ID: 1140797467

View in Genome Browser
Species Human (GRCh38)
Location 16:78452969-78452991
Sequence GAGGATCACTTAGGCCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9898
Summary {0: 1, 1: 3, 2: 67, 3: 1165, 4: 8662}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140797467_1140797471 2 Left 1140797467 16:78452969-78452991 CCTTCTTGGCCTAAGTGATCCTC 0: 1
1: 3
2: 67
3: 1165
4: 8662
Right 1140797471 16:78452994-78453016 CTCTCAGCCTCCCGAGTAGCTGG 0: 176
1: 6928
2: 127209
3: 307556
4: 216434
1140797467_1140797474 11 Left 1140797467 16:78452969-78452991 CCTTCTTGGCCTAAGTGATCCTC 0: 1
1: 3
2: 67
3: 1165
4: 8662
Right 1140797474 16:78453003-78453025 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
1140797467_1140797472 3 Left 1140797467 16:78452969-78452991 CCTTCTTGGCCTAAGTGATCCTC 0: 1
1: 3
2: 67
3: 1165
4: 8662
Right 1140797472 16:78452995-78453017 TCTCAGCCTCCCGAGTAGCTGGG 0: 5346
1: 120948
2: 300228
3: 217123
4: 118479
1140797467_1140797477 30 Left 1140797467 16:78452969-78452991 CCTTCTTGGCCTAAGTGATCCTC 0: 1
1: 3
2: 67
3: 1165
4: 8662
Right 1140797477 16:78453022-78453044 CAGGCACCTGCCTTCATGCCTGG 0: 5
1: 392
2: 3992
3: 17845
4: 49870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140797467 Original CRISPR GAGGATCACTTAGGCCAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr