAGAGGTAGGCAGG + Exonic
947210620 2:227705302-227705324 TAGAAGTTGTAGAGGAAGACTGG + Intronic
947488940 2:230577519-230577541 TAGAGGCTGGAGAAATAGGAAGG + Intergenic
947705585 2:232273017-232273039 GTGAAGGTGGAGGAGTAGGCTGG - Intronic
1168731132 20:82021-82043 TAAAAGAAGGAGAAATAGGCTGG + Intergenic
1172012278 20:31852512-31852534 TAGAAGTTGGAGATGTTGGCCGG + Intronic
1172154291 20:32812855-32812877 AAGAAAGGGGAGAAGTAGGCAGG - Intergenic
1172554517 20:35829320-35829342 AATATTTTGGAGAAGTAGGCTGG - Intronic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1173164475 20:40676995-40677017 TAGGAGTAGGAGAAGTAGGAGGG + Intergenic
1173784508 20:45782937-45782959 TTGAGGTTGGAGAGGTAGGCAGG - Intronic
1173816549 20:45993113-45993135 TAGAAGTTGGAGGACTAGCTGGG + Intergenic
1174985632 20:55448531-55448553 TTGAAGTTGGTCAAGTAGGGAGG - Intergenic
1175577749 20:60075283-60075305 TAAAAATTGGAGATGGAGGCTGG + Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176955668 21:15100298-15100320 TAGTAGTAGTAGTAGTAGGCAGG - Intergenic
1177534493 21:22406298-22406320 TGGAAGTTAGAGAACAAGGCCGG - Intergenic
1177896155 21:26857721-26857743 TATTAGTTGGAGAAGGAGTCAGG - Intergenic
1180473618 22:15684365-15684387 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
1181154099 22:20907308-20907330 TAGAAGTTGTGGTAGTAGGTTGG + Intergenic
1181286656 22:21757264-21757286 TAGAAGTTGGAGAGGAATCCTGG - Exonic
1181642826 22:24213513-24213535 AAGAAGTTAGTAAAGTAGGCTGG - Intergenic
1182565602 22:31196203-31196225 TAGAAGTTAGAGGAGCAGGTGGG - Intronic
1183033558 22:35123519-35123541 TAAAAGGTGGAGAAGGCGGCAGG - Intergenic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183792855 22:40087808-40087830 GAGGAGCTGGAGATGTAGGCAGG + Intronic
1184075436 22:42174360-42174382 TAGAAGCTGGACCAGAAGGCAGG + Intronic
1203294027 22_KI270736v1_random:23116-23138 GAGAAGTTGGAGAGGTGGCCAGG - Intergenic
949191554 3:1255491-1255513 TAAAAGCTGGAGAAATTGGCAGG + Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949474720 3:4432490-4432512 GTTAGGTTGGAGAAGTAGGCAGG - Intronic
949607480 3:5670192-5670214 CAAAATTTGGTGAAGTAGGCTGG + Intergenic
950249620 3:11453491-11453513 AAAAGGGTGGAGAAGTAGGCGGG + Intronic
950838424 3:15942879-15942901 TAGAAGAGAGAGAAGAAGGCAGG - Intergenic
950931178 3:16790473-16790495 AAGAATTTGGGGAAGCAGGCTGG - Intergenic
951303521 3:21028293-21028315 ATGAAGTTGGTGAAGTAGGCAGG - Intergenic
951763255 3:26167886-26167908 TAGAAGTTAGAAAAAAAGGCAGG - Intergenic
953431485 3:42844219-42844241 TGGAAGTTGGAGACATGGGCAGG + Intronic
953435079 3:42871602-42871624 TAGAAGGAGGAGAAATGGGCTGG - Intronic
953609437 3:44435185-44435207 TATAGGTTAGAGAAGTAGGGTGG - Intergenic
953834291 3:46329707-46329729 TAGATGTTGGAGGAGCAGGAGGG + Intergenic
954804144 3:53205849-53205871 AAGAAATAGGAGAAATAGGCTGG + Intergenic
956043635 3:65172540-65172562 CAGAGGTTGGACAAGTAAGCCGG - Intergenic
956122393 3:65979230-65979252 TAGAAGCTGGAGTAGAAGGAAGG - Intronic
956529323 3:70200359-70200381 CAGAAGTCAGAGAAATAGGCAGG - Intergenic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
957252907 3:77796993-77797015 TACAAATTGTAAAAGTAGGCCGG - Intergenic
957950481 3:87119855-87119877 AAGAACTTGGACAAATAGGCTGG - Intergenic
957955931 3:87187010-87187032 ATGAAGCTGGGGAAGTAGGCAGG + Intergenic
958670934 3:97203007-97203029 GAGGAGTTGGAGAGGTAGGCAGG + Intronic
958747803 3:98158438-98158460 GTGAAGTTGGAGAAGTCAGCTGG + Intergenic
958753100 3:98216206-98216228 GTGAAGTTGGAGAAGTCAGCTGG + Intergenic
959637954 3:108596471-108596493 TAGAGGTTGGAGAAGTGTGGAGG + Intronic
959676247 3:109039210-109039232 TAGAAATCAGAGAAGCAGGCGGG - Intronic
959790105 3:110349483-110349505 TAGAAGTTAGAGTAGAAGGTAGG + Intergenic
960223401 3:115143860-115143882 CAGAAGTTTGAGAAGGAGGAAGG - Intronic
962022054 3:131511750-131511772 TAGATGTTAGAGAAGCAGGAGGG + Intergenic
962769277 3:138597113-138597135 TAGAAGTTGAGAAATTAGGCCGG - Intergenic
962816463 3:139005567-139005589 TAGAGGTTGGAGAGGTGAGCTGG + Exonic
962817959 3:139019963-139019985 TAGAGGTTGGAGAGGTGAGCTGG + Exonic
962820458 3:139043922-139043944 TAGAGGTTGGAGAGGTGAGCTGG + Exonic
964795467 3:160492111-160492133 AAGTAGTTAGAGAAGTAGGCAGG + Intergenic
965529515 3:169757199-169757221 TAGAAGATGGTGAACTGGGCTGG + Intergenic
965537492 3:169838238-169838260 TAAAAGTTTTAAAAGTAGGCTGG - Intergenic
966254641 3:177904001-177904023 AAGAAATTGGAGTAGTGGGCAGG + Intergenic
966979464 3:185117752-185117774 GACAAGCTGGAGAAGTAGGCAGG - Intronic
966979802 3:185121665-185121687 GTGAAGTTGGAGAAGTAGTAAGG + Intronic
967575324 3:191083111-191083133 TAGAAAATAGAGAAATAGGCTGG + Intergenic
967780253 3:193430755-193430777 GTGAAGTTGGTGAAGTAGTCAGG + Intronic
970091207 4:12410305-12410327 TAGTAGTTTGAGAACTGGGCAGG + Intergenic
970790477 4:19852487-19852509 TAGAAGTTGTAGAAATGGGTGGG - Intergenic
971304523 4:25467983-25468005 TTGAAATAGGAGAAATAGGCCGG + Intergenic
971864949 4:32157272-32157294 TAGAAGTAGTAGTACTAGGCCGG - Intergenic
972015283 4:34235628-34235650 TGGAAGTTTGAGAACAAGGCAGG + Intergenic
972277477 4:37570735-37570757 TAGAAGTTGGAGTATTTGGAAGG - Intronic
973061113 4:45726086-45726108 TGGGAGTTGGAGAAGTGGGATGG + Intergenic
974120359 4:57630917-57630939 GAGAAGCTGCAGAAGTAAGCAGG - Intergenic
974422580 4:61696971-61696993 TAGAACTTGGAGAATATGGCTGG - Intronic
976739755 4:88345964-88345986 TAGACGTTGGAGGAGCAGGAGGG + Intergenic
978850084 4:113324654-113324676 TAGAATTTGGAGAATTAGGAAGG + Intronic
978854834 4:113382430-113382452 TAGATCTTGGACAAGTTGGCAGG + Exonic
978909462 4:114047466-114047488 TATTAGTTGGAGAAGGAGTCAGG - Intergenic
979833458 4:125330352-125330374 TAGAAATTGGTGAAGGAGGCTGG - Intronic
980125676 4:128771689-128771711 TAGAAATTGGAGTAGAAGGCCGG + Intergenic
981440379 4:144775679-144775701 ATCAAGTTGGAGATGTAGGCAGG + Intergenic
981950445 4:150400131-150400153 ATGAAGTTGGGGAAGTAAGCAGG + Intronic
982003392 4:151042135-151042157 ATTAAGTTGGAGAGGTAGGCAGG + Intergenic
985198774 4:187462313-187462335 TAAAATTTGGAGAAGCAGCCAGG + Intergenic
985679880 5:1250318-1250340 TAGAAGTGAGAGAGGGAGGCAGG - Intergenic
986111961 5:4728225-4728247 GGGAAGATGGAGAAATAGGCTGG + Intergenic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987383430 5:17307106-17307128 TGGAGGTTGAAGAAATAGGCTGG - Intergenic
987885041 5:23801669-23801691 TATAAATTGGTGAAGTAGGAAGG + Intergenic
988995036 5:36706514-36706536 TAAAAGTGGAAGAAGGAGGCAGG + Intergenic
989248769 5:39283158-39283180 AAGAAGTTAGAGAAGTGGGATGG - Intergenic
989629498 5:43466600-43466622 TAGAAAGTGAAAAAGTAGGCGGG + Intronic
989658206 5:43768188-43768210 AAGAGGTTGGAGAAGAAGCCAGG + Intergenic
989688722 5:44116924-44116946 TAGATGTTGGAGGAGTAGGAGGG + Intergenic
989697836 5:44224645-44224667 GAGAAGTTAGAGAAGAAGGTGGG + Intergenic
990986959 5:61649553-61649575 GTGAGGTTGGAGAGGTAGGCAGG - Intronic
994325085 5:98438067-98438089 TAGATGTTGGAGGAGCAGGAGGG - Intergenic
994598580 5:101872074-101872096 TAAAAGTTGCATATGTAGGCAGG + Intergenic
994816270 5:104591779-104591801 TAGCAGGTGGAGAAGGAGGAGGG - Intergenic
995349323 5:111157011-111157033 TACAAGGTAGAGAAGTAGACAGG - Intergenic
995683117 5:114743030-114743052 GAGAAGTTGGGGCAGAAGGCAGG - Intergenic
996557065 5:124788898-124788920 TAGAAGTTGGTGACACAGGCTGG - Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996992013 5:129646182-129646204 TAAAAATTGGAAAAGGAGGCCGG - Intronic
997946602 5:138208246-138208268 TAGAATTTGGAGGATTGGGCCGG - Intronic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
998822820 5:146072307-146072329 TAGCTGTTGGAGAAGTTTGCAGG + Intronic
1000917490 5:167099972-167099994 TAGAAGTTGAAGAAGTACCAAGG - Intergenic
1001132781 5:169078532-169078554 GTGAAGTTGGTGAAGTAGGAAGG - Intronic
1001591753 5:172870368-172870390 TGGAAATTAGAGAAGTGGGCTGG - Intronic
1003800724 6:9663910-9663932 TAGAGGTGTGGGAAGTAGGCAGG + Intronic
1003836565 6:10077743-10077765 AAGAATTTGGGGCAGTAGGCTGG + Intronic
1004590506 6:17047030-17047052 TGGAAGCTGGACAGGTAGGCAGG + Intergenic
1006362994 6:33597864-33597886 TAGGAGTCAGAGAAGTAGGAAGG + Intergenic
1006530271 6:34646203-34646225 TAGCAGTTTGACAAGTAGGTTGG + Intronic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1007132132 6:39485031-39485053 TTGAAGATGGAGAAATATGCAGG - Intronic
1008037889 6:46765234-46765256 TAGGATTTGGAGAAGCAGGAGGG - Intergenic
1008610628 6:53181776-53181798 TAAAGATTGGAGAAATAGGCTGG - Intergenic
1008891637 6:56499525-56499547 TAGGAGTAGGAGAAGAAAGCAGG + Intronic
1010099944 6:72092358-72092380 AATAAGTTGGAGAAGTTGACAGG + Intronic
1010203831 6:73306172-73306194 TATAAGTAGGAGCAGGAGGCAGG - Intronic
1011189879 6:84717577-84717599 TATTAGTTGGAGAAGGAGCCGGG + Intronic
1011427424 6:87245934-87245956 TAGAAATTTAAAAAGTAGGCTGG + Intronic
1011811498 6:91137306-91137328 TAGAGATTGGAGAAGTAGCCTGG + Intergenic
1013217330 6:108039761-108039783 TAGAAATTGTAAAATTAGGCTGG - Intergenic
1013222737 6:108093731-108093753 AAAAAGTGGGAGAAGTAGGTAGG + Intronic
1013598656 6:111684128-111684150 AAGAAGTTTGAGAAGGAGGGAGG + Intronic
1014026278 6:116650124-116650146 TAGAAGGTAAAGAAGCAGGCCGG + Intronic
1014036227 6:116769588-116769610 TTGAGCTTGGAGAGGTAGGCAGG - Intergenic
1015333223 6:132005589-132005611 AAGAAGGTGGAGGAGCAGGCAGG + Intergenic
1015535154 6:134260055-134260077 TAGAAAGTAGACAAGTAGGCTGG + Intronic
1015828422 6:137341301-137341323 AAGAAATTGGATGAGTAGGCAGG - Intergenic
1016023400 6:139259356-139259378 ATGAAGTTGGAGAGGTAAGCAGG - Intronic
1016189999 6:141253438-141253460 TAATAGTTGGAGAAGTCGACTGG + Intergenic
1017361855 6:153582438-153582460 TAGAAGTTTGAGAACTGAGCTGG - Intergenic
1018747428 6:166773222-166773244 TGCAGGTTGGAGAAGGAGGCAGG + Intronic
1019504192 7:1382677-1382699 TAGAAGCTGGAAACGTGGGCTGG - Intergenic
1021365939 7:19777842-19777864 TAAAAGTTGTTGAAATAGGCTGG + Intergenic
1022143223 7:27511722-27511744 TATAAAATGGAGAAGCAGGCTGG - Intergenic
1023564353 7:41508681-41508703 TAGAAGCTGGAGAAGCAGCATGG - Intergenic
1024533955 7:50414719-50414741 AATCAGTAGGAGAAGTAGGCCGG + Intergenic
1026258585 7:68734420-68734442 AAGAAGTAGGACAAGAAGGCCGG - Intergenic
1027766658 7:82352578-82352600 TAAAAGATGGAGATGCAGGCTGG + Intronic
1028829707 7:95314060-95314082 TAAAAGCAGGTGAAGTAGGCTGG + Intronic
1029318370 7:99735222-99735244 TATATGCTGGAGAAGGAGGCAGG + Intergenic
1030169602 7:106588247-106588269 TAGAAGTTTGAGAAAGAGGATGG - Intergenic
1030300382 7:107968552-107968574 TAAAAGTGGGAGAGGCAGGCAGG + Intronic
1030337196 7:108340147-108340169 TATTAGTTGGAGAAGGAGTCAGG - Intronic
1030510679 7:110479202-110479224 ATGAGGTTGGAGAAGTAGGCAGG - Intergenic
1030511101 7:110482791-110482813 ATGAGGTTGGAGAAGAAGGCAGG - Intergenic
1030662267 7:112232957-112232979 CAGGAGTTGGTGAGGTAGGCAGG - Intronic
1030991795 7:116309860-116309882 AAGAGGTTGAAGAAATAGGCAGG + Intronic
1032235922 7:130122753-130122775 TAGGAGTTTGAGAAGCAGCCTGG - Intronic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033497601 7:141915552-141915574 TAGAAAATGGAGCAGTAGGAAGG - Intronic
1034055900 7:148034717-148034739 GAAAATTTGGAGGAGTAGGCTGG + Intronic
1034378256 7:150665545-150665567 TAAAAGTTGGAGAAGCTGGGAGG + Intergenic
1034726605 7:153341806-153341828 TAGAAGTAGGTGAAGTAGGGAGG + Intergenic
1035284729 7:157799013-157799035 TAGAAGTTGGAGAAGAAAGGAGG - Intronic
1037052561 8:14394443-14394465 TAGAAGGTAGGGAAGTGGGCTGG - Intronic
1037372644 8:18196244-18196266 TAAAAGTTGTAAAAGTTGGCTGG - Intronic
1037512777 8:19600374-19600396 TACAAAATAGAGAAGTAGGCTGG - Intronic
1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG + Intergenic
1037984983 8:23284875-23284897 TATCAGTGGGAGAAGCAGGCTGG - Intronic
1039012741 8:33112698-33112720 TTAAAGTTGGAGAGGTAGGCTGG + Intergenic
1039051088 8:33494368-33494390 TAAAAGTTGTAGAACCAGGCTGG - Intronic
1041709560 8:60881498-60881520 CAGAAGTCGGAGGAGAAGGCAGG - Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1042722262 8:71839400-71839422 TTGGGGTTGGAGAAGTGGGCAGG - Intronic
1042847041 8:73178732-73178754 TATATGTTGGAGACGGAGGCAGG - Intergenic
1043815746 8:84799071-84799093 TAGAAGTTGGGGAGCAAGGCAGG + Intronic
1044194922 8:89364042-89364064 TAGAATTGGGAAAAGTAGGATGG + Intergenic
1044260393 8:90113028-90113050 ATGAGGTTGGAGAGGTAGGCAGG + Intergenic
1044387942 8:91612103-91612125 GATGAGCTGGAGAAGTAGGCTGG + Intergenic
1045115140 8:98973486-98973508 TGGAAGGTGGAGAACTAGGCCGG + Intergenic
1045233721 8:100330822-100330844 ATGAAGTTGGAGAGGTGGGCAGG - Intronic
1045258294 8:100548260-100548282 ATGAATTTGGAGAGGTAGGCAGG - Intronic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1050271480 9:3950430-3950452 ATGAGGCTGGAGAAGTAGGCGGG - Intronic
1050395999 9:5196513-5196535 GAGGAGGTGGAGAAGTAGGGAGG - Intergenic
1050465367 9:5917409-5917431 ATGAAGCTGGAGAGGTAGGCAGG + Intronic
1051474493 9:17490093-17490115 TAGAAATAGGAAAAGTAGGCTGG + Intronic
1051477385 9:17522872-17522894 TGGTACTTGGAGAAGTAGACAGG - Intergenic
1054851608 9:69852448-69852470 TAGCAGTTGGAGGAGTTGTCTGG + Intronic
1056508050 9:87276060-87276082 TAAAAGTTGGAACAGTAGGCCGG + Intergenic
1056844668 9:90026773-90026795 GAGAATTTGCAGAAATAGGCTGG - Intergenic
1057796006 9:98158713-98158735 TAGGAGTTGGTCATGTAGGCAGG + Intronic
1058640453 9:107079099-107079121 GAGAGGTGAGAGAAGTAGGCAGG - Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059227244 9:112683256-112683278 CAGGAGTTGGAGAAGCAGCCTGG + Intergenic
1059352561 9:113676042-113676064 TTAAAGGTGGAGAAATAGGCTGG + Intergenic
1059658967 9:116382526-116382548 CACAAGCTGGAGAAGTGGGCAGG - Intronic
1059786882 9:117596147-117596169 TAGAAGTTGGGAAAGCAGCCAGG - Intergenic
1059815004 9:117902429-117902451 TTTAAGTTGGAGAAACAGGCTGG - Intergenic
1059819542 9:117956806-117956828 AATTAGTTGCAGAAGTAGGCAGG + Intergenic
1060647883 9:125297628-125297650 AGGAAATTGGAGAAGTAGCCAGG + Intronic
1060749338 9:126158743-126158765 TTCAACTTGGAGAAGTAGCCTGG - Intergenic
1061025925 9:128049461-128049483 AAGAAAGTGGAGAAGTTGGCCGG + Intergenic
1061267017 9:129512135-129512157 GAGGAGTTGGAGAAGGAGCCAGG - Intergenic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1186386596 X:9116283-9116305 CAGGAATTGGAGGAGTAGGCTGG - Intronic
1186720797 X:12301373-12301395 GAGAAGCTGCAGAAGTAGGTTGG - Intronic
1187695244 X:21913000-21913022 AAGAAATTGGAGAAGATGGCCGG - Intergenic
1189062271 X:37767362-37767384 TAAAAGTTGAAGAAGTTTGCTGG - Intronic
1189814859 X:44814336-44814358 TAAAAGTAGGATAAGCAGGCTGG - Intergenic
1191598548 X:62975113-62975135 TAGAAGTTGGAAAAGTTTGGAGG - Intergenic
1192440045 X:71167595-71167617 TAGAAGGCGTAGAAGTAGGTAGG - Exonic
1192454834 X:71268002-71268024 TAGATGTTGGAGGAGCAGGAGGG - Intergenic
1192583441 X:72302883-72302905 CAGAAGTTGGATAAATTGGCGGG + Exonic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195485483 X:105400056-105400078 ATGAAGCTGGAGAAGTAAGCAGG + Intronic
1196324906 X:114391202-114391224 CAGAAGTTGGAGAAGAAGAGAGG + Intergenic
1196751586 X:119122441-119122463 TAGAAGTTTTAGAACTAGTCAGG - Intronic
1197240700 X:124119892-124119914 TAGAAGATAGATGAGTAGGCAGG + Intronic
1197572398 X:128165300-128165322 TAGAAGTTGTAGGCATAGGCTGG - Intergenic
1197823131 X:130561643-130561665 ATGAAGCTGGAGAATTAGGCGGG + Intergenic
1198511730 X:137358823-137358845 ATGAAGATGGAGAAGTAGCCAGG - Intergenic
1198931976 X:141871848-141871870 TAACAGGTGGAGAAGTAGGAGGG + Intronic
1199537340 X:148917637-148917659 CAGTAGTTGGAGAAGTTGGATGG + Intronic
1201949802 Y:19550928-19550950 TAGTAGGTGGAGAAGGAGGTGGG + Intergenic
1202345666 Y:23922854-23922876 TAAAATTTGATGAAGTAGGCAGG - Intergenic
1202525105 Y:25747236-25747258 TAAAATTTGATGAAGTAGGCAGG + Intergenic