ID: 1140788181

View in Genome Browser
Species Human (GRCh38)
Location 16:78363799-78363821
Sequence CAGTGAGGTCCTGTAGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140788177_1140788181 -3 Left 1140788177 16:78363779-78363801 CCTCCAGCTTACAGCGGAGACAG 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1140788181 16:78363799-78363821 CAGTGAGGTCCTGTAGGATGAGG 0: 1
1: 0
2: 0
3: 24
4: 326
1140788175_1140788181 -1 Left 1140788175 16:78363777-78363799 CCCCTCCAGCTTACAGCGGAGAC 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1140788181 16:78363799-78363821 CAGTGAGGTCCTGTAGGATGAGG 0: 1
1: 0
2: 0
3: 24
4: 326
1140788178_1140788181 -6 Left 1140788178 16:78363782-78363804 CCAGCTTACAGCGGAGACAGTGA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1140788181 16:78363799-78363821 CAGTGAGGTCCTGTAGGATGAGG 0: 1
1: 0
2: 0
3: 24
4: 326
1140788176_1140788181 -2 Left 1140788176 16:78363778-78363800 CCCTCCAGCTTACAGCGGAGACA 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1140788181 16:78363799-78363821 CAGTGAGGTCCTGTAGGATGAGG 0: 1
1: 0
2: 0
3: 24
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140788181 Original CRISPR CAGTGAGGTCCTGTAGGATG AGG Intronic
900282338 1:1878852-1878874 CAGTGAGTTCCAGTGGGGTGAGG - Intronic
900295447 1:1946894-1946916 CAGTGAGGGCCAGTGGGTTGGGG + Intronic
900394415 1:2447290-2447312 CAGAGTGGTCCTGGAGGATGCGG - Intronic
901317562 1:8318941-8318963 CAGTGAGGTCCTCCAGGACCAGG - Intronic
902644758 1:17790652-17790674 CAGGGAGGACCTGAAGGCTGGGG - Intronic
902865439 1:19274531-19274553 CCGTGTGGTCCTGGAGGATGAGG + Intergenic
902867557 1:19289164-19289186 CCGTGTGGTCCTGGAGAATGAGG + Exonic
903082351 1:20820551-20820573 CAGGGAGGACCTGAAGGCTGGGG + Intronic
904849435 1:33446271-33446293 TAGGGAGGCCCAGTAGGATGTGG + Intergenic
904939279 1:34153707-34153729 CAGAAACCTCCTGTAGGATGTGG + Intronic
905396433 1:37669573-37669595 AAGAGAGGACATGTAGGATGAGG - Intergenic
906082429 1:43102085-43102107 CAGTAAGGGCCTGAAGGCTGAGG - Intergenic
906164740 1:43677929-43677951 TAGTGAGGACCTGTAGGTGGTGG + Intronic
906855059 1:49295234-49295256 CTGTGAGGTCCTGGAGAGTGGGG - Intronic
907339767 1:53726608-53726630 CTGTGGTGTCCAGTAGGATGAGG - Intronic
907603667 1:55794393-55794415 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
907761813 1:57368339-57368361 CAGGGAGGGGCTGAAGGATGGGG + Intronic
910834507 1:91494657-91494679 CAGTGGGTCCCTGTTGGATGAGG - Intergenic
911406924 1:97452684-97452706 GAGTGAGTTCTTGTAAGATGTGG + Intronic
912472121 1:109913001-109913023 CAGTGAGGCCTTGAAAGATGGGG - Intronic
912849535 1:113110372-113110394 CAGTGAAATCCTGTATGACGTGG + Exonic
912888761 1:113504898-113504920 CTGTGAGGTACTGTTGAATGAGG + Intronic
913118509 1:115718432-115718454 CATTGAGGTCAATTAGGATGTGG + Intronic
915943395 1:160133247-160133269 CAGAGGGGTCAAGTAGGATGAGG + Intronic
916648851 1:166816637-166816659 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
917273231 1:173301678-173301700 CAGTGTGGTGGTGTTGGATGAGG - Intergenic
917704962 1:177623143-177623165 CAATGAGTGCCTGTGGGATGAGG + Intergenic
918930940 1:190856167-190856189 CAGTGAGGGCCAGGATGATGAGG + Intergenic
919083264 1:192891522-192891544 CAGGGAGGTCTTGAAGGCTGGGG - Intergenic
919165315 1:193885062-193885084 CAGAGAGGGCCTGAAGGCTGGGG - Intergenic
919191787 1:194230506-194230528 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
919239197 1:194889602-194889624 CAGGGAGGGCCTGGAGGCTGAGG + Intergenic
919313998 1:195948385-195948407 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
919965753 1:202523483-202523505 TAGTGAGGTCCTCTAGCAAGAGG + Intronic
920269544 1:204752516-204752538 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
921180006 1:212624724-212624746 CAGTGGGGGCCTGTGGGGTGGGG + Exonic
922786621 1:228286094-228286116 CATCGAGGACCTGGAGGATGTGG + Exonic
923202054 1:231722352-231722374 AAATGAGGTTCTGTAGAATGCGG + Intronic
923627364 1:235625003-235625025 CACTGAGGTGCTGGTGGATGCGG + Intronic
924241261 1:242043398-242043420 GAGTGAGTTCCTGTAAGATCCGG + Intergenic
924673040 1:246148085-246148107 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
924815071 1:247434336-247434358 CAGTGAGGCCCGGTGGGCTGGGG + Intronic
1063770743 10:9196750-9196772 GAGTGAGATCCTCTAGGAGGAGG + Intergenic
1066672764 10:37857764-37857786 CAGCGAAGTCCTGTAGCACGGGG - Intronic
1067189276 10:44056292-44056314 GAGTCAGGTCCTGTGGGATGAGG + Intergenic
1068672550 10:59738596-59738618 CAGTGAGGTAGTGTAGGAAGTGG + Intergenic
1068926159 10:62541392-62541414 GAGTGAGTTCCTGTGAGATGTGG + Intronic
1070387924 10:75942654-75942676 CAGTGATGCCCTGGAGGATTTGG + Intronic
1071517667 10:86309823-86309845 CAGTGAGGCTTTGTAGGAGGAGG - Intronic
1071605439 10:86983381-86983403 AATTGAGGCCCTGAAGGATGAGG + Intronic
1072154736 10:92714597-92714619 CAGAGAGGGCCTGAAGGCTGGGG - Intergenic
1074290225 10:112132731-112132753 CAGTGAGTTCATGCAGGATTTGG + Intergenic
1075405962 10:122195923-122195945 AAGTGGGGTCCTGTAAGTTGTGG - Intronic
1075785142 10:125044195-125044217 CTGAGAGGCCCTGTAGGCTGCGG - Intronic
1075809718 10:125216206-125216228 CCGTGAGGTGCTCTAGGAAGCGG + Intergenic
1076549157 10:131267017-131267039 CAGGGAGGACCTGAAGGCTGGGG - Intronic
1076784113 10:132740886-132740908 CAGTGATTTCCTGGAGGAGGAGG + Intronic
1077001679 11:326567-326589 CAGTGAGGTCCTGCAGCAGCTGG - Intronic
1077395773 11:2320438-2320460 CAGTGAAGTCCTATAGGATATGG - Intergenic
1077912710 11:6587042-6587064 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
1078449271 11:11428274-11428296 GAGTGAGCTCCTGGAGGACGTGG - Intronic
1078836432 11:15035050-15035072 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
1079257614 11:18845956-18845978 CAGAGAGGTAGTGTAGGATAGGG + Intergenic
1079882340 11:25943878-25943900 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1083631810 11:64099327-64099349 CTGTGAGCTCCTGGAGGATGAGG + Intronic
1083998375 11:66283272-66283294 CTCTGAGGTCATGTATGATGCGG + Exonic
1085795162 11:79532713-79532735 CAGGGAGGTCCTGGACGTTGGGG + Intergenic
1086455821 11:86957524-86957546 CTGTGAGATCCTAAAGGATGAGG - Intergenic
1088135656 11:106552671-106552693 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1089172958 11:116527909-116527931 CAGTAAGGGCCTGAAGGCTGAGG + Intergenic
1089710453 11:120310838-120310860 CAGTGAGGTCCTCTGGGACAGGG - Intronic
1089739693 11:120573871-120573893 CAGTGTGGGCCTCTGGGATGTGG - Intronic
1089823165 11:121246610-121246632 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1091380026 12:51645-51667 CAGCGAAGTCCTGTAGGACAAGG - Intergenic
1091408009 12:220981-221003 CAGTGAGGTCCTGGGGGTGGCGG + Exonic
1093153571 12:15653325-15653347 GAGTGTGGTTCTGTAGGCTGTGG - Intronic
1094267962 12:28580365-28580387 AACTGAGGTCCTTTAGGATGAGG - Intergenic
1094427301 12:30328409-30328431 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1095289278 12:40458226-40458248 CAGTGAACTCCTGAAGGAAGAGG - Intronic
1096602198 12:52737199-52737221 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1096602860 12:52742534-52742556 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1096966907 12:55635756-55635778 CTGTGAGATCCTGCAGGACGTGG - Intergenic
1097076274 12:56397212-56397234 CAGGGAGGACCTGAAGGCTGGGG - Intergenic
1097129951 12:56804674-56804696 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1097415950 12:59317100-59317122 GAGTGAGTTCCTTTAGGGTGAGG - Intergenic
1100672852 12:96835451-96835473 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
1104567853 12:129901601-129901623 AAATGAGGTCCTGTGTGATGTGG - Intronic
1104716360 12:131018903-131018925 CTGTGAGGTCCTGCAGGTGGGGG + Intronic
1105071301 12:133235768-133235790 CAGGGGGGTCCGGGAGGATGAGG - Exonic
1106537500 13:30660265-30660287 CAGGGAGGGCCTGAAGGCTGAGG - Intronic
1107875842 13:44789955-44789977 CAGGGAGGGCCTGAAGGTTGGGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108975924 13:56443097-56443119 CAATGAGGTCCATTTGGATGAGG - Intergenic
1109030027 13:57179547-57179569 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1109426079 13:62167840-62167862 CAGGGAGGTCCAGGAGGGTGGGG - Intergenic
1110306754 13:73996832-73996854 AAGTGCGGTAGTGTAGGATGAGG - Intronic
1110633416 13:77736715-77736737 CAGGGAGGGCATGTAGGATAAGG - Intronic
1111142593 13:84140058-84140080 CAGTGAGGTGTTGTATGATATGG - Intergenic
1111274866 13:85935507-85935529 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1111586868 13:90292673-90292695 CAGTGTGTTCCTTTAGGATTGGG - Intergenic
1112326381 13:98445025-98445047 CCGTGAGGGGCTGCAGGATGTGG - Intronic
1115457362 14:33618928-33618950 CAGTGAGGTGCTGTCAGTTGTGG + Intronic
1116009766 14:39337421-39337443 CAGTTAGGTCTTGTTGGTTGAGG - Intronic
1116130849 14:40854520-40854542 CAGAGAGGGCCTGAAGGCTGGGG + Intergenic
1118367816 14:65110618-65110640 CTGTGAGGTCCTGTGTGATCTGG + Intergenic
1119199248 14:72740821-72740843 GAGTGAGGTCCTGCAAGCTGTGG + Intronic
1120436957 14:84494347-84494369 CAGTGAAGTCCGGGATGATGAGG + Intergenic
1121553382 14:94819230-94819252 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1121695359 14:95908056-95908078 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1122358180 14:101136761-101136783 CACTGAGCTCCTTCAGGATGAGG - Intergenic
1122491240 14:102117282-102117304 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
1122506165 14:102233218-102233240 CAGGGAGGGCCTGTGGGCTGAGG - Intronic
1123721108 15:23062680-23062702 CAGTGAAGTCCAGTCTGATGAGG - Intergenic
1123888354 15:24749351-24749373 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1124937570 15:34186861-34186883 CAGGGAGGACCTGAAGGAAGGGG + Intronic
1125928694 15:43584369-43584391 CAGCGAGCTCCTTGAGGATGAGG - Exonic
1125941860 15:43684204-43684226 CAGCGAGCTCCTTGAGGATGAGG - Intergenic
1126185744 15:45829407-45829429 CAGGGAGGGCCTGAAGGCTGTGG - Intergenic
1128380087 15:67106008-67106030 CAGTGATGTCCTGGATGGTGAGG - Intronic
1129663220 15:77564913-77564935 CAGAGGGGGCCTGGAGGATGAGG + Intergenic
1130183153 15:81651737-81651759 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1130856138 15:87841554-87841576 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1131596767 15:93805945-93805967 CAGTGTGGTCCTGCAGAAAGAGG + Intergenic
1131741958 15:95402565-95402587 CAGTGAGGTCCTGTAGAAAAAGG - Intergenic
1132953470 16:2578204-2578226 CAGGGAGGCCCTGGAGGGTGCGG + Intronic
1132960882 16:2621964-2621986 CAGGGAGGCCCTGGAGGGTGCGG - Intergenic
1135284548 16:21182159-21182181 CCATGAGGTCCTGCATGATGAGG - Intergenic
1136124364 16:28166874-28166896 CAGTGTGGTCAAGGAGGATGGGG - Intronic
1137291530 16:47055209-47055231 CAGAGAGGGCCTGAAGGCTGGGG - Intergenic
1137311905 16:47270883-47270905 CAGTGGTTTCCTGTGGGATGGGG + Intronic
1137401056 16:48154951-48154973 CAGTCAGGCCCTGGAGGAAGGGG - Intronic
1138589602 16:57992527-57992549 AAGTGTGGTGCTTTAGGATGAGG - Intergenic
1139390017 16:66601586-66601608 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1140788181 16:78363799-78363821 CAGTGAGGTCCTGTAGGATGAGG + Intronic
1141294195 16:82751479-82751501 CAATGAGGTGCTGTAGTAGGAGG - Intronic
1141778758 16:86142691-86142713 GAGAGAGGGCCTGTGGGATGGGG + Intergenic
1142086221 16:88183911-88183933 GAGGGAGGTCCTGTAGGGAGTGG + Intergenic
1145775375 17:27524252-27524274 CAGTGAGGTCAAGCAGGATGAGG + Intronic
1146093494 17:29905711-29905733 CAGGGAGGGCCTGTGGGCTGGGG + Intronic
1146143268 17:30388268-30388290 CAGGGAGGTCCTGAAGGCTGGGG - Intronic
1147567567 17:41547165-41547187 CAGTGAGCTCCTTGAGGCTGGGG + Intergenic
1148758315 17:49986181-49986203 TAGTGTGGTCCTGAAGGGTGTGG + Intergenic
1149884663 17:60328091-60328113 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
1151875096 17:76863461-76863483 AGATGAGGTCCTGTAGGATTAGG + Intergenic
1151895147 17:76975011-76975033 CAGGGAGGTCCTGAAGGCTAGGG + Intergenic
1152517927 17:80837032-80837054 CAGTGCGGCCCTGAAGGACGGGG + Intronic
1152577549 17:81149475-81149497 CTGTGAGGGGCTGGAGGATGTGG - Intronic
1152722258 17:81928837-81928859 CAGTGTGGTGTGGTAGGATGAGG - Intergenic
1152806129 17:82357236-82357258 CAGTGGGCGCCTGGAGGATGAGG - Intergenic
1152918366 17:83052960-83052982 CCGTGAGGTCCTCCAGGAGGAGG + Intergenic
1154057027 18:11022569-11022591 CACTGGGGTCCTGTAAGAGGAGG - Intronic
1155949288 18:31891536-31891558 CAGTGACGTAATGTAGTATGTGG - Intronic
1156795891 18:41045654-41045676 CAGTGAGGAATTGTAGCATGAGG - Intergenic
1158240493 18:55371838-55371860 CTGTGAGGTCCTGGAAGCTGGGG + Intronic
1160154988 18:76426830-76426852 CACTGAGGCCCTGGAGGATTGGG - Intronic
1160795395 19:942936-942958 CAGTGAGGTCCTGCAGCGTACGG + Intronic
1161330935 19:3687458-3687480 CGGTGAGGGCCTGTGGGAAGGGG + Intronic
1161824166 19:6551465-6551487 CAGGGAGGGCCTGAAGGCTGAGG - Intergenic
1162531978 19:11241465-11241487 CTGTGAGGGCCCATAGGATGTGG - Exonic
1164203872 19:23041688-23041710 CAGTGAGCTCCTGGGGGATACGG - Intergenic
1164254917 19:23519193-23519215 CACTGAGCTCCTGGGGGATGTGG - Intergenic
1165958009 19:39514227-39514249 CTGTGAGCTCCTCAAGGATGGGG - Intergenic
1165969344 19:39613315-39613337 CAGTGAGGTCCAGGCTGATGAGG + Intergenic
1166897474 19:46032888-46032910 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1167013158 19:46822049-46822071 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1167235075 19:48309275-48309297 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
1167415780 19:49371169-49371191 CAGTGAGTTCAAGGAGGATGAGG + Intronic
1167556881 19:50202360-50202382 CAATGAGGTCCTGCGGGATGTGG - Intronic
1167710550 19:51107974-51107996 CAGTAAGTATCTGTAGGATGAGG + Intronic
1168472299 19:56649591-56649613 GAGTGAGGACCTGAAGGAGGTGG + Intronic
925032717 2:663404-663426 AGGTGACGCCCTGTAGGATGGGG + Intergenic
925191401 2:1887288-1887310 CAGTGACGCTCTGTCGGATGGGG - Intronic
927072901 2:19548460-19548482 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
927266913 2:21162237-21162259 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
929037275 2:37706307-37706329 CAGAGAGGCCCTGGAGGAGGAGG - Intronic
931057005 2:58483500-58483522 CAGTGAGGGCCTGGAGGATAGGG - Intergenic
931500055 2:62855500-62855522 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
931503899 2:62903023-62903045 AAGTGAGCTCTTGTAGTATGCGG + Intronic
932436677 2:71705992-71706014 GATTGAGGTCCTGAAGGAAGAGG + Intergenic
932835603 2:75033275-75033297 AAGTGAGGAGCTGTAGGATCTGG - Intergenic
934762672 2:96865106-96865128 AAGTGAGGTTCTGTGGGAAGGGG + Exonic
934857794 2:97739685-97739707 CAGGGAGGTCCGGGAGGGTGCGG + Exonic
935350794 2:102150321-102150343 CAGGAAGGTGCTGTTGGATGAGG + Intronic
936563846 2:113567197-113567219 CAGCGAAGTCCTGTAGGACAAGG + Intergenic
938194903 2:129318942-129318964 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
940422828 2:153499453-153499475 CAGTGACGGCCTGAAGCATGGGG - Intergenic
940612209 2:156006423-156006445 CAGGGAGGGCCTGAAGGCTGAGG - Intergenic
941043607 2:160649046-160649068 CAGGGAGGTCCTGAAGCCTGGGG + Intergenic
941161421 2:162039403-162039425 CACTGTGGTCCTGGAGGAGGTGG - Intronic
941774263 2:169374781-169374803 GAGTGTTGTCCTCTAGGATGTGG - Intergenic
941919677 2:170837473-170837495 CTCTGAGGTCCTGTAGGGTATGG + Intronic
942103997 2:172614273-172614295 CAGGGAGGTCCTGAAGACTGGGG + Intergenic
942614533 2:177776635-177776657 AAATGAGGTCATGTGGGATGTGG + Intronic
942697774 2:178665099-178665121 CTGTGAGGTTCTGGAGGAGGGGG - Intronic
943023488 2:182601973-182601995 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
943305957 2:186263153-186263175 CTGTAAGATCCTCTAGGATGTGG + Intergenic
948476110 2:238221078-238221100 CAGGGAGGGCCTGAAGGTTGGGG - Intergenic
1168798826 20:630770-630792 CAGTGAGCTCCTGGAGGACAGGG + Intergenic
1169544541 20:6637262-6637284 CACTGAGCTCCTGTGGGATCTGG - Intergenic
1170501011 20:16975084-16975106 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1173856823 20:46255598-46255620 GAGGGAGGACCTGTAGGCTGAGG - Intronic
1175501708 20:59455504-59455526 CACTGAGGTCCTGCAACATGTGG + Intergenic
1175610059 20:60343272-60343294 CAATGAGGTCCTTTGGGAAGAGG - Intergenic
1176899032 21:14417468-14417490 CACTCAGGTCCTGGAGGGTGGGG - Intergenic
1177396100 21:20538151-20538173 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1178244383 21:30936657-30936679 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1178626664 21:34224258-34224280 CTGAGAGGTCCAGTAAGATGAGG + Intergenic
1178948835 21:36969309-36969331 CAGTGAGGGACTACAGGATGAGG - Intronic
1182070673 22:27461581-27461603 CTGTGAGCTCCTGGAGAATGAGG + Intergenic
1184046958 22:41977644-41977666 CGGTGGGGTCCTGAAGGCTGCGG + Intronic
1184560904 22:45262507-45262529 CAGGGAGGCCCTGAAGGCTGGGG - Intergenic
1184567285 22:45299577-45299599 CAGTGTCATCCTGTGGGATGAGG + Intergenic
1184676384 22:46045426-46045448 AGGTGAGGGCCTGTGGGATGAGG + Intergenic
1184854382 22:47138433-47138455 CAGTGATGACCTGCAGGCTGGGG + Intronic
949387315 3:3517493-3517515 CAGTGAGTTCATGTAAGATCTGG + Intergenic
950560578 3:13719255-13719277 CAGTGGGGTCCTGTTGTCTGGGG + Intergenic
951708393 3:25566587-25566609 GGGTGAGGTCCTGTGGGAAGGGG - Intronic
952016123 3:28959116-28959138 CAGGGAGGGCCTGAAGGTTGGGG + Intergenic
952269394 3:31817197-31817219 CAGGGAGGGCCTGAAGGCTGAGG - Intronic
952409526 3:33034624-33034646 CAATGATGTCATGTAGCATGCGG + Intronic
953030179 3:39174855-39174877 CAGAGAGGTCTAGTAGGATGAGG - Intergenic
953060511 3:39424975-39424997 GAGTAAGTTCCTGGAGGATGGGG - Intergenic
954646333 3:52133832-52133854 CAGGGAGCTGCTGTGGGATGAGG - Intronic
955241528 3:57182777-57182799 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
955303809 3:57809615-57809637 CAGTGAGGGCCTAAAGGCTGGGG + Intronic
958192251 3:90197926-90197948 CAGTGAGGTGCTATTTGATGAGG - Intergenic
961463486 3:127067818-127067840 CACTGTGGGCCTGCAGGATGTGG + Intergenic
961492827 3:127267077-127267099 CAGTGAGATCCTCTAGGGAGGGG + Intergenic
961524715 3:127489409-127489431 CAGTGTGTTCCTGTGGGATTGGG - Intergenic
962824553 3:139088575-139088597 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
963025474 3:140914510-140914532 CAGTGATGGCCTGGAGGGTGTGG - Intergenic
965009817 3:163073379-163073401 CAGTGATGGCCTGAAGCATGGGG + Intergenic
965542050 3:169880271-169880293 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
966605846 3:181820874-181820896 TAGTGAGGTCCTATAGCCTGGGG + Intergenic
968538677 4:1151183-1151205 CAGGGAGGTCCTGAAGGCTGGGG - Intergenic
969216934 4:5730570-5730592 CAGTGAGGGCCTCCAGGGTGGGG - Intronic
969365069 4:6689603-6689625 CAGTGAGGGGCTGCAGGGTGAGG - Intergenic
972203906 4:36747947-36747969 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
972358300 4:38303333-38303355 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
972776873 4:42249699-42249721 CTGAGAGGTCTTGTAAGATGAGG + Intergenic
975221196 4:71814550-71814572 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
975597794 4:76066734-76066756 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
978964568 4:114725568-114725590 CAGAGAGGGCCTGAAGGGTGGGG - Intergenic
979742406 4:124167926-124167948 CAGCGAGGTCCTGCACAATGAGG - Intergenic
980007592 4:127559412-127559434 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
981444014 4:144813867-144813889 AAGTGAGATCATGTAGCATGTGG + Intergenic
984102120 4:175499364-175499386 CAGGGAGGGCCTGAAGGGTGGGG - Intergenic
984141476 4:176009329-176009351 CAGCTGGGTCCGGTAGGATGGGG + Intergenic
985388326 4:189468161-189468183 CAGTGAGGGGCTGGAGGATGGGG - Intergenic
985842630 5:2320202-2320224 TCGTGAAGTCCTGTAGGATTTGG - Intergenic
986082591 5:4409896-4409918 CAGTGAGGTCCTGTCAGGTCAGG - Intergenic
987048649 5:14130750-14130772 CAGTAAGGTCATGCAGGGTGAGG - Intergenic
988346369 5:30042271-30042293 CAGGGAGGTACTGAAGCATGGGG + Intergenic
990639141 5:57762176-57762198 CAGGGAGGACCTGAAGGCTGGGG + Intergenic
991206031 5:64051274-64051296 GAGTGGGGTCCTGTTGCATGGGG - Intergenic
992654437 5:78894521-78894543 CAGTGAGATCCTTTAGAATCTGG - Intronic
993973795 5:94452110-94452132 CATTGAGGTCCTTGAAGATGGGG + Intronic
994646973 5:102482496-102482518 TAGTGCTGTCCTATAGGATGGGG - Intronic
994851243 5:105057369-105057391 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
996923863 5:128800115-128800137 CAGAGAGGGCCTGAAGGCTGGGG - Intronic
997256058 5:132429023-132429045 CTGAGAGGTCCTGGAGGCTGCGG + Intronic
998236119 5:140400459-140400481 CAGAGAGTTCCTGAAGGAAGAGG + Intergenic
998792263 5:145778018-145778040 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
999799426 5:155019597-155019619 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
999948981 5:156628159-156628181 CAGTGAGTTCCTGTGAGATCTGG - Intronic
1004404379 6:15318357-15318379 CAGTGAGGTGCAGGGGGATGAGG + Intronic
1005043493 6:21620509-21620531 CAGGGAGGGCCTGAAGGCTGAGG - Intergenic
1005157379 6:22822151-22822173 CAGTGAGGGCCTGTAGGAATTGG - Intergenic
1006347956 6:33498229-33498251 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1008188333 6:48423018-48423040 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1009196706 6:60695375-60695397 CAGGGAGGCCCTGAAGGCTGGGG + Intergenic
1009839151 6:69044376-69044398 TATTGAGGTCCTGGAGGATGAGG - Intronic
1010080512 6:71856139-71856161 CAGAGTGGTCCTTTAGGAAGAGG - Intergenic
1010969806 6:82251286-82251308 CAGTGATGTCCTGTAGAAGATGG - Intergenic
1012169551 6:96001995-96002017 CAGGGAGGGCCTGAAGGTTGGGG - Intergenic
1013375509 6:109510098-109510120 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
1013997598 6:116326235-116326257 CTCTGAGCTCCTCTAGGATGAGG - Intronic
1015455666 6:133424330-133424352 CAGTGAGGGCCTGAAGGCTGGGG - Intronic
1016190789 6:141261545-141261567 CAGGGAGGGCCTGAGGGATGGGG + Intergenic
1016878611 6:148888233-148888255 CAGTGAGTTCCTGTGAGATCTGG - Intronic
1017054480 6:150424903-150424925 CAGGGAGGGCCTGAAGGCTGTGG + Intergenic
1017213144 6:151879261-151879283 CAGATAGGTTATGTAGGATGTGG + Intronic
1017528247 6:155262024-155262046 AAGGGAAGTCCTGTAGGAAGAGG - Intronic
1017890138 6:158631102-158631124 CAGGGACGTCCTGAAGGCTGAGG - Intronic
1018098553 6:160415641-160415663 TAGAGAGGTCGTGAAGGATGAGG - Intronic
1019897942 7:3997765-3997787 CAGTGAGGGCCTGGAGGCTGGGG - Intronic
1020012416 7:4813693-4813715 GAGCGAGCTCCTGAAGGATGAGG - Intronic
1020568042 7:9822516-9822538 CAGGGAGGTCCTAAAGGCTGGGG - Intergenic
1021021138 7:15599956-15599978 CAGTGAGGGCCTGAAGCCTGGGG - Intergenic
1022834761 7:34102918-34102940 CAGGGAGGCCCTCTGGGATGAGG + Intronic
1023047152 7:36220061-36220083 AGGTGAGGTCGTGGAGGATGGGG + Intronic
1024254786 7:47532254-47532276 CAGGGAGGGCCTGTAGGCTGGGG + Intronic
1027333739 7:77126876-77126898 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
1027887956 7:83933617-83933639 CAGTGGGATCTTGTAGGATCTGG + Intergenic
1028116432 7:87002803-87002825 CAGTGAAGTGCTGGGGGATGGGG - Intronic
1029978091 7:104852773-104852795 CAGTGAGCTACTGGAGCATGGGG + Intronic
1030514069 7:110519434-110519456 CAGGGAGGTCCTGAAGGCAGGGG - Intergenic
1030653376 7:112139833-112139855 CAGTGAAGGCCTGTAGTCTGTGG - Intronic
1031690188 7:124778312-124778334 CTCTGAGGCCCTTTAGGATGTGG - Intronic
1032429177 7:131847057-131847079 CAAAGAGGTCCTGCATGATGTGG - Intergenic
1032794260 7:135264871-135264893 TAGAGATGTCCTGTAGGATCTGG + Intergenic
1034183094 7:149153787-149153809 CAGTGAGCTCCAGAAAGATGAGG + Intronic
1034502117 7:151457427-151457449 CAGTGAAGTCCAGGATGATGAGG - Intergenic
1035450976 7:158976541-158976563 CAGCGAGGGCCTGAAGGCTGGGG + Intergenic
1035904674 8:3496400-3496422 CAGTGAGTTCTTGTAGGTTGAGG - Intronic
1037824212 8:22151395-22151417 CATTGAGTTCCTGTAGGTAGAGG - Intronic
1038589419 8:28822919-28822941 CAGGGAGTTACTGGAGGATGTGG + Intronic
1040531739 8:48271663-48271685 CAGTGAGGCCCTGCTGTATGGGG + Intergenic
1040725645 8:50378948-50378970 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
1042396050 8:68292864-68292886 CAGGGAGGGCCTGCAGGCTGCGG + Intergenic
1042667321 8:71221303-71221325 CAGTGAGGTGGGGTGGGATGGGG + Intronic
1042687868 8:71462084-71462106 CAGGGAGGGCCTGAAGGCTGAGG - Intronic
1043486005 8:80699974-80699996 CAGTGAGGTCAGGTGGGGTGTGG + Intronic
1043568125 8:81570894-81570916 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1044259225 8:90098335-90098357 CAGGGAGGGCCTGAAGGCTGAGG - Intergenic
1045558299 8:103236373-103236395 CAGAGAGGTCCAGCAGGATGAGG - Intergenic
1047151630 8:122270705-122270727 GAGTGATTTCCTGTAGGAAGTGG + Intergenic
1047227618 8:122970124-122970146 CTGAGAGGTACTCTAGGATGAGG + Intronic
1047688169 8:127322457-127322479 CAGTGAGGTCCAGGCTGATGAGG + Intergenic
1048461600 8:134625941-134625963 CAGAGAGCAACTGTAGGATGAGG + Intronic
1049888682 9:46924-46946 CAGCGAAGTCCTGTAGGACAAGG - Intergenic
1051522212 9:18001792-18001814 CAGAGAGGGCCAGTAGGATGAGG + Intergenic
1051767028 9:20535775-20535797 CAGTGATGTCATTGAGGATGTGG - Intronic
1052232578 9:26172117-26172139 TAGTGAAGTCCTTTAGGATATGG - Intergenic
1052771894 9:32697668-32697690 CAATGAGGTCCTTGGGGATGTGG - Intergenic
1053128171 9:35599494-35599516 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1053624428 9:39854058-39854080 CTCTGAGGTCATGTAGAATGCGG - Intergenic
1053880440 9:42589169-42589191 CTCTGAGGTCATGTAGAATGCGG + Intergenic
1053892231 9:42705165-42705187 CTCTGAGGTCATGTAGAATGCGG - Intergenic
1054219467 9:62396639-62396661 CTCTGAGGTCATGTAGAATGCGG + Intergenic
1054591645 9:67018055-67018077 CTCTGAGGTCATGTAGAATGCGG + Intergenic
1055086219 9:72316622-72316644 CAGCGGGGTCCGGTAGGATAAGG - Intergenic
1055723480 9:79201443-79201465 CAGTGAGGGCCTGGGGGCTGTGG + Intergenic
1056442918 9:86638328-86638350 GAGAGAGGGCCTGGAGGATGGGG - Intergenic
1056750958 9:89350862-89350884 CAGTGTGGTCCTGTGATATGTGG + Intronic
1057189309 9:93077672-93077694 CAGTGAGGTGCTGGGGGCTGAGG - Intronic
1057320185 9:94005563-94005585 CTGTGAGGTCCTCAAGGACGAGG + Intergenic
1057531181 9:95847743-95847765 CAGGGAGGGCCTGTAGGCTGGGG + Intergenic
1187498097 X:19813799-19813821 CAGTTTGGTACTGTAGGATTCGG - Intronic
1189360183 X:40343935-40343957 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1190444880 X:50514686-50514708 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1190680172 X:52820030-52820052 CAGTGTGGTACTGTAGGACTAGG - Intergenic
1193141704 X:78034629-78034651 TAATGAGGTCTTGCAGGATGAGG - Intronic
1195126499 X:101813838-101813860 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1195454281 X:105051094-105051116 CAGGGAGGGCCTGAAGGCTGAGG - Intronic
1197386781 X:125812307-125812329 CAGTGAAGGCCTCTAGGATTTGG - Intergenic
1197620420 X:128741681-128741703 CAGATAGGCCCTGTATGATGCGG - Intergenic
1199773338 X:150989266-150989288 CAGTGAGGGTATGTGGGATGGGG + Exonic
1200104322 X:153703882-153703904 CACTGAGGCCCTGAAGAATGTGG + Intronic
1202301371 Y:23419297-23419319 TAGTGAGGTCCTCTAGCAAGAGG + Intergenic
1202569440 Y:26251301-26251323 TAGTGAGGTCCTCTAGCAAGAGG - Intergenic