ID: 1140794559

View in Genome Browser
Species Human (GRCh38)
Location 16:78425008-78425030
Sequence TGACACGGGCAGGAGCTGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140794559_1140794566 7 Left 1140794559 16:78425008-78425030 CCGCTCAGCTCCTGCCCGTGTCA 0: 1
1: 0
2: 2
3: 14
4: 283
Right 1140794566 16:78425038-78425060 CTCCTCAGAGTCCCATCGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1140794559_1140794565 6 Left 1140794559 16:78425008-78425030 CCGCTCAGCTCCTGCCCGTGTCA 0: 1
1: 0
2: 2
3: 14
4: 283
Right 1140794565 16:78425037-78425059 TCTCCTCAGAGTCCCATCGGTGG 0: 1
1: 0
2: 1
3: 12
4: 96
1140794559_1140794564 3 Left 1140794559 16:78425008-78425030 CCGCTCAGCTCCTGCCCGTGTCA 0: 1
1: 0
2: 2
3: 14
4: 283
Right 1140794564 16:78425034-78425056 TGGTCTCCTCAGAGTCCCATCGG 0: 1
1: 0
2: 0
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140794559 Original CRISPR TGACACGGGCAGGAGCTGAG CGG (reversed) Exonic
900504052 1:3020436-3020458 GGCCACCAGCAGGAGCTGAGGGG + Intergenic
900527017 1:3134374-3134396 TGGCACGGGCATGGGCTGGGCGG + Intronic
900967016 1:5965871-5965893 TGGCACTGGCAGGACCCGAGGGG - Intronic
901236763 1:7671423-7671445 AGGCACGGGCAGGTGCAGAGAGG - Intronic
901441648 1:9281816-9281838 TGACATTCCCAGGAGCTGAGAGG + Intergenic
901643649 1:10705419-10705441 TGACACGTGCATTAGGTGAGTGG + Intronic
902629158 1:17694643-17694665 CCACACGGGCAGGCCCTGAGGGG + Intronic
903344159 1:22673672-22673694 TAGCCCGGCCAGGAGCTGAGCGG - Intergenic
903500893 1:23799739-23799761 TGGCATGGGCAGAGGCTGAGCGG - Intronic
903645862 1:24896223-24896245 TGACAGAGGGAGGAGCTAAGAGG - Intergenic
905206264 1:36344384-36344406 GAGCACGGGCAGGAGCTCAGAGG - Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
909291468 1:73888899-73888921 TGACAAGGGAAGCAGCTGGGTGG - Intergenic
913181040 1:116321757-116321779 TGAAGCTGGCAGGAGCTGACAGG - Intergenic
913608823 1:120491374-120491396 ATACAGGGGCAGGAGCTGACGGG + Intergenic
914205005 1:145519077-145519099 ATACAGGGGCAGGAGCTGATGGG - Intergenic
914370566 1:147021151-147021173 ATACAGGGGCAGGAGCTGACAGG + Intergenic
914484124 1:148092259-148092281 ATACAGGGGCAGGAGCTGATGGG - Intergenic
914582373 1:149030464-149030486 ATACAGGGGCAGGAGCTGACGGG - Intronic
915465858 1:156097561-156097583 TGCCATGGGCAGGACATGAGTGG + Intronic
915586220 1:156845342-156845364 GGACTAGGGCAGGTGCTGAGGGG - Intronic
915725210 1:158012351-158012373 TCACACGGGTAGGAGGTGACAGG - Intronic
917315309 1:173718679-173718701 TTACACGGGCAGGAGTGCAGTGG - Intronic
917738249 1:177939530-177939552 TGAGGCTGGCAGGAGCTGGGTGG + Intronic
917922316 1:179760698-179760720 TGGCAAAGGCAGGAGCAGAGGGG + Intronic
918149127 1:181782988-181783010 TGGCCCAGGCAGGAGCAGAGTGG - Intronic
920527071 1:206675041-206675063 TGACGCAGGCAGGAGCTCTGTGG + Intronic
922665286 1:227463995-227464017 GGACAGGGGCAGGAGGTCAGTGG + Intergenic
923131361 1:231077408-231077430 TGAGATGGGCAGGAGAGGAGTGG + Intergenic
923311175 1:232737046-232737068 AGGCACTGGCAGGAGCTGGGAGG + Intergenic
924564883 1:245189032-245189054 TGTCAGGGGCTGGAGTTGAGGGG + Intronic
924769184 1:247064060-247064082 TAACACGGGGAGGGGCTGATTGG - Intronic
1063178173 10:3570863-3570885 GGACAGGGGCAGGGGCTGAGGGG + Intergenic
1063333644 10:5187722-5187744 TCACATGGAGAGGAGCTGAGTGG + Intergenic
1067009383 10:42695559-42695581 TGACATTGGCAGTAGCTGGGGGG + Intergenic
1067090875 10:43265398-43265420 TGAGAAGGGCATGAGCTGTGTGG - Intronic
1069552757 10:69375930-69375952 TGACCGGGGCTGGAGCTGTGCGG + Intronic
1069632430 10:69905037-69905059 TGACTGAGGCAGGAGCAGAGAGG + Intronic
1069925007 10:71843298-71843320 AGAGAGGGGGAGGAGCTGAGAGG + Intronic
1070264944 10:74893080-74893102 CCACAGAGGCAGGAGCTGAGAGG + Intronic
1070782152 10:79143875-79143897 TGACATGGCCAGGACGTGAGAGG + Intronic
1071506317 10:86233903-86233925 AGACACAGGCAGGAAATGAGAGG + Intronic
1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG + Intronic
1073329650 10:102661761-102661783 TGACAATGACAGGATCTGAGTGG - Intergenic
1074418098 10:113284893-113284915 GGAAACAGGCAGGGGCTGAGGGG + Intergenic
1076838559 10:133033354-133033376 TCAGACATGCAGGAGCTGAGTGG - Intergenic
1077063024 11:626028-626050 GCCCCCGGGCAGGAGCTGAGAGG + Exonic
1077883973 11:6372202-6372224 TGACAGTGGCTGGAGCAGAGTGG - Intergenic
1078171973 11:8934981-8935003 TGACTCAGGCAGGAGATGACGGG + Intergenic
1078855908 11:15206356-15206378 TAACAAGGGCAGGGGCAGAGGGG + Intronic
1082261169 11:50077125-50077147 GGAGCTGGGCAGGAGCTGAGTGG + Intergenic
1083460528 11:62808105-62808127 TGACACGGACAGGAAATCAGGGG + Intronic
1083741082 11:64712162-64712184 TGAAACGGTGAGGGGCTGAGTGG - Intronic
1083959523 11:66006913-66006935 TGAGTCGGGCTGGATCTGAGAGG - Intergenic
1086282015 11:85200792-85200814 AGACTGGGGCTGGAGCTGAGAGG - Intronic
1086498945 11:87432590-87432612 TGAGGTGAGCAGGAGCTGAGTGG - Intergenic
1087652784 11:100887822-100887844 TGATAGGGGCAGGAGCAGAAAGG + Intronic
1087932398 11:103993105-103993127 TGACACAGGCAGGAGTGCAGTGG + Intronic
1088027287 11:105200820-105200842 TCACACTGGGAGGAGCTGACAGG - Intergenic
1088901244 11:114119223-114119245 TCACCCGGGCTGGAGCGGAGTGG - Intronic
1088906897 11:114161982-114162004 TGACAAGGGCAAGAGAGGAGTGG - Intronic
1089601463 11:119617918-119617940 TGAGGCGGGCAGGAGATCAGCGG - Intergenic
1089615643 11:119693236-119693258 TCACAGGTGGAGGAGCTGAGGGG - Intronic
1090034145 11:123233669-123233691 TGGCAAGGGCAAGAGCAGAGTGG - Intergenic
1092114150 12:5986641-5986663 TGTCAAGGGCAGGACCAGAGGGG - Intronic
1096807665 12:54150345-54150367 TGCCAGGGGCAGGGGCAGAGAGG + Intergenic
1096836408 12:54354007-54354029 TGTGAAGGGGAGGAGCTGAGGGG - Intergenic
1098212304 12:68179397-68179419 GGACAAGGGCAGAAACTGAGAGG + Intergenic
1100214734 12:92435722-92435744 TGGCACGGGCAAGAGCAGAGTGG - Intergenic
1102524981 12:113506024-113506046 TGACCCAGGCAGGAGATGAAGGG - Intergenic
1104058630 12:125249394-125249416 TCACAAGGGCAGGAGCTGTTAGG + Intronic
1104398257 12:128453939-128453961 TGACACGTGAAGGAGATGTGTGG + Intronic
1105706319 13:22969629-22969651 TGACCAGGACAGGAGCTCAGAGG + Intergenic
1105858969 13:24393087-24393109 TGACCAGGACAGGAGCTCAGAGG + Intergenic
1111731769 13:92085842-92085864 TGACAGGAGGAGGAGCTCAGGGG + Intronic
1112436447 13:99394300-99394322 TGACAAGGGCAGGGGCATAGTGG - Intergenic
1113419709 13:110161236-110161258 TGACATGGGCATGGGCTCAGGGG + Exonic
1113956534 13:114102496-114102518 TGGGACGGGCAGGAGGTGCGAGG + Intronic
1114479641 14:23024704-23024726 TGAAATAGGCAGGAGCTGGGCGG - Intronic
1114493012 14:23114868-23114890 TGAGACTGGCAGGAGGAGAGTGG - Intergenic
1114732162 14:25004559-25004581 TGACTTTGTCAGGAGCTGAGAGG - Intronic
1114791719 14:25667056-25667078 TGACACATGCAGCAGCTGATTGG + Intergenic
1115877407 14:37876122-37876144 TGAGAGGAGCAGGAGCTGAGTGG + Intronic
1116632157 14:47349912-47349934 AGGCACTGGCAGGAGATGAGAGG + Intronic
1119230870 14:72978832-72978854 TGACACAGGGAGGAGCTCGGAGG + Intronic
1119262688 14:73246936-73246958 TGCCACGGGCATGTGCTGGGGGG - Intronic
1121779555 14:96613636-96613658 TGGCATGTGCAGGATCTGAGAGG + Intergenic
1121937041 14:98029544-98029566 TGACACAGGAAGGACTTGAGAGG + Intergenic
1122204849 14:100143254-100143276 TGACCCCTGCAGGAGCTGGGAGG + Intronic
1123670264 15:22649614-22649636 TGACAGGAGGAGGAGCTCAGGGG + Intergenic
1124526238 15:30456032-30456054 TGACAGGAGGAGGAGCTCAGGGG + Intergenic
1124772415 15:32551652-32551674 TGACAGGAGGAGGAGCTCAGGGG - Intergenic
1125117216 15:36108744-36108766 TGAGACTGGCTGGAGCAGAGCGG - Intergenic
1127796628 15:62443946-62443968 TCACCCAGGCAGGAGCAGAGTGG - Intronic
1129190311 15:73933720-73933742 TGACATGGGCAGGAGAGGAAAGG + Intronic
1130014285 15:80175109-80175131 TGACATGGCCAGGAGCTCTGAGG + Intronic
1130195770 15:81779084-81779106 TGGCACAAGCAGGAGGTGAGTGG - Intergenic
1130483911 15:84387095-84387117 TGGCAAGGGCAGGGACTGAGCGG - Intergenic
1132611008 16:816329-816351 TGGCACTGGGAGGAGGTGAGGGG + Intergenic
1133140848 16:3742927-3742949 TGAAAGGGGCAGGAGGTGACTGG - Intronic
1133148159 16:3806165-3806187 TGACACTGGTAGCACCTGAGCGG - Intronic
1133732610 16:8589887-8589909 GGACGGGGGCAGGAGCAGAGGGG - Intergenic
1134431705 16:14214867-14214889 TTCCAGGGGCAGGAGGTGAGAGG + Intronic
1134586204 16:15413578-15413600 TGGCACGGGCAGGGGGTGAGAGG - Intronic
1135324427 16:21517299-21517321 TCACCCAGGCAGGAGCTTAGTGG + Intergenic
1136262740 16:29092013-29092035 TCACACAGGCTGGAGCAGAGTGG - Intergenic
1136335911 16:29610565-29610587 TCACCCAGGCAGGAGCTTAGTGG + Intergenic
1138870308 16:60875947-60875969 TTACCCAGGCAGGAGCTCAGTGG + Intergenic
1139691586 16:68645308-68645330 TCAAAGGGGCAAGAGCTGAGCGG + Exonic
1140794559 16:78425008-78425030 TGACACGGGCAGGAGCTGAGCGG - Exonic
1141070288 16:80948428-80948450 TGACACAGACAAGAGCAGAGAGG - Intergenic
1141335345 16:83149455-83149477 TCATATGGGCAGGAACTGAGAGG + Intronic
1141507657 16:84489361-84489383 AGCCACAGACAGGAGCTGAGAGG - Exonic
1141551755 16:84810911-84810933 TGAAAGGGGCAGGAACTCAGGGG + Intergenic
1141576403 16:84966711-84966733 TCACAGGGGAAGGCGCTGAGTGG - Intergenic
1142036629 16:87866363-87866385 TCACCCAGGCAGGAGCTCAGTGG + Intronic
1142481870 17:224037-224059 TGAAACTGGCAGGACATGAGGGG - Intronic
1143383107 17:6508571-6508593 TGCCACAGTCAGGGGCTGAGGGG + Intronic
1143460696 17:7101690-7101712 TGGCACGGGCACGAGCTGGGTGG - Exonic
1144634542 17:16896792-16896814 TGGCATGGGCAGAAGCTCAGGGG - Intergenic
1145168622 17:20636223-20636245 TGGCATGGGCAGAAGCTCAGGGG - Intergenic
1145397499 17:22506931-22506953 TGACAGGGCCATGAGATGAGGGG + Intergenic
1146164538 17:30577628-30577650 TGGCATGGGCAGAAGCTCAGGGG - Intergenic
1146612747 17:34322118-34322140 TGTCACAGGCAGGAAGTGAGAGG + Intergenic
1147368391 17:39974519-39974541 TGACGGGGGCAGGAGGTGGGTGG + Intronic
1147716472 17:42512139-42512161 TGATACGGGCGTGTGCTGAGTGG + Intronic
1148156312 17:45427005-45427027 TGACTTGGGGAGGAGCAGAGTGG - Intronic
1148167799 17:45495750-45495772 TGAGACGTGCAGGAGATGTGGGG - Intergenic
1148443773 17:47725673-47725695 TGACACGCGGTGGAGCTGACGGG - Intergenic
1149177899 17:53896448-53896470 AGAGACAGGCAGGAGATGAGAGG + Intergenic
1150398978 17:64842167-64842189 TGAGACGTGCAGGAGATGTGGGG - Intergenic
1152482013 17:80560607-80560629 GGGGACGTGCAGGAGCTGAGAGG + Intronic
1153434922 18:5058943-5058965 AGACACCGTCAGGAGATGAGAGG + Intergenic
1154018323 18:10639515-10639537 TCAAATGGGCAGTAGCTGAGAGG - Intergenic
1154186549 18:12190075-12190097 TCAAATGGGCAGTAGCTGAGAGG + Intergenic
1154355115 18:13619144-13619166 TGACACGGGAGGCAGCTAAGTGG - Intronic
1154954684 18:21242416-21242438 GGGCGCGGGCAGGAGGTGAGAGG + Intronic
1157583707 18:48787972-48787994 TGACATGGGCAGGATCTCAGCGG + Intronic
1157757332 18:50230421-50230443 TGACACAGGGAGGTGCTGAAAGG + Intronic
1161454957 19:4365496-4365518 CGCCACGGGAAGGAGCTGGGCGG - Exonic
1161499754 19:4607332-4607354 CGGCGCGGGCTGGAGCTGAGGGG + Intergenic
1162043321 19:7983469-7983491 TGGCAAGGGCAGGACCAGAGGGG + Intronic
1162191200 19:8948380-8948402 TGACAGGGACAGGAGAGGAGTGG + Exonic
1162464482 19:10831749-10831771 AGGCATGGGCGGGAGCTGAGAGG - Exonic
1162484804 19:10953071-10953093 TCACCCAGGCAGGAGCGGAGTGG + Intergenic
1163849132 19:19653721-19653743 TGACTCAGGGAGGAGCTGACGGG + Intronic
1164650172 19:29885734-29885756 TGACAGGCTCAGGAGCTGGGAGG - Intergenic
1166368416 19:42288891-42288913 TGCAACGGACAGGAGCTCAGAGG - Exonic
1167040039 19:47018758-47018780 TGACCCGGGCTGGAGCGCAGTGG + Intergenic
1167416549 19:49376214-49376236 TGACATGGGAAGGACCTGAGTGG - Intergenic
1167551509 19:50164038-50164060 TGTCACAGGCTGGAGCTCAGTGG + Intergenic
1168595731 19:57674992-57675014 TCACCCAGGCAGGAGCTCAGTGG + Intronic
925365293 2:3307311-3307333 AGACACTGGCAGGAGCTGCTGGG - Intronic
925481801 2:4283779-4283801 TGCCAGGGGCAGGAACTGATGGG - Intergenic
926111825 2:10188621-10188643 TGACCCCCTCAGGAGCTGAGAGG - Intronic
926704300 2:15825966-15825988 TGTTACAGGCAGGAGCTGCGAGG + Intergenic
926776947 2:16432272-16432294 TGACACAGGCAGGAGAAGAAAGG - Intergenic
927726114 2:25424641-25424663 TGACACAGGGAAGAGGTGAGTGG + Intronic
928308640 2:30191893-30191915 TGACAGGGGCTGGGGCGGAGAGG + Intergenic
929484059 2:42339267-42339289 TGGCACCACCAGGAGCTGAGGGG + Intronic
929731207 2:44494818-44494840 CAACAAGGGCAGGAGGTGAGAGG - Intronic
931904416 2:66826886-66826908 AGACAGGGGCAGGAGGTCAGAGG - Intergenic
932114389 2:69033150-69033172 TGACACAGACAGGAGCAGAGCGG + Intronic
936404075 2:112187120-112187142 TCACACTGGCTGGAGCGGAGAGG - Exonic
936704316 2:115053451-115053473 TGCAAGTGGCAGGAGCTGAGAGG + Intronic
937452165 2:122010672-122010694 TGATCCAGGCAGGAGCAGAGAGG - Intergenic
937697978 2:124829111-124829133 TGACTCGGGCAAGAGATGTGGGG + Intronic
938109949 2:128557202-128557224 TGGGAGGGGCAGGAGCTGTGTGG + Intergenic
938118820 2:128619902-128619924 TGACACAGCCAGGATTTGAGTGG + Intergenic
939272833 2:139961736-139961758 TGACCCAGGCCAGAGCTGAGTGG - Intergenic
944279696 2:197881556-197881578 TCACATGGGCAGTAGCAGAGGGG - Intronic
945452124 2:210005687-210005709 TGACATGCGCTGGAGCTGACAGG + Intronic
946178039 2:217933788-217933810 GCACACGGGCAGAAGCTGGGTGG + Intronic
947544877 2:231003470-231003492 AGGCAAGGGAAGGAGCTGAGAGG + Intronic
948857513 2:240736914-240736936 TGGCACCTGCAGGAGCTGTGCGG - Intronic
1168893328 20:1308093-1308115 AGACACAGACAGGAGCAGAGGGG - Exonic
1169039486 20:2481192-2481214 TGACATGGGGAGTAGCTAAGAGG + Intronic
1170843786 20:19945328-19945350 TCACATGGGCAGGAGGTGGGTGG + Intronic
1171543391 20:25983724-25983746 TGTCACGGGCATGAGGGGAGGGG - Intergenic
1172058451 20:32171598-32171620 TGACACAGGCTGGAGCACAGTGG + Intergenic
1173251112 20:41364706-41364728 TGACAGAGGCAGAAGGTGAGGGG - Intronic
1173694511 20:44997290-44997312 TCATACCTGCAGGAGCTGAGTGG - Exonic
1173950824 20:46992032-46992054 TGCCACCAGTAGGAGCTGAGAGG + Intronic
1174351422 20:49970993-49971015 GGACTCGGGCAGGTGCAGAGAGG + Intergenic
1174394212 20:50236411-50236433 TGTCACAGTGAGGAGCTGAGAGG - Intergenic
1175140617 20:56858246-56858268 TGACAGAGGCAGAAGCTGGGTGG - Intergenic
1175231422 20:57475841-57475863 GGCCACGGGGAGGAGCTGAATGG + Intergenic
1176227342 20:64008534-64008556 TGCCAAAGGCAGGAGCTGAAAGG - Intronic
1176753147 21:10706455-10706477 TGGCATGGGGAGGAGCGGAGTGG - Intergenic
1176977057 21:15334529-15334551 TGGCAAGGGCAGTAGCAGAGAGG + Intergenic
1179600898 21:42476633-42476655 TGGCACTGACAGCAGCTGAGGGG - Intronic
1180305093 22:11067286-11067308 TTACACTGCCAGGAGCAGAGGGG + Intergenic
1180857500 22:19057747-19057769 TGGCTTAGGCAGGAGCTGAGTGG - Intronic
1181394973 22:22614806-22614828 AGGCATGGGCAGGATCTGAGGGG - Intergenic
1181712813 22:24701492-24701514 TGAAATGGACAGTAGCTGAGAGG - Intergenic
1181811622 22:25406672-25406694 GGCCACGAGCTGGAGCTGAGGGG + Intergenic
1182076179 22:27496948-27496970 AGACATGGGTAGGAACTGAGGGG - Intergenic
1182311652 22:29412874-29412896 TCACAGCGGCAGGAGCAGAGAGG - Intronic
1182739564 22:32557746-32557768 TGTCACGGGCAAGGGCAGAGTGG - Intronic
1183159940 22:36106115-36106137 TGGCATGGGAAAGAGCTGAGGGG - Intergenic
1183647485 22:39134861-39134883 TGGCATGGGAAGGAGTTGAGTGG - Intronic
1184684423 22:46089729-46089751 AGGCAGGGGCAGAAGCTGAGTGG - Intronic
1184784125 22:46663578-46663600 GGACACAGGCAGGAGATGAGGGG + Intronic
950306297 3:11917369-11917391 TGACAGTGGCAGGACCAGAGGGG + Intergenic
950647554 3:14386374-14386396 TGTCAAGAGCAGAAGCTGAGAGG + Intergenic
953705040 3:45225101-45225123 GGACACAGGGAGGAGCGGAGCGG + Exonic
954449140 3:50562358-50562380 AGCCACAGGCAGGTGCTGAGTGG - Intronic
954583803 3:51717916-51717938 TGACACTGGCAGGAGAGGACAGG + Intronic
956567526 3:70655879-70655901 TGCCACGTGCAGGGGCAGAGAGG - Intergenic
957301068 3:78391674-78391696 TGACATGGGTAGGATTTGAGAGG - Intergenic
960993477 3:123326361-123326383 TGACAAGGGAGGGAGTTGAGGGG - Intronic
961180889 3:124876609-124876631 AGAAACAGGCAGAAGCTGAGAGG + Intronic
961653898 3:128431005-128431027 AGCCACTGGCAGGGGCTGAGTGG - Intergenic
962733654 3:138305051-138305073 TGACCAGGGCAGGAGCTGCTAGG + Intronic
963927399 3:150965683-150965705 TGACAGGGGCAGGTTCTAAGTGG - Intronic
966815513 3:183886769-183886791 ATACAGAGGCAGGAGCTGAGGGG + Intergenic
966866194 3:184260306-184260328 GGCCACGGGCAGTAGCTGCGCGG - Intronic
968500599 4:948108-948130 GGTCACAGGCAGGATCTGAGGGG - Exonic
968814456 4:2814803-2814825 TAACATGGGCAGGAGCTGTGAGG - Intronic
968953317 4:3705896-3705918 TGAAACAGGAAGGGGCTGAGAGG - Intergenic
970689634 4:18607665-18607687 AGACAGGGGCATGAGCTTAGGGG - Intergenic
971373185 4:26034671-26034693 AGGCACTGGCAGGAGATGAGGGG - Intergenic
972158986 4:36199136-36199158 TGACACTGGCTGCAGCAGAGAGG - Intronic
973291714 4:48477555-48477577 AGCCACAGGGAGGAGCTGAGGGG - Intergenic
973881697 4:55279302-55279324 TCACATGGTGAGGAGCTGAGTGG - Intergenic
974235029 4:59169844-59169866 TTACACAGGCTGGAGCTCAGAGG + Intergenic
978245430 4:106566226-106566248 TGACTAGGGCAGGATTTGAGAGG + Intergenic
980625595 4:135371404-135371426 TGACACAGACAGGAGCAGAGGGG - Intergenic
980977495 4:139625072-139625094 TGAAACCAGCAGCAGCTGAGAGG - Intergenic
981550792 4:145938480-145938502 AGACACTGGCAGGAGCGGGGAGG + Intronic
982090741 4:151878042-151878064 TCACCCAGGCTGGAGCTGAGTGG + Intergenic
984096147 4:175437317-175437339 TGGCACGAGGAGGAGGTGAGGGG - Intergenic
984769265 4:183423224-183423246 TGACAGGGGCAGGAGGTGAGAGG + Intergenic
986265100 5:6184191-6184213 TGACAGGGGAAGCAGATGAGAGG - Intergenic
988083793 5:26446826-26446848 TGTCAGGGGCAGGACCTGATGGG - Intergenic
995061111 5:107812776-107812798 TGACAGAGTCAGGAGGTGAGAGG - Intergenic
997369418 5:133348567-133348589 GGCCAGGTGCAGGAGCTGAGGGG + Intronic
998487810 5:142518078-142518100 TGAGAAGGGCATGAGCTAAGAGG + Intergenic
1001496053 5:172188305-172188327 TGGGCCGGGCAGGAGCTGCGAGG - Exonic
1002052232 5:176577573-176577595 TGCCAGGGGCAGAAGCCGAGGGG + Intronic
1002723976 5:181282644-181282666 TTACACTGCCAGGAGCAGAGGGG + Intergenic
1002935684 6:1670151-1670173 TGCCACAGGGAGGAGTTGAGGGG - Intronic
1003095969 6:3143917-3143939 AGGCAAAGGCAGGAGCTGAGGGG - Intronic
1003652700 6:7975991-7976013 TGACCCACGCAGGTGCTGAGAGG - Intronic
1005139158 6:22607643-22607665 TGACACTGGCTGGAGGGGAGTGG - Intergenic
1006135921 6:31896723-31896745 TGACAGAGGCTGGAGATGAGGGG + Exonic
1007072889 6:39049384-39049406 AGACCCTGGGAGGAGCTGAGAGG + Intronic
1008055562 6:46942167-46942189 TGACAGGGGGAGGAGGTGATGGG - Intronic
1008146332 6:47895966-47895988 TGACACTGCTAGGTGCTGAGGGG - Intronic
1010617942 6:78036071-78036093 TGACAGTGCAAGGAGCTGAGAGG - Intergenic
1013419293 6:109951435-109951457 TAACATGGGCAGAAGCTCAGAGG + Intergenic
1014898201 6:126929641-126929663 GGTCAAGGCCAGGAGCTGAGAGG - Intergenic
1018686045 6:166305891-166305913 GCACACGGTCTGGAGCTGAGAGG - Exonic
1018930839 6:168239404-168239426 TCACCGGGGCAGGGGCTGAGGGG + Intergenic
1023779989 7:43646641-43646663 GGACAGGGGCAGGACATGAGAGG - Intronic
1024410404 7:49034212-49034234 TGACCCGCACAGGAGGTGAGTGG - Intergenic
1025034969 7:55588292-55588314 TGCCACGTGCAGGCGCTGTGCGG + Intergenic
1025227808 7:57179533-57179555 TTACCCAGGCTGGAGCTGAGTGG - Intergenic
1029180007 7:98693560-98693582 AGACACAGCCAGGAGCTGTGTGG - Intergenic
1029382039 7:100220851-100220873 TGACAGGGGCAGGGGCAGGGGGG + Intronic
1029388618 7:100259835-100259857 TCAGACGGGCAGGACCTGGGTGG + Intronic
1030063889 7:105644285-105644307 TAAAAGGGGCAGGGGCTGAGAGG - Intronic
1032518542 7:132525073-132525095 TGTCAGGGGCAGGGGGTGAGGGG - Intronic
1032565869 7:132942199-132942221 TCACACGGGCAGGAGGAAAGGGG + Intronic
1033913017 7:146287375-146287397 TGACTTAGGCAGGTGCTGAGAGG + Intronic
1034338947 7:150340403-150340425 TGGCCCGGGCAGGAGCGGGGAGG - Intronic
1037245625 8:16831323-16831345 CGACAAAGGCAGGATCTGAGAGG - Intergenic
1037469516 8:19193808-19193830 GGACAGGGGAAGGAGATGAGGGG - Intergenic
1041206298 8:55501461-55501483 TGCCAGGGGCTGGAGGTGAGGGG - Intronic
1044790616 8:95843167-95843189 TGACAAGGGAAGGAGAGGAGAGG - Intergenic
1049194758 8:141308833-141308855 CGCCACGGGCAGGGGCGGAGGGG - Intergenic
1049271671 8:141699385-141699407 CAACTCAGGCAGGAGCTGAGAGG - Intergenic
1049350306 8:142160782-142160804 GGCAACGGGCAGGAGCTGGGAGG - Intergenic
1049574299 8:143383363-143383385 TGACACGCCCAGGAGCTGGAGGG - Exonic
1049682499 8:143925927-143925949 GAACACGGGCAGGCGCTGACGGG + Intronic
1049714250 8:144082481-144082503 TGAGGCCGGCAGGACCTGAGCGG - Intergenic
1051609617 9:18948516-18948538 TGACTCCGGCAGGGGCAGAGGGG + Intronic
1052996311 9:34553220-34553242 TGGCAAGGGCAGGGGGTGAGAGG + Intronic
1053886123 9:42646076-42646098 TTACACTGCCAGGAGCAGAGGGG + Intergenic
1054225145 9:62453525-62453547 TTACACTGCCAGGAGCAGAGGGG + Intergenic
1055382540 9:75724614-75724636 TCACATGGGCAGGAGGTGGGTGG + Intergenic
1056792372 9:89634074-89634096 TGACATGGGCAGGAGCTAGGAGG + Intergenic
1057442531 9:95092356-95092378 TGACCCTGGCAGTCGCTGAGTGG + Intergenic
1058314908 9:103553789-103553811 TGATAGGGGCAGGAAGTGAGTGG + Intergenic
1058695881 9:107558732-107558754 AGACACTGGCAGGAGATGGGAGG - Intergenic
1059332111 9:113542236-113542258 TGAGATGGGAAGGAGCTCAGTGG + Intronic
1059418250 9:114175248-114175270 TGAGAGGGCCTGGAGCTGAGGGG - Intronic
1062277708 9:135738589-135738611 TGAGACGGGCAGAGTCTGAGAGG - Intronic
1062340262 9:136090950-136090972 GCACAGGGGCAGGAGCTGGGCGG + Intronic
1062590437 9:137272257-137272279 TGCTACGGACAAGAGCTGAGAGG - Intronic
1185635792 X:1550782-1550804 TCACAAGGTCAGGAGATGAGAGG + Intergenic
1186290019 X:8086880-8086902 TCAGACAGGCAGGTGCTGAGGGG - Intergenic
1187320296 X:18231779-18231801 TGACACAGGCAGGACTAGAGAGG + Intergenic
1187514444 X:19954566-19954588 TGACAGGGACTGGAGCTGAGAGG + Intronic
1189240198 X:39518991-39519013 TGTCACGGGCAGGAGGTCGGGGG - Intergenic
1190394175 X:49963000-49963022 TGACTCCAGAAGGAGCTGAGAGG + Intronic
1195067990 X:101254756-101254778 GGACATGGGCAAGAGCTGATGGG - Intronic
1195688447 X:107605063-107605085 TGACACAGGCAGGGGCTGAGTGG - Exonic
1199694608 X:150334976-150334998 TGACAAGGGCAGTGGCTGAGAGG - Intergenic
1201142366 Y:11039457-11039479 TCACACGGGCTGTAGCTTAGTGG + Intergenic