ID: 1140797559

View in Genome Browser
Species Human (GRCh38)
Location 16:78453962-78453984
Sequence GATCTGGATTTCACCACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140797555_1140797559 2 Left 1140797555 16:78453937-78453959 CCAAGTCCAACTTGTAGATTGGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1140797559 16:78453962-78453984 GATCTGGATTTCACCACACCTGG 0: 1
1: 0
2: 1
3: 8
4: 93
1140797557_1140797559 -4 Left 1140797557 16:78453943-78453965 CCAACTTGTAGATTGGGCAGATC 0: 1
1: 0
2: 1
3: 7
4: 59
Right 1140797559 16:78453962-78453984 GATCTGGATTTCACCACACCTGG 0: 1
1: 0
2: 1
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140797559 Original CRISPR GATCTGGATTTCACCACACC TGG Intronic
920016705 1:202916835-202916857 GAACTGCACATCACCACACCGGG - Intronic
920043847 1:203120956-203120978 GCTCTGGATGTCCCCAGACCTGG - Intronic
921700139 1:218259837-218259859 GGTCTGGATTTCTCAACCCCCGG + Intergenic
922972837 1:229757714-229757736 GGTCTGGATTTCAGCAGTCCAGG + Intergenic
924314870 1:242785257-242785279 GTCCTGGCTTACACCACACCTGG - Intergenic
924452577 1:244191469-244191491 GAGCTGGATTTCACCAGGCGAGG - Intergenic
1074863516 10:117531626-117531648 TATCTCGCTTTCAGCACACCCGG + Intergenic
1078877945 11:15416874-15416896 GATCCTGATTTCAACACACTTGG + Intergenic
1080277105 11:30514906-30514928 GAGATGAGTTTCACCACACCAGG - Intronic
1084377183 11:68785416-68785438 GAGGTGCATGTCACCACACCTGG - Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1092002385 12:5043607-5043629 GCTCTGGATTTCAGTTCACCTGG - Intergenic
1097867184 12:64568565-64568587 TTTCTGGATTCCACCACAGCAGG + Intergenic
1098818747 12:75204103-75204125 GATCTCGTTTTCTCCACAACAGG + Intronic
1099119622 12:78672153-78672175 GGCCTGGATTTCCCCAGACCTGG + Intergenic
1110048680 13:70864792-70864814 GATGTGTATTTTACCACAACTGG - Intergenic
1111664997 13:91255937-91255959 GAAGTGGATTTCAACACACAAGG - Intergenic
1119965743 14:78913819-78913841 GCTCTGGCTTTCCCCACACTTGG + Intronic
1123120663 14:105914913-105914935 GACCTGGGTTTCACCTGACCTGG - Intergenic
1123403374 15:20006460-20006482 GACCTGGGTTTCACCTGACCTGG - Intergenic
1123512712 15:21013114-21013136 GACCTGGGTTTCACCTGACCTGG - Intergenic
1125194407 15:37030232-37030254 GCTCTGGCTTTCATGACACCAGG + Intronic
1130017669 15:80200233-80200255 GTTCTTGAATTCACCACCCCAGG - Intergenic
1135414412 16:22257839-22257861 GACCTGGCTGTCACCACACAGGG - Intronic
1140797559 16:78453962-78453984 GATCTGGATTTCACCACACCTGG + Intronic
1143431598 17:6891933-6891955 GAGCTGGATTTCACAGGACCTGG + Intronic
1146570648 17:33949956-33949978 GATCTGGGGTTGGCCACACCAGG - Intronic
1147020082 17:37524288-37524310 GATCTGTATTTTTCCTCACCAGG + Intronic
1147047532 17:37765431-37765453 GATCTTGATTTCACCACGCCTGG + Intergenic
1147577848 17:41612844-41612866 CCTCTGGATTTCATCACTCCCGG + Intronic
1148799219 17:50212654-50212676 GATCTGGCTGTCAGGACACCTGG - Intergenic
1150631986 17:66886230-66886252 GAGCTGGATTTGAGGACACCTGG + Intergenic
1150722167 17:67622612-67622634 GGGCTGGAATTAACCACACCTGG - Intronic
1151403069 17:73868810-73868832 GAGCTGGCTCACACCACACCTGG + Intergenic
1153094389 18:1383821-1383843 GATCTTGCTCTCACCACACTTGG + Intergenic
1153922647 18:9805111-9805133 CAGCTGCATGTCACCACACCTGG - Intronic
1153975091 18:10262317-10262339 GATTTGCTTTTCACCACACAAGG + Intergenic
1154103068 18:11494675-11494697 GAACTGGATTTCACCACATAAGG - Intergenic
1157520294 18:48340882-48340904 GTTCTGGATCTCACCACCCTGGG + Intronic
1158963249 18:62603506-62603528 GAGCTGGATTTAACCAAACTTGG + Intergenic
1162217303 19:9147148-9147170 GATCTGTTTTTCTCCTCACCAGG - Intronic
1164889057 19:31807451-31807473 GAGCTTGATTACACCACACCTGG + Intergenic
926519197 2:13888915-13888937 TATCTAGTTTTCACAACACCAGG - Intergenic
932346789 2:71001028-71001050 GTTCTGGCTTTGACCACCCCTGG + Intergenic
935030387 2:99316311-99316333 GAGGTGGATGCCACCACACCTGG + Intronic
936776040 2:115974794-115974816 GATCAGAATTTCCCCAGACCAGG + Intergenic
937319261 2:120951288-120951310 GATCCGGCTTTCCCCGCACCCGG + Exonic
946968438 2:225065600-225065622 GCTCTGTATTTCTCCTCACCAGG + Intergenic
947345133 2:229182790-229182812 CATGTGGATTTCCCCAGACCTGG - Intronic
947415537 2:229891449-229891471 GATGTGCATGTCACCACACCCGG - Intronic
948058505 2:235027078-235027100 GGTTTGGATTTCACTGCACCTGG + Intronic
1171343466 20:24448012-24448034 CCTCTGGGTTTCACCCCACCAGG - Intergenic
1172525476 20:35598601-35598623 GATCTGGATTTCATCACTGGAGG - Intergenic
1173278846 20:41609094-41609116 GATCTAAATTTCAGCACACTGGG + Intronic
1177107929 21:16983853-16983875 GATATGGACGTAACCACACCAGG + Intergenic
1178792801 21:35715447-35715469 GATCTGGACATCTCTACACCTGG + Intronic
1180067380 21:45419243-45419265 GAACTGCATGTCACCACACACGG - Intronic
1182048342 22:27294294-27294316 GATCAGAATTTCACAAAACCAGG - Intergenic
950985232 3:17356788-17356810 GATCTGCATTTCAGAACCCCAGG - Intronic
956452296 3:69386387-69386409 GAGCTGCATTTCAGCACACTTGG + Intronic
961154433 3:124666709-124666731 GTTCTGGATGTCACAACTCCAGG - Intronic
969269868 4:6092202-6092224 GGCCGGGATTCCACCACACCTGG - Intronic
971000185 4:22313713-22313735 AACCTGGATTTCTCCATACCAGG + Intergenic
971109409 4:23566660-23566682 GATCTGTAATCCACCACACCTGG + Intergenic
974376540 4:61084952-61084974 GATCTGGTTTTGACCACCACTGG + Intergenic
976650951 4:87434183-87434205 TAGCTGGGATTCACCACACCTGG + Intronic
978866651 4:113520884-113520906 GCTGTGCATTCCACCACACCTGG - Intronic
980137123 4:128869025-128869047 AATTTGGATTTCAACACAACAGG - Intronic
981703031 4:147627752-147627774 TATCTGCATACCACCACACCTGG - Intronic
981703052 4:147627883-147627905 TATCTGCATACCACCACACCTGG - Intronic
981703073 4:147628014-147628036 TATCTGCATACCACCACACCTGG - Intronic
984293788 4:177828620-177828642 AAACTGGATTTAACCAGACCTGG + Intronic
985969927 5:3366951-3366973 CATCTGCATGTCACCACACCTGG + Intergenic
990299968 5:54440403-54440425 GAGCTAGGATTCACCACACCCGG - Intergenic
991682429 5:69152304-69152326 GTTCTGGATTTCAGGAGACCAGG - Intergenic
992322576 5:75628609-75628631 GAGATGGATTTTACCAAACCTGG - Intronic
992482760 5:77167913-77167935 TAGCTGGCTTTCACCACACAAGG + Intergenic
994307228 5:98221158-98221180 GATCTGGGTGACAACACACCAGG - Intergenic
994822819 5:104676241-104676263 GAGATGGATTTGACCTCACCTGG + Intergenic
996397583 5:123028685-123028707 GCTCTGGATTTCAACAGACTGGG + Intronic
1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG + Intronic
1007041448 6:38726189-38726211 GATTTGGATAACACCACAACTGG + Intronic
1008076577 6:47152049-47152071 AATCTGCCTTGCACCACACCTGG + Intergenic
1008804491 6:55411322-55411344 GAGCTAGATTTTACCACAGCTGG + Intergenic
1013075299 6:106765644-106765666 GCTCTGCATCTCACCACACAAGG - Intergenic
1016388468 6:143551541-143551563 GAGCTGGGTTTCTCAACACCCGG + Intronic
1017113962 6:150959645-150959667 GAGCTGGATCTCAACACAGCAGG - Intronic
1018310273 6:162501294-162501316 GATATGGATTTCACGAGGCCTGG - Intronic
1020824025 7:13004611-13004633 GATAGGGATTTCATCACATCTGG + Intergenic
1025027819 7:55532653-55532675 GAGCTGTATTTTTCCACACCAGG - Intronic
1025235390 7:57231350-57231372 TATCTTGATTTCACCCCACTGGG - Intergenic
1029032713 7:97485733-97485755 GAGCTGGATTTCAGCCCAACTGG - Intergenic
1036223525 8:6940189-6940211 GGTATGGATCTCACCACCCCCGG - Intergenic
1042842243 8:73135671-73135693 GAACTGAATTACAACACACCTGG + Intergenic
1047184143 8:122616846-122616868 GGTCTGGATTCCACGACACCAGG + Intergenic
1060376188 9:123116875-123116897 GTTTTGAATTTCACCACAACTGG - Intronic
1061155999 9:128861972-128861994 GAGCTGGATTTCACCCTACCGGG + Intronic
1062209081 9:135353527-135353549 GCTCTGGGATTCACCACTCCAGG - Intergenic
1194819046 X:98483352-98483374 GATCTGCAATTCACCAGGCCTGG - Intergenic
1195240325 X:102944995-102945017 GATCTGAATATCACCACATTGGG - Intergenic
1198351716 X:135811587-135811609 GATCGGGTTCCCACCACACCAGG + Intergenic
1198355532 X:135846105-135846127 GATCGGGTTCCCACCACACCAGG + Intergenic
1198357442 X:135863384-135863406 GATCGGGTTCCCACCACACCAGG + Intergenic