ID: 1140789590

View in Genome Browser
Species Human (GRCh38)
Location 16:78378349-78378371
Sequence GGTCAAACTCCCCATCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140789590 Original CRISPR GGTCAAACTCCCCATCAGAC TGG Intronic
901235146 1:7663707-7663729 GGACAAGCTCCCCATCACAGAGG - Exonic
902827582 1:18987618-18987640 GGTCCATCTTCCCATCAGGCTGG + Intergenic
912803015 1:112733206-112733228 GTACAAACTCCCCTTCAGTCTGG + Intergenic
918116390 1:181501776-181501798 GTTCAAATTCACCATCTGACAGG - Intronic
1065798248 10:29327129-29327151 GGTCAAAGTCCCCATCTGAGAGG + Intergenic
1076314967 10:129533503-129533525 GGTCAAAGCTCCCAGCAGACTGG - Intronic
1082001561 11:47395918-47395940 GGTCAGGCTGCCCAGCAGACAGG + Intergenic
1084712938 11:70855344-70855366 GGGCAAATTGCCCATCAGTCTGG + Intronic
1088286773 11:108198493-108198515 AGACAAACTCCCAAGCAGACGGG + Intronic
1094496087 12:30990266-30990288 GGCCACACTCCCCAGCAGACAGG - Intronic
1098888035 12:75980124-75980146 GGTCAAATTCCCCATTATCCAGG - Intergenic
1099092910 12:78336504-78336526 TTGCAAACTACCCATCAGACAGG + Intergenic
1102881330 12:116487278-116487300 ACTCTAACTCCCCATCAGCCTGG - Intergenic
1107964805 13:45588885-45588907 GGTCCAACTCCCCAGCATCCAGG - Intronic
1108181117 13:47840979-47841001 GGTTACCCTCCCCAGCAGACCGG - Intergenic
1108970674 13:56371999-56372021 TGTCATACTCTCAATCAGACAGG - Intergenic
1113782240 13:112983335-112983357 GGGCACACTCCCCAGCAGATGGG - Intronic
1115496267 14:34007618-34007640 GTTCAAACTCCCCAAGAGAGAGG - Intronic
1135868783 16:26129597-26129619 TCTCAAACTCCCCATGAGAAGGG + Intronic
1137384838 16:48031777-48031799 CCTCATACTCCCCATCAGCCTGG + Intergenic
1139224574 16:65221942-65221964 GGTCATTCTCCCCTCCAGACTGG - Intergenic
1140789590 16:78378349-78378371 GGTCAAACTCCCCATCAGACTGG + Intronic
1144632202 17:16879985-16880007 GGACAAAATGGCCATCAGACAGG - Intergenic
1147460145 17:40563156-40563178 TGTCACTCTCCCCACCAGACTGG + Intronic
1148519954 17:48263825-48263847 GGTCCGACTGTCCATCAGACTGG - Intronic
1150356676 17:64492385-64492407 GGTCAAACTCTACATCAGCCAGG + Intronic
1156396391 18:36703816-36703838 GGTCACATTCTCCATCTGACGGG + Intronic
1158156892 18:54435928-54435950 GGTCAAACTCACCAGAAGAGGGG - Intergenic
1159687251 18:71438024-71438046 GGTCATACGCTTCATCAGACAGG + Intergenic
1162423492 19:10579742-10579764 GCTCAAAGTCACCATCAGGCGGG + Exonic
924964548 2:63358-63380 GGTAGAAATCACCATCAGACAGG + Intergenic
927211383 2:20641066-20641088 TGTCAGACTCCCCAACAAACAGG + Exonic
931453940 2:62392214-62392236 TTGCAAACTACCCATCAGACAGG - Intergenic
931765054 2:65447712-65447734 CTGCAAACTACCCATCAGACAGG - Intergenic
932676260 2:73784113-73784135 GGTCAGATTCCCCACAAGACAGG - Intergenic
932676846 2:73789014-73789036 GGTCAGATTCCCCACAAGACAGG - Intronic
932677431 2:73793911-73793933 GGTCAGATTCCCCACAAGACAGG - Intronic
932678017 2:73798809-73798831 GGTCAGATTCCCCACAAGACAGG - Intronic
932678603 2:73803709-73803731 GGTCAGATTCCCCACAAGACAGG - Intronic
932679183 2:73808608-73808630 GGTCAGATTCCCCACAAGACAGG - Intronic
936969956 2:118167884-118167906 GGTCATACTCCCCAAGAGCCAGG - Intergenic
1170502386 20:16988128-16988150 GGTCAAACCCCACATCAAAAGGG - Intergenic
1173212487 20:41046454-41046476 GGTGGAATTACCCATCAGACTGG + Intronic
956600454 3:71015450-71015472 GGTGAAACTCTCCATCAAAAAGG + Intronic
961040884 3:123677280-123677302 GGAGAAACTCCCCATCTGACTGG + Intronic
961812041 3:129527628-129527650 GGCCAGCCTCCCCTTCAGACTGG + Intergenic
965258168 3:166444000-166444022 GGTGAAACCCACCTTCAGACTGG + Intergenic
966854009 3:184181786-184181808 GCTCAAACTCTCCATCTGGCGGG - Exonic
968588362 4:1445161-1445183 AGTCAATCTCAGCATCAGACAGG - Intergenic
969870020 4:10098801-10098823 GGTAGAACTCCACATCACACTGG - Intronic
969941283 4:10734456-10734478 GGACAAACTTCTCAACAGACTGG - Intergenic
982465333 4:155723204-155723226 AGTCAAATTCCCTATCATACAGG + Intronic
985937111 5:3106029-3106051 GGTCTAACTCCCCATGAGCGAGG + Intergenic
990841628 5:60086710-60086732 GTTCAATCTCCCCATCAGTCTGG + Intronic
1000771420 5:165359447-165359469 TTTCAAACTCCCCAGCAGATGGG - Intergenic
1010481555 6:76360702-76360724 GGTCAGAGTTCCCATTAGACTGG - Intergenic
1012515377 6:100053195-100053217 TGTCAAGCTCCCCAGGAGACAGG - Intergenic
1018870191 6:167776837-167776859 GCTCAGTCTCCACATCAGACCGG + Intergenic
1025712894 7:63927957-63927979 GGTGAGACTCCCCCTCACACTGG + Intergenic
1034827747 7:154282043-154282065 GGTCAATCTCCCCATTGGACAGG - Intronic
1037385331 8:18333899-18333921 GGTAAAGCTTCCCATCAAACAGG + Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048593297 8:135841546-135841568 GGTCAAACTCAACATCAGTGGGG + Intergenic
1051007501 9:12364803-12364825 GTTCAAACTTTCCATTAGACTGG - Intergenic
1053426492 9:38013719-38013741 GGGCAAACCCTCCATGAGACTGG + Intronic
1056982361 9:91327233-91327255 AGACAAATTCCCCAGCAGACAGG + Intronic
1062098152 9:134713154-134713176 GGTAAAACTCACTATCGGACAGG - Intronic
1186260481 X:7773616-7773638 GGTGTAACTCCCCAGCAGACAGG + Intergenic
1186277430 X:7955168-7955190 AGTCAGACTCCACCTCAGACAGG - Intergenic
1187961016 X:24566147-24566169 TGCCAAATTCCCCATCAGAAAGG - Intronic
1198570648 X:137952162-137952184 TTGCAAACTACCCATCAGACAGG - Intergenic
1198655616 X:138910385-138910407 GGTCAAATTCCCAAGCAGATAGG + Intronic
1198707955 X:139469770-139469792 GGTCCAACTTCCCATAAGAGGGG - Intergenic