ID: 1140800659

View in Genome Browser
Species Human (GRCh38)
Location 16:78485367-78485389
Sequence TCCCTAAGGAACCCTGTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140800654_1140800659 -3 Left 1140800654 16:78485347-78485369 CCCAGTGAGGTCCTTTTGACTCC 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1140800659 16:78485367-78485389 TCCCTAAGGAACCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1140800655_1140800659 -4 Left 1140800655 16:78485348-78485370 CCAGTGAGGTCCTTTTGACTCCC 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1140800659 16:78485367-78485389 TCCCTAAGGAACCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1140800653_1140800659 1 Left 1140800653 16:78485343-78485365 CCTGCCCAGTGAGGTCCTTTTGA 0: 1
1: 0
2: 1
3: 20
4: 196
Right 1140800659 16:78485367-78485389 TCCCTAAGGAACCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140800659 Original CRISPR TCCCTAAGGAACCCTGTTTT GGG Intronic
904856547 1:33502081-33502103 TCCCTCAGGATCCCTGTGCTAGG + Intergenic
908120943 1:60985322-60985344 TCCCCATGGCACCCTGTTTAGGG - Intronic
909446171 1:75751370-75751392 TCTCTCAGTAACCCTTTTTTGGG + Intronic
912143242 1:106757632-106757654 TCCCTCAGAAACCTTGCTTTTGG + Intergenic
912798222 1:112705643-112705665 TTCCCAAGGAACCCTCTTTTTGG - Exonic
913339019 1:117738693-117738715 TCTTTAAGCAACCCTGTTTGTGG - Intergenic
915841230 1:159215111-159215133 TCCCTGTGAAACACTGTTTTAGG - Intergenic
919714674 1:200763773-200763795 TCCTTAAGAAACTATGTTTTTGG + Intronic
920932895 1:210405423-210405445 TCCCTTGAGAACACTGTTTTAGG - Intronic
1067471973 10:46544114-46544136 TCCCTATTGAACCCTTCTTTAGG - Intergenic
1068647149 10:59480505-59480527 TTCCCAAGGAGCCCTGTATTTGG + Intergenic
1072427924 10:95345689-95345711 TCCTTATGGAACCCAGTCTTTGG + Intronic
1076550968 10:131277991-131278013 TCCCTCCAGAGCCCTGTTTTGGG - Intronic
1076877048 10:133221072-133221094 TCTCTAGGGACCCCTGTGTTGGG + Intronic
1079775587 11:24521464-24521486 TCCCTAAGAAACATTGCTTTAGG - Intronic
1081429529 11:42961361-42961383 TCCCAATGGAACAGTGTTTTGGG - Intergenic
1083451099 11:62745883-62745905 TCCCAAAGGAAACCTATTGTTGG - Intergenic
1084444184 11:69193925-69193947 GCCCTGATGAACCCTGATTTTGG - Intergenic
1084915158 11:72423282-72423304 TCCCTGAGGAACACTGGGTTTGG - Intronic
1085793000 11:79512273-79512295 TCCATAGGAAGCCCTGTTTTAGG + Intergenic
1091299413 11:134497986-134498008 GCACCAAGGAACCCTTTTTTTGG - Intergenic
1095072530 12:37871832-37871854 TCACAAAGTAAACCTGTTTTTGG - Intergenic
1095696215 12:45147128-45147150 TCCCTGAGGAACATTGTCTTTGG + Intergenic
1095906404 12:47382664-47382686 TGCAGAAGGAACCTTGTTTTTGG - Intergenic
1097081365 12:56433583-56433605 TGCCTAAGGAGCCCAGCTTTCGG - Exonic
1097757284 12:63420520-63420542 TCCCTTTGGAACTCTGTATTTGG - Intergenic
1098979472 12:76939340-76939362 TCCCTGAGAAAAACTGTTTTAGG + Intergenic
1101208082 12:102508842-102508864 TCCCTACGCATCCCTGTTTTTGG + Intergenic
1101794816 12:107963367-107963389 GCCCTGAGGAACCCATTTTTTGG + Intergenic
1103770134 12:123316053-123316075 TCCTTGAGGAACCCTGTTCTTGG + Intronic
1103951867 12:124555721-124555743 TCCCCAAGGAACCAAGTTCTGGG - Intronic
1106984992 13:35336009-35336031 TTCCTAAGGAACTCTGTGTAAGG - Intronic
1107481220 13:40787815-40787837 ACCCAAAGGAACCCTGATTAAGG - Intergenic
1112273232 13:97989965-97989987 TCTCTAAGCAATCCTGTTTTTGG - Intronic
1113225161 13:108151713-108151735 TCCCTCAGAATACCTGTTTTTGG - Intergenic
1114201493 14:20525198-20525220 TTCCTAAAGAAACCTATTTTAGG - Intergenic
1115767569 14:36639231-36639253 TCCCAAATTCACCCTGTTTTAGG + Intergenic
1120870945 14:89337072-89337094 TACCTAAGGACCCCTCTCTTGGG - Intronic
1120913176 14:89686501-89686523 TCCATAAGAAAGCCAGTTTTGGG - Intergenic
1121215278 14:92242757-92242779 TTCCTTAGGAACACTGGTTTGGG - Intergenic
1121639603 14:95476242-95476264 AACCTAAGGAACACTGTTCTGGG + Intergenic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1131296607 15:91154891-91154913 TCCCCAAGGAACCATGCTCTTGG - Intronic
1134191860 16:12127805-12127827 GCCCTAAGTATCCCTGATTTGGG - Intronic
1138928895 16:61628096-61628118 TCCCACAGAAACACTGTTTTAGG + Intergenic
1140800659 16:78485367-78485389 TCCCTAAGGAACCCTGTTTTGGG + Intronic
1146929360 17:36766822-36766844 GCCCTCAGGAAACCTGGTTTGGG + Intergenic
1147797372 17:43054357-43054379 TTCCTAAGGAAAACTGCTTTGGG - Intronic
1148017376 17:44531607-44531629 TCGCCAAGGTACCATGTTTTGGG - Intergenic
1149313106 17:55415154-55415176 TCCCTCATGAAACCTGTTGTGGG - Intronic
1149502680 17:57166445-57166467 TCCATAAGCCATCCTGTTTTGGG + Intergenic
1150816994 17:68400275-68400297 TCCCTCGAGAACCCTGATTTAGG + Intronic
1156804322 18:41158932-41158954 TCACTGAGGAACAATGTTTTAGG + Intergenic
1158450726 18:57561970-57561992 TGCCTAAGGAACACTGCTCTGGG + Intronic
1158767562 18:60473224-60473246 TCCATAAAGAAGGCTGTTTTAGG + Intergenic
1161226974 19:3151252-3151274 TCCTAAAGTGACCCTGTTTTAGG + Intronic
1161301855 19:3546537-3546559 TCCCTAAGGAGCCCTGGCTCTGG + Intronic
1161456970 19:4374508-4374530 ACCCTAAGGAACCCTGTGCAGGG + Intronic
1162889265 19:13720540-13720562 CCCCAAAGGAAACCTGTTGTTGG - Intergenic
1164566503 19:29329583-29329605 TCCCTAGGGAGCCCTGTTGCTGG - Intergenic
1166921594 19:46232425-46232447 TCCCTAAGGAACCTGCTTCTGGG - Intergenic
927001107 2:18794708-18794730 TCCCTCAGAATCCCTGGTTTAGG + Intergenic
928262406 2:29779626-29779648 TCCCCAAGGAAGCCAGTCTTTGG + Intronic
928898323 2:36291140-36291162 TCCAAAAGGAACACTGTATTAGG - Intergenic
931243376 2:60472101-60472123 TCCCTAAGGATCCCTCCATTAGG + Intronic
933802201 2:85970748-85970770 ACCATCAGAAACCCTGTTTTAGG - Intergenic
940488560 2:154327507-154327529 TCCCTAAAGAAACCTCTTGTTGG + Intronic
942774005 2:179558886-179558908 TCCCTATGGAAACCTGGTATGGG + Intronic
943556125 2:189405884-189405906 TCCTTTAGGAACTTTGTTTTAGG + Intergenic
943674357 2:190702693-190702715 TCTTTAATGAAACCTGTTTTGGG + Intergenic
944443554 2:199766452-199766474 TCCATAAGGAACACATTTTTAGG + Intronic
945427079 2:209719568-209719590 TCCTAGAGCAACCCTGTTTTAGG + Intronic
946168739 2:217881110-217881132 TCCCTCAGGGAGCCTCTTTTGGG - Intronic
947603689 2:231469829-231469851 TCCTGAAGAAACCCTGATTTGGG - Intronic
948206473 2:236165115-236165137 TGCCTAAGGAGACCTGTTTCAGG + Intergenic
1169448187 20:5689564-5689586 ACCCTAACGTACCCTGCTTTGGG + Intergenic
1174194020 20:48760214-48760236 TTCCTAAGGAAACCTGGATTTGG + Intronic
1175285239 20:57833387-57833409 TTCCTAAGGAGGCCTGTTTCTGG + Intergenic
1178238656 21:30873466-30873488 CACCAAAGGAGCCCTGTTTTAGG - Intergenic
1180610616 22:17095326-17095348 GCCCTATGGAATACTGTTTTTGG - Intronic
1181332008 22:22100126-22100148 ACCCTAAGGAAACAAGTTTTTGG - Intergenic
1183294580 22:37022087-37022109 TTCCTGAGGAACCCTATTGTGGG - Intronic
963306308 3:143657406-143657428 TCCCCAAGGAACCCTGTTTGAGG - Intronic
967902080 3:194464965-194464987 TCCCTGAGGAAGCATATTTTAGG - Intronic
969326843 4:6448956-6448978 TCCCAAAGGAACACTGCTCTGGG - Intronic
970324055 4:14904721-14904743 TCTCCAAGGAAGCATGTTTTTGG + Intergenic
970931335 4:21515733-21515755 TTTCTAAGGAACCCACTTTTGGG - Intronic
971785311 4:31094840-31094862 TCCCTAAGGCATCATGTTGTTGG - Intronic
972407538 4:38761291-38761313 TCTCTCAGGAACCCTGACTTTGG - Intergenic
974594211 4:63995872-63995894 TCCCTGAGGTGCCCTTTTTTAGG - Intergenic
977916623 4:102601549-102601571 TTCCTAAGAAAACCTGATTTGGG - Intronic
980992305 4:139748353-139748375 TCCCTTAGTGACTCTGTTTTGGG - Intronic
981252718 4:142623473-142623495 TCACCATGGATCCCTGTTTTAGG - Intronic
983346975 4:166539181-166539203 ACCCGAAGGAATCCTGATTTTGG - Intergenic
985028151 4:185759776-185759798 TAACTAAGGAACCCTGTTACAGG - Intronic
989326567 5:40203266-40203288 TCTCTAAGGCACCCTGATATTGG - Intergenic
993390651 5:87316672-87316694 TGCCTCAGCATCCCTGTTTTGGG + Intronic
995250027 5:109982750-109982772 TTCCTAAGTAACCCTGTTAAGGG + Intergenic
996325544 5:122268537-122268559 TTCCTCAGGAACACTGATTTAGG - Intergenic
997198071 5:131992840-131992862 TCACTAAGGACAGCTGTTTTTGG - Intronic
999120977 5:149209191-149209213 TCCCTAGAGAACTCTGATTTAGG - Intronic
1001371091 5:171202923-171202945 TCCATTAGAAACCCTGTTTTGGG + Intronic
1002040278 5:176508466-176508488 AACCTAAGGACCACTGTTTTTGG + Exonic
1002134457 5:177099168-177099190 TCCCTCAAGAACCCTGTTCCAGG + Intergenic
1009188963 6:60606517-60606539 TCCCACAGGAATCCTGTTTGAGG - Intergenic
1011780238 6:90780589-90780611 TCCCTAAGGAAACATGTTCAAGG - Intergenic
1014293376 6:119587695-119587717 TCCATGAGAAACCCTGTTCTGGG - Intergenic
1014693789 6:124594296-124594318 TCCCTGAGCAAGTCTGTTTTAGG + Intronic
1015522705 6:134147534-134147556 TCCCTGAGCAACCCTGATATGGG + Intergenic
1015623909 6:135160158-135160180 ACCCTCAGGAACTCAGTTTTTGG + Intergenic
1021359977 7:19700610-19700632 TCCCTAAGGAATCCTGCAGTGGG - Intronic
1024918131 7:54526015-54526037 CCCCTAAGGAACCATTCTTTAGG - Intergenic
1032069939 7:128798215-128798237 TCGCTCTGGAACCCTATTTTCGG - Intronic
1032858537 7:135857474-135857496 TCCCTGAGCAACCCTTTTTAGGG - Intergenic
1036107480 8:5856482-5856504 TAGCTATGGAACCCTGTCTTAGG - Intergenic
1038046667 8:23771532-23771554 TGCCTGAGGCATCCTGTTTTTGG + Intergenic
1050485661 9:6132119-6132141 TATCTCTGGAACCCTGTTTTGGG + Intergenic
1051409499 9:16774775-16774797 TATTTAAGGAAACCTGTTTTGGG + Intronic
1052172141 9:25412797-25412819 TCCCTAAGGAAGCCTGTCTCTGG + Intergenic
1056248587 9:84724235-84724257 TCCTTAAGGAGCCCTGTGTGTGG - Exonic
1057485318 9:95478353-95478375 ACATTAAAGAACCCTGTTTTAGG + Intronic
1058793507 9:108474181-108474203 TCCCAAAGTAATCCTGTGTTGGG + Intergenic
1060887865 9:127168296-127168318 CCCCAATGGAAACCTGTTTTAGG + Intronic
1189419664 X:40845598-40845620 TCCCTAAGGAGGCCTGAATTTGG + Intergenic
1195246748 X:103002042-103002064 TCCCAATGCAACCCTGTTCTTGG + Intergenic
1201417687 Y:13763779-13763801 GTCCTAAGGTATCCTGTTTTGGG + Intergenic
1202068754 Y:20968624-20968646 TCCCTGCTGAACTCTGTTTTTGG - Intergenic