ID: 1140795393

View in Genome Browser
Species Human (GRCh38)
Location 16:78432863-78432885
Sequence CATTGTCCAGCCCATCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140795389_1140795393 22 Left 1140795389 16:78432818-78432840 CCACCTTTTTACCTCTTGCGGGC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1140795393 16:78432863-78432885 CATTGTCCAGCCCATCATAAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
1140795390_1140795393 19 Left 1140795390 16:78432821-78432843 CCTTTTTACCTCTTGCGGGCATG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1140795393 16:78432863-78432885 CATTGTCCAGCCCATCATAAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
1140795392_1140795393 11 Left 1140795392 16:78432829-78432851 CCTCTTGCGGGCATGAGTCTGGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1140795393 16:78432863-78432885 CATTGTCCAGCCCATCATAAAGG 0: 1
1: 0
2: 0
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140795393 Original CRISPR CATTGTCCAGCCCATCATAA AGG Intronic
902336007 1:15755331-15755353 CCATGTCCAGCCAATCATAGTGG - Intergenic
905488143 1:38322021-38322043 CATTGACAAAACCATCATAATGG - Intergenic
906515906 1:46438673-46438695 CATTGTGGATCCCAGCATAAAGG + Intergenic
909461955 1:75926906-75926928 CATTATTCAGCCCACCAAAATGG - Intronic
912791500 1:112656478-112656500 ACTTGTCCAGTCCACCATAATGG - Intronic
913100064 1:115555356-115555378 CATTGTCCAGTCTACCCTAAAGG - Intergenic
914537272 1:148577493-148577515 CATAGTCTATCCCAACATAAAGG - Intronic
915890035 1:159764664-159764686 ATTTTTCCAGCACATCATAAAGG + Intergenic
916283281 1:163076268-163076290 CATTTTGCAGCCCATTATATTGG - Exonic
918558870 1:185839971-185839993 CATTGTCAAAACAATCATAAGGG + Intronic
918885455 1:190187448-190187470 CATTGACCAGACCAACATCATGG + Intronic
919585580 1:199435182-199435204 CTTTTTCCAGCTCATCAAAAAGG + Intergenic
920055612 1:203188843-203188865 CCTTGGCCAGCCCAAGATAAGGG + Intergenic
920324046 1:205147626-205147648 CATTGTCCAGCCCATGCTCCAGG - Exonic
921095420 1:211883222-211883244 CTAAGTCCAGCCCATAATAAAGG - Intergenic
921253576 1:213319535-213319557 CATTGTGCAGCATATAATAAGGG - Intergenic
921908232 1:220518268-220518290 CATTCTGCAGCCCATGATCAAGG + Intergenic
922579019 1:226683233-226683255 CTTTGAGCAGCCCAGCATAAAGG + Intronic
1068044719 10:51871630-51871652 CATAGTCCATCCCAGCAAAAAGG + Intronic
1068748825 10:60567579-60567601 GATTCTGCAGCCCATCATCAAGG + Intronic
1070159341 10:73856404-73856426 CATTGTCGAGCCAGTCAGAATGG - Intronic
1074646229 10:115456242-115456264 CTTTGTCCAGTCTAACATAATGG - Intronic
1076212878 10:128664074-128664096 CATTGCCCAGACCAACATAAGGG - Intergenic
1077446701 11:2595736-2595758 CATTCTGCAGCCCATAATCAAGG + Intronic
1079939863 11:26666306-26666328 CATTATCCAAAACATCATAAAGG + Intergenic
1082615197 11:55350672-55350694 CATTGTCCAGACCAATATCATGG + Intergenic
1087903046 11:103664159-103664181 CGTTTTCTTGCCCATCATAAGGG - Intergenic
1089321076 11:117627194-117627216 CGTTGTCCTGCCCATCAGAACGG + Intronic
1095564595 12:43607364-43607386 CATTGCCCAGCCCAATGTAATGG + Intergenic
1099403818 12:82234770-82234792 CATTTTCCAGCCCAGGCTAAAGG - Intronic
1100810371 12:98331281-98331303 CATTGTAGAGCCCAACATTAAGG - Intergenic
1101289702 12:103355442-103355464 CATTGACCCGCCCATCTGAAAGG + Intronic
1101769705 12:107737798-107737820 CATTTTCCAGGCAATTATAATGG + Intronic
1102988582 12:117298463-117298485 CATGGTTCAGCCCATAATACAGG - Intronic
1104572037 12:129934046-129934068 CATAATTCAGCCCATAATAAGGG + Intergenic
1104811860 12:131624182-131624204 CATTGCCCAGGCCATGAGAATGG + Intergenic
1105712018 13:23020266-23020288 CATTGTCTAGTACATAATAAGGG + Intergenic
1106078679 13:26482643-26482665 CACAGTCCAGCCCATCAGAGTGG + Intergenic
1106936666 13:34729936-34729958 CATTGGCCAGCCCATGTTCAAGG - Intergenic
1115938746 14:38585033-38585055 CTTTGTCCAGCCTATCATTGAGG + Intergenic
1117449474 14:55837041-55837063 CTTTTTCCCACCCATCATAAGGG + Intergenic
1120313891 14:82866819-82866841 CATTGTCCACCCCAGAGTAAGGG - Intergenic
1123790150 15:23711716-23711738 CATTACCCAGACCCTCATAAAGG - Intergenic
1124237143 15:28000535-28000557 CATTGTCAAGACCAGCATCAAGG - Intronic
1127680562 15:61292529-61292551 TAATGTCCAGCCCACCAGAATGG + Intergenic
1129126365 15:73444855-73444877 CATTCTGCAGCCCATGATCAAGG - Intronic
1135750472 16:25054894-25054916 CACTGTCCAGCCTATCAGAGTGG - Intergenic
1135759519 16:25126039-25126061 CACTGTCCAGCCTATCAGAGTGG - Intronic
1137865156 16:51886998-51887020 CATTTGCCAGTCCATGATAAGGG - Intergenic
1138189547 16:55003348-55003370 CATTTTCCAGCCCATCCAATTGG + Intergenic
1138214539 16:55191705-55191727 CATTCTCCTGCCCTTCATACAGG + Intergenic
1138358980 16:56410331-56410353 CACTTGCCAGCCCATAATAAAGG + Intronic
1138884908 16:61064875-61064897 CTTTATCCAGTCCATCATTATGG - Intergenic
1140252118 16:73303313-73303335 CATTGCTCGGCCCAACATAATGG - Intergenic
1140579934 16:76218147-76218169 CCTGTTCCTGCCCATCATAAAGG - Intergenic
1140795393 16:78432863-78432885 CATTGTCCAGCCCATCATAAAGG + Intronic
1142061740 16:88034772-88034794 CATTTTCCAGCACTTCACAAAGG - Intronic
1146288786 17:31593703-31593725 CAGTTTCTAGCCCATCGTAAGGG + Intergenic
1146794720 17:35773195-35773217 CATTGCCCAGCCCATCGTTGTGG + Exonic
1147217228 17:38908009-38908031 GACAGTGCAGCCCATCATAAGGG + Intronic
1148605874 17:48928489-48928511 CAGTGTCCAGCCATGCATAAGGG + Exonic
1148961363 17:51396082-51396104 CACTGCCGAGCCCAGCATAACGG - Intergenic
1149305763 17:55345184-55345206 CATTGCCCAGCCCACCTTAGAGG - Intergenic
1150573064 17:66405064-66405086 CAGTTTCCATCCCATCAAAAAGG - Intronic
1153207185 18:2716466-2716488 CACAGTCCAGCCCATCATCTAGG - Intronic
1155841058 18:30643235-30643257 CAGTGTCCAGCCCATATTTAAGG - Intergenic
1156029576 18:32696505-32696527 CCTTGTTCAGCTCATCATATGGG + Intronic
1158031029 18:52965183-52965205 CATTATTCAGGCTATCATAAAGG + Intronic
1158543923 18:58379654-58379676 TATTGTCCAGCCCACCACACTGG - Intronic
1158828472 18:61251447-61251469 CAATGTGCAGGGCATCATAATGG + Intergenic
1158865675 18:61635895-61635917 CATTTTCTTACCCATCATAAGGG - Intergenic
1160424997 18:78773468-78773490 CATGGGCCAGGCCATCAAAAGGG - Intergenic
1162041585 19:7974179-7974201 CACTGTCCAGCACATCAGAGAGG - Intronic
1163099674 19:15087197-15087219 CATTATCCTGGCCATCATCACGG + Exonic
1163780579 19:19245155-19245177 CACTGTCCTGCCCATCCTGACGG - Intronic
1165633464 19:37321135-37321157 CATATTCCAGACCATCACAAGGG - Intronic
928444681 2:31322466-31322488 CATTGACCAGCTTATTATAAAGG - Intergenic
929009703 2:37428867-37428889 CTTTTTCCTCCCCATCATAAGGG - Intergenic
929797221 2:45069338-45069360 CTGTGTCCAGCCCATCTGAATGG - Intergenic
930110776 2:47676779-47676801 CAGTTCCCAGCCCATCAGAATGG + Intergenic
931152549 2:59590670-59590692 AAGTGTCCAGCACCTCATAAAGG + Intergenic
937443874 2:121940022-121940044 CATTGACTAGCCCATATTAAAGG + Intergenic
940282790 2:152004727-152004749 CATTGTCCAGCCCAGCTAAGTGG - Intronic
943155913 2:184176559-184176581 CTATGTCCAGCCCATCTCAACGG + Intergenic
943872073 2:193012188-193012210 CATTGCCCAACCCATCACCAGGG + Intergenic
944017202 2:195055901-195055923 CATAGTCTATCCCATCTTAAAGG + Intergenic
944869640 2:203896986-203897008 TACTGTCCAGGCCATCATCAGGG - Intergenic
945230339 2:207582115-207582137 CTTTGTCCAGCCCATATTCAAGG + Intronic
1169802052 20:9520635-9520657 CATTGTCAAGCACAGCATAATGG + Intronic
1170905128 20:20508108-20508130 CATTGGTCAGCCCATCATTCAGG - Intronic
1173386167 20:42589988-42590010 ATTGGTCCAGCCCATCACAAAGG - Intronic
1174194633 20:48764306-48764328 TATTGTTCAGCCCACCACAATGG - Intronic
1175489341 20:59368903-59368925 CATTTTTCAGCTCATCATAAAGG + Intergenic
1177182636 21:17759335-17759357 CATTTTCTCACCCATCATAAGGG - Intergenic
1179333959 21:40432607-40432629 CATTATTCAGCCTATCATATAGG + Intronic
1180075408 21:45459247-45459269 GAGTGTCCAGCCCAACATAGGGG - Intronic
1182539337 22:31028822-31028844 CATTGTGCACCACATCAGAAGGG + Intergenic
1182762041 22:32730385-32730407 CAGTGTCTAGCCCATTCTAAAGG - Intronic
1183964444 22:41432993-41433015 AATTGTCCAGCCCAAGAAAAGGG + Intergenic
949989310 3:9564783-9564805 TATTGTCCAGTCAATCATAATGG - Intergenic
951525323 3:23647684-23647706 CATTGTCCTGGCCATCACAATGG + Intergenic
951577824 3:24131689-24131711 CCTTGTCCTGTCCATCATGAAGG + Intronic
952875401 3:37940704-37940726 GATTGGCCAGCCCTTGATAAAGG + Intronic
955349598 3:58183909-58183931 CAAGGTCCAGTCCATCACAAAGG + Intergenic
955721024 3:61881468-61881490 CAGCGTCCAGCACATCATGAAGG - Intronic
956523631 3:70132574-70132596 CATTTTCCAGCCTGTCAGAATGG + Intergenic
957701013 3:83712562-83712584 CATTGTCCAAGCCATAAAAATGG - Intergenic
958416371 3:93879012-93879034 CAATCTCCAGCACATCATTAAGG - Intronic
959733516 3:109631127-109631149 CATTCTCCAGCCCACCAGACTGG - Intergenic
963846580 3:150164829-150164851 CAGCGTCCAGCACATCATGAAGG + Intergenic
964261786 3:154847823-154847845 CCTTGTCCAGGCCATTTTAAAGG - Intergenic
968349985 3:198046064-198046086 CCTTGTCCAGCCCATCCTGCTGG + Intergenic
969467244 4:7365066-7365088 CTGTGGCCAGCCCATCACAAGGG + Intronic
971149015 4:24011292-24011314 CCTTTTGCATCCCATCATAAGGG + Intergenic
971582518 4:28360936-28360958 CAGTGTCAAGCCCAGCATGAAGG + Intergenic
971819940 4:31539175-31539197 CATTGTCCAACCCATCACCTGGG - Intergenic
980496288 4:133590261-133590283 CATTGTAAAGGCCACCATAAAGG + Intergenic
986659675 5:10047779-10047801 CATTATCCAGCTCATCATTCAGG - Intergenic
996270655 5:121600917-121600939 TATTGTCCAGACCAACATCATGG + Intergenic
999594346 5:153185494-153185516 CCAAGTCCAGCCCATAATAATGG + Intergenic
1000267965 5:159656624-159656646 CATTTTCCAGCTTATCTTAATGG - Intergenic
1001137622 5:169115575-169115597 CAATGTCCAGCCCCTCAGAAAGG + Intronic
1009242063 6:61195879-61195901 CATTGTCAAGGCCATGAAAAGGG - Intergenic
1010407093 6:75517893-75517915 CATGGTCTTTCCCATCATAATGG + Intergenic
1010990927 6:82479260-82479282 AATAGTCCAGCCCAACAGAAAGG + Intergenic
1020141177 7:5612777-5612799 CCTTGTCCTCCCCATCAGAAGGG + Intergenic
1021401400 7:20213532-20213554 CTTTATCCAGTCCATCATTATGG - Intronic
1026471959 7:70701265-70701287 CACTGTGCAGCCCAACATCAGGG - Intronic
1027934704 7:84587972-84587994 AATTGTCCTGCCCATTATTAAGG + Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1038433817 8:27520806-27520828 CGCAGTTCAGCCCATCATAAAGG + Intronic
1042033555 8:64504746-64504768 CATTGTCCAGACCAACCTTATGG - Intergenic
1042061145 8:64819514-64819536 CATTGTGCAGCACATCGTATAGG + Intergenic
1042350110 8:67768540-67768562 CATTATTCAGCCAATCATACTGG - Intergenic
1043022119 8:75015964-75015986 CATTGTCAAGCCTTTGATAAAGG + Intronic
1048339736 8:133529421-133529443 AATTTTCCATCCCACCATAAGGG - Intronic
1050741930 9:8830623-8830645 CAGTGTCCACCCTATCATGAGGG + Intronic
1052880751 9:33599757-33599779 CACTGTCCAGCCCATCCTGCTGG - Intergenic
1053495217 9:38544453-38544475 CACTGTCCAGCCCATCCTGCTGG + Intronic
1055257029 9:74384096-74384118 CATTGTTCAGGCAATTATAAAGG - Intergenic
1056469634 9:86893123-86893145 TATTGTTCAGCCAATTATAAGGG + Intergenic
1057713204 9:97465903-97465925 CAGTGTCCTTCCCATCATGAAGG - Intronic
1192902996 X:75520606-75520628 CAATGTCCATACCATAATAATGG + Intronic
1195538232 X:106033378-106033400 CAATCTTCATCCCATCATAAGGG + Exonic
1200273644 X:154711855-154711877 CATGGGCAAGCCCATCACAAGGG + Intronic
1200908971 Y:8514370-8514392 CAGTGTCCAGCCCATGAGAGGGG - Intergenic
1202232226 Y:22669353-22669375 CAGTGTCCAGCCCATGAGAGAGG - Intergenic
1202310930 Y:23526805-23526827 CAGTGTCCAGCCCATGAGAGAGG + Intergenic
1202559872 Y:26143789-26143811 CAGTGTCCAGCCCATGAGAGAGG - Intergenic