ID: 1140800873

View in Genome Browser
Species Human (GRCh38)
Location 16:78487368-78487390
Sequence TTGTATTAGTAGATGGGATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140800873_1140800878 19 Left 1140800873 16:78487368-78487390 CCGTATCCCATCTACTAATACAA 0: 1
1: 0
2: 0
3: 12
4: 468
Right 1140800878 16:78487410-78487432 GATGAGTCCACAAGTTTGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1140800873_1140800877 18 Left 1140800873 16:78487368-78487390 CCGTATCCCATCTACTAATACAA 0: 1
1: 0
2: 0
3: 12
4: 468
Right 1140800877 16:78487409-78487431 GGATGAGTCCACAAGTTTGAAGG 0: 1
1: 0
2: 2
3: 6
4: 116
1140800873_1140800876 -3 Left 1140800873 16:78487368-78487390 CCGTATCCCATCTACTAATACAA 0: 1
1: 0
2: 0
3: 12
4: 468
Right 1140800876 16:78487388-78487410 CAAACTAATGAGATCTATTAAGG 0: 1
1: 0
2: 2
3: 20
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140800873 Original CRISPR TTGTATTAGTAGATGGGATA CGG (reversed) Intronic
901133082 1:6974850-6974872 TTTTATTATTAGATGGCAAAAGG - Intronic
901565976 1:10115441-10115463 TTGTATTTTTAGTTGAGATAGGG + Intronic
901826610 1:11866028-11866050 TTGTATTTTTAGTAGGGATAGGG + Intergenic
902319662 1:15652352-15652374 TTGTATTAAGAGATGGGGTTTGG - Intronic
902433687 1:16383036-16383058 TTGTATTTTTAGAAGGGACAGGG + Intronic
902505365 1:16936439-16936461 TTGTATTTGTAGTAGAGATAGGG + Intronic
905227883 1:36491877-36491899 TTGTATTTTTAGAAGGGATGGGG + Intergenic
906988890 1:50716335-50716357 ATGTATTAATAGGTGGGCTATGG - Intronic
907207557 1:52786916-52786938 TTGTATTTTTAGTAGGGATAGGG - Intronic
907939119 1:59070331-59070353 TTGTATTTTTAGTTGAGATAGGG + Intergenic
908521340 1:64945908-64945930 TTGTATTTTTAGTAGGGATAAGG + Intronic
908869769 1:68595967-68595989 TTGTATAAATAGATGGTTTATGG + Intergenic
908924879 1:69242163-69242185 TTGTATTATTAGTAGAGATATGG + Intergenic
909593462 1:77378490-77378512 TTGTATTTTTAGAAGAGATAGGG + Intronic
909940237 1:81602724-81602746 TTGTATTCTTAGTAGGGATAGGG - Intronic
911713072 1:101097344-101097366 GTTTATTAGTAGATTGGACATGG - Intergenic
911992102 1:104711889-104711911 TTGTATTTTTAGTTGGGATAGGG + Intergenic
913290756 1:117269468-117269490 TTGTATTTTTAGAAGAGATAGGG - Intergenic
914995622 1:152541104-152541126 TTGTATTGGGAGATGGAAAAGGG - Intronic
915002912 1:152609777-152609799 TTGTATTGGGAGATGGAAAAGGG + Intergenic
915116299 1:153602516-153602538 TTGTATTTTTAGTAGGGATAGGG - Intergenic
915354116 1:155245540-155245562 TTGTATTTTTAGAAGAGATAGGG - Intergenic
915394758 1:155574738-155574760 TTTTATTAGTAGTAGAGATAAGG + Intergenic
915441675 1:155949405-155949427 TTGTATTTTTAGAAGAGATAGGG - Intronic
915657473 1:157373298-157373320 TTGCATTTGTATATGTGATAAGG + Intergenic
915671572 1:157493448-157493470 TTGCATTTGTATATGTGATAAGG - Intergenic
916013576 1:160728264-160728286 TTGCATCAGTGGATAGGATAAGG + Intergenic
916455216 1:164964113-164964135 TTGTAATAGTAGATGAAACATGG + Intergenic
917820906 1:178763013-178763035 TTGTATTTGTATATGGTACAAGG + Intronic
917917138 1:179713461-179713483 GTGTATTTGTATATGGTATAAGG - Intergenic
917988743 1:180350204-180350226 TTGTATTAATAGAAAAGATAAGG + Intronic
918742878 1:188158342-188158364 TTGGATGAGTAGGTGGGAGAGGG + Intergenic
919324624 1:196090999-196091021 TTGTATTATTAGTAGAGATAGGG + Intergenic
919828487 1:201521185-201521207 TTGTATTATTAGTAGAGATAGGG + Intergenic
920165745 1:204034601-204034623 TTGTATTTTTAGTTGAGATAGGG + Intergenic
921658281 1:217767634-217767656 GTTTATTAGTAGATTGGACATGG - Intronic
922386047 1:225084222-225084244 TTATAATAATAGAAGGGATAAGG + Intronic
923096836 1:230781963-230781985 TTGTACTAGTATCTGGGAGAAGG - Intronic
924131107 1:240909354-240909376 TTGTTTCAGAAGATGGGGTATGG - Intronic
924273283 1:242357657-242357679 TTGTATTTGTAGTAGGGACAGGG + Intronic
1062840596 10:667179-667201 TTGTATTATTAGTAGGGATGGGG - Intronic
1063190176 10:3686310-3686332 TTGTATTATTAGTAGAGATAGGG + Intergenic
1065425902 10:25603379-25603401 TGGTATGAGCAGATGGGAAAAGG - Intergenic
1066687312 10:37993390-37993412 TTGTATTTGTAGTAGAGATAGGG + Intergenic
1067490161 10:46690797-46690819 TTGTATTATTAGAAGAGATGGGG - Intergenic
1067604504 10:47649579-47649601 TTGTATTATTAGAAGAGATGGGG + Intergenic
1068257788 10:54536445-54536467 TTTTATTAGTAGATCAAATAAGG + Intronic
1068992552 10:63164735-63164757 TTGTATTTTTAGTGGGGATAGGG - Intergenic
1069251224 10:66269751-66269773 ATGTATTAGTGGCTGGGTTATGG - Intronic
1069345094 10:67459345-67459367 TTGCATTAGTAGTGGGGATGGGG + Intronic
1070451966 10:76568177-76568199 TTGTATAAAAAGAAGGGATATGG - Intergenic
1071079063 10:81788350-81788372 TTGTTTCTGTAGAAGGGATATGG + Intergenic
1071620061 10:87111014-87111036 TTGTATTATTAGAAGAGATGGGG + Intronic
1072114020 10:92350927-92350949 TTCTACTAGGAGATGAGATAGGG - Intronic
1072233267 10:93431199-93431221 TTGTATTTTTAGTTGGGATGGGG + Intronic
1072599165 10:96908162-96908184 TTGTATTTGTAGTAGAGATAGGG + Intronic
1072820978 10:98557449-98557471 TTGTTTTATTGTATGGGATAAGG - Intronic
1073285831 10:102387492-102387514 TTGTATTATTAGTGGAGATAGGG - Intergenic
1073791025 10:106940709-106940731 TTGTATTTTTAGTTGAGATAGGG - Intronic
1076322243 10:129591755-129591777 TTGTATTTTTAGAAGAGATAGGG - Intronic
1081360714 11:42174556-42174578 TTGTATTCAGAGATGGGAAATGG - Intergenic
1083406360 11:62459965-62459987 TTGTATTATTAGTAGAGATAAGG - Intronic
1083794501 11:65007240-65007262 TTGTATTTTTAGAAGAGATAGGG - Intergenic
1084047754 11:66579893-66579915 TTGTATTTTTAGTAGGGATAGGG - Intergenic
1084391059 11:68877270-68877292 TTGTATTTGTAGTAGAGATAGGG - Intergenic
1084436867 11:69147986-69148008 TTGTATTATTAGTTGAGACAGGG + Intergenic
1084620759 11:70268993-70269015 TTGTATTTTTAGTAGGGATAGGG + Intergenic
1084847751 11:71913484-71913506 TTGTATTAGTAGTAGAGATGGGG - Intronic
1084972480 11:72779417-72779439 TTGTATTTGTAGTAGAGATAGGG - Intronic
1085222507 11:74887040-74887062 TTGTTTTTGTAGATGGTGTAAGG - Intronic
1085421765 11:76368371-76368393 TTGAATTAGTAAATGGGTTTGGG - Intronic
1086403327 11:86479048-86479070 TTGTATTAGTAAATTGAATAAGG + Intronic
1086540671 11:87906857-87906879 TTGTATTAGTAGGTGTAAAAAGG - Intergenic
1087080415 11:94165736-94165758 TTGTATGTGTAGAAGGGACAGGG - Intronic
1089501218 11:118932479-118932501 TTGTATTACTAGTTGTGATGGGG + Intronic
1090356653 11:126145152-126145174 TTGTATTTTTAGTAGGGATAGGG + Intergenic
1090445263 11:126759300-126759322 TTGTATTTTTAGTTGAGATAGGG + Intronic
1090595046 11:128311662-128311684 CTGTAAGAGTATATGGGATATGG - Intergenic
1091411061 12:239564-239586 TCGTGTTAGAAGATGGGCTATGG - Intronic
1091625339 12:2117096-2117118 TTGTATTATTAGCAGAGATAAGG - Intronic
1091924901 12:4337956-4337978 TTGTATTTGTAGTGGAGATAGGG - Intronic
1092379822 12:7986501-7986523 TTGTATTATTAGTAGAGATAGGG - Intergenic
1092669238 12:10843629-10843651 TTTTCTTAGTAGAAGGAATAGGG + Intronic
1093292149 12:17340257-17340279 TTGTATTAATATATGGTGTAAGG + Intergenic
1094562884 12:31572050-31572072 TTGTATTTTTAGTTGGGATGGGG - Intronic
1095895419 12:47275497-47275519 TTGTATTTTTAGTGGGGATAGGG + Intergenic
1097039733 12:56148559-56148581 TTGTATTGTTAGTAGGGATAAGG - Intergenic
1097549145 12:61045297-61045319 TTGGATTAATTGATGAGATATGG + Intergenic
1098270490 12:68765082-68765104 TTGTATTATTAGTTGAGACAGGG - Exonic
1098558337 12:71844458-71844480 TTTAATTAGTAGAGGGTATAGGG - Intronic
1098808835 12:75057879-75057901 TTGTATATGTACATTGGATAAGG - Intronic
1098910999 12:76208480-76208502 TTTTATTAGTAGACAGGATGAGG + Intergenic
1098936500 12:76485397-76485419 TTGTATTTGTAGTAGGGACAGGG - Intronic
1100496690 12:95131865-95131887 TTGTATTTTTAGTAGGGATATGG - Intronic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1103096236 12:118135136-118135158 GTGTATGAGAAGATGGGATCTGG + Intronic
1103626240 12:122222426-122222448 TTGTATTTGTAGTAGGGACAGGG - Intronic
1105363837 13:19746227-19746249 TTGTATTAGTAGTAGAGATGGGG - Intronic
1105560498 13:21485923-21485945 TTGTATTATTAGTAGAGATAGGG - Intergenic
1106180264 13:27363655-27363677 TTGTATTTTTAGAAGAGATAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106757214 13:32834868-32834890 TTGTAATAGGAGATGGAACATGG + Intergenic
1106988114 13:35380270-35380292 TTGTATTTGTAGTAGGGATAGGG - Intronic
1107687513 13:42918602-42918624 TCTTATTATTTGATGGGATATGG - Intronic
1110213403 13:72999894-72999916 TTGTATTTTTAGTAGGGATAGGG - Intronic
1110294900 13:73853039-73853061 TTGTATTATTAGTAGAGATAGGG + Intronic
1111718472 13:91911369-91911391 TTGTATTTTTAGTAGGGATAGGG - Intronic
1112014727 13:95322233-95322255 TTGTATTATTAGTAGGGATGGGG - Intergenic
1112350312 13:98627618-98627640 TTGTATTTGTAGTAGAGATAGGG + Intergenic
1112968522 13:105229926-105229948 TTGTATTTTTAGAAGAGATAGGG + Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1114259880 14:21028885-21028907 TGGCATTATTAGATGGGAAAAGG + Intronic
1114477139 14:23004080-23004102 TTGTATTTGTAGTAGAGATAGGG + Intronic
1116931851 14:50698585-50698607 TAGTTTTTGTAGATGGTATAAGG + Intergenic
1119452460 14:74723654-74723676 TTGTATTTTTAGAAGAGATAGGG - Intronic
1120076614 14:80166232-80166254 TTGTATTATTAGTTGTGATGGGG - Intergenic
1120240307 14:81942307-81942329 TGGTATTATTAGATTGGAAAGGG + Intergenic
1120590495 14:86368371-86368393 TTGAATTAGTAGAATGAATAAGG - Intergenic
1120620741 14:86761351-86761373 TTGTATTATTAGTGGAGATAGGG + Intergenic
1120679280 14:87460631-87460653 TTGTATTATTAGTTGAGACAGGG + Intergenic
1121132817 14:91464146-91464168 TTGTATTTGTAGTAGAGATAGGG - Intronic
1121246196 14:92462568-92462590 TTGTATTTGTAGTAGGGACAAGG + Intronic
1121295604 14:92819449-92819471 TTTTTTTAAGAGATGGGATATGG - Intronic
1122559021 14:102597992-102598014 TTGTATTTTTAGTAGGGATAGGG + Intronic
1122610874 14:102982594-102982616 TTGTATTAGTAGTAGAGACAGGG - Intronic
1124552206 15:30692221-30692243 TTGTATTTTTAGATGAGACAAGG + Intronic
1124679033 15:31713444-31713466 TTGTATTTTTAGATGAGACAAGG - Intronic
1124715707 15:32059174-32059196 TTGTATTATTAGTAGAGATAGGG + Intronic
1125090392 15:35784129-35784151 TTTTGTTAGTAAATGGGAGAGGG + Intergenic
1125114573 15:36074862-36074884 TTGTATTAGTGGATGTTAAAAGG - Intergenic
1125358745 15:38843851-38843873 TTGTATTTGTAGTAGAGATAGGG + Intergenic
1127007823 15:54590354-54590376 TTGTATTTGTAGATGGCTTTTGG + Intronic
1127787683 15:62370710-62370732 TTGTATTTTTAGAAGGGATGGGG - Intergenic
1127832430 15:62762627-62762649 TTGTAGTAGTATTTGGTATATGG - Intronic
1128574829 15:68766190-68766212 TTGTATTTTTAGAAGGGACAGGG + Intergenic
1129146869 15:73656316-73656338 TTGTATTATTAGTAGGGATGGGG + Intergenic
1129900868 15:79148557-79148579 TGGTATTAGGAGATGGGGTTTGG - Intergenic
1130217791 15:81988592-81988614 ATGTGTTAGTAGATTGGATATGG + Intergenic
1130265507 15:82398455-82398477 TTGTATTATTAGTAGAGATAGGG + Intergenic
1130357189 15:83144268-83144290 TTGTATCAGTAGTTGGTTTAGGG + Intronic
1130506504 15:84548431-84548453 TTGTATTATTAGTAGAGATAGGG - Intergenic
1130646503 15:85731908-85731930 TTGTATTTTTAGTAGGGATAGGG - Intronic
1130778247 15:87008147-87008169 TTGAATTAGTAGACTGGGTAAGG + Intronic
1131026969 15:89151489-89151511 GTGTATTAGTAAATGGGGAAAGG + Intronic
1131289732 15:91096925-91096947 TTCTATTTGTGCATGGGATAAGG - Intergenic
1133773803 16:8883006-8883028 TTGTATTTGTAGTTGAGATGGGG + Intergenic
1133815003 16:9190314-9190336 TTGTATTTGTAGTAGGGATGGGG + Intergenic
1134316398 16:13122872-13122894 TTGTATTTTTAGTTGGGATGAGG - Intronic
1134627401 16:15732133-15732155 TTGTATTTGTAGTAGAGATAGGG + Intronic
1134840325 16:17396695-17396717 TTGTATTTGTAGTAGAGATAGGG - Intronic
1134911387 16:18029852-18029874 TTGTATTTTTAGTAGGGATAGGG - Intergenic
1135341871 16:21655218-21655240 TTGTATTAGTAGGTGGCAAGTGG + Exonic
1137466605 16:48715444-48715466 TTGTACTAGGTGCTGGGATACGG + Intergenic
1138511517 16:57511186-57511208 TTGTATTTTTAGTTGGGACAGGG + Intergenic
1139091538 16:63654253-63654275 TTGTATTATTAGTAGGGACAGGG - Intergenic
1140642988 16:76998969-76998991 TTGTATTAGTAGTAGAGATGGGG - Intergenic
1140664936 16:77218751-77218773 TTGTATTTTTAGAAGAGATAGGG + Intergenic
1140800873 16:78487368-78487390 TTGTATTAGTAGATGGGATACGG - Intronic
1141038165 16:80646614-80646636 TTGTATTTGTAGTAGAGATAGGG - Intronic
1141055500 16:80810097-80810119 TTGCATTAGTAGGTGGTATCGGG + Intergenic
1143636925 17:8170198-8170220 TTGTATTTGTAGAAGAGACAGGG - Intergenic
1144070640 17:11668490-11668512 TTGTATTTGTAGTAGAGATAGGG - Intronic
1145096145 17:20028932-20028954 TTGTATTTTTAGAAGAGATAGGG + Intronic
1147231816 17:39025070-39025092 TTGTATTATTAGGAGAGATAAGG + Intergenic
1147707596 17:42437835-42437857 TTGTATTTTTAGTAGGGATAGGG + Intergenic
1148246765 17:46036882-46036904 TTGTATTTTTAGTAGGGATAGGG + Intronic
1148338477 17:46858100-46858122 TTGTATTTGTAGTAGAGATAAGG + Intronic
1148436304 17:47688609-47688631 TTGTATTAGTAGTAGAGATGGGG - Intergenic
1148620724 17:49032638-49032660 TAGTATTATTAGATTGGAGAAGG - Intronic
1148997001 17:51719430-51719452 TTGTATTAGATGCTGGGCTACGG - Intronic
1149031200 17:52084559-52084581 TTGAAGTAGTAGCTGAGATAGGG - Intronic
1149285467 17:55159070-55159092 TTGTATTATTAGTAGAGATAGGG - Intronic
1149489273 17:57070581-57070603 TTGTATTAGTAGTAGAGATGGGG - Intergenic
1151153702 17:72109664-72109686 TTGTATTTGTAGTAGGGATGGGG - Intergenic
1151311557 17:73295728-73295750 TTGTATTATTAGTTGAGATGGGG - Intronic
1151541265 17:74765722-74765744 TTGTATTTTTAGTAGGGATAGGG + Intronic
1151596395 17:75080419-75080441 TTGTATTTTTAGTAGGGATATGG - Intergenic
1153446105 18:5174566-5174588 TTGTATTTTTAGTAGGGATAGGG - Intronic
1155138501 18:23020246-23020268 TTGTATTATTAGTAGGGACAGGG - Intronic
1155803172 18:30134550-30134572 TTGTTTTAATAGATGGAATAAGG - Intergenic
1156224726 18:35093037-35093059 TTGTATTTGTAGAAGAGATGGGG - Intronic
1156984275 18:43330551-43330573 TTGCAGTAGTAGATGGGGTGAGG - Intergenic
1157236948 18:45973872-45973894 TTGTATTTTTAGTAGGGATAGGG - Intergenic
1157532872 18:48436760-48436782 TTGTATTTTTAGTTGAGATAGGG - Intergenic
1158212412 18:55066141-55066163 TTGTATTAGTAGTAGTGACAGGG - Intergenic
1158239481 18:55360897-55360919 TTGTATTTTTAGTTGAGATAGGG + Intronic
1158388836 18:57026478-57026500 AGGTATTAGTAGGTGGGAAATGG + Intronic
1159096512 18:63908224-63908246 TTGTACTAGAAAAAGGGATATGG + Intronic
1159325484 18:66910503-66910525 TTGGCTAAGTAGATGTGATATGG - Intergenic
1161491040 19:4561782-4561804 TTGTATTTTTAGTAGGGATAAGG + Intergenic
1161491069 19:4561917-4561939 TTGTATTTTTAGTAGGGATAAGG + Intergenic
1161491311 19:4563391-4563413 TTGTATTTTTAGTAGGGATAAGG + Intergenic
1161848396 19:6725504-6725526 TGGAATTAGACGATGGGATAGGG - Intronic
1162221345 19:9179365-9179387 TTGTATTTTTAGATGAGATGGGG - Intergenic
1162624142 19:11870427-11870449 TTGTATTTTTAGATGAGACAGGG - Intronic
1162921080 19:13903498-13903520 TTGTATTTTTAGTAGGGATAGGG - Intronic
1162963557 19:14143890-14143912 TTGTATTTTTAGAAGAGATAGGG - Intergenic
1163025199 19:14506892-14506914 TTGTATTTTTAGTAGGGATAGGG - Intergenic
1164026921 19:21360984-21361006 TTGTATTTTTAGAAGAGATAGGG + Intronic
1164290409 19:23863389-23863411 TTGTATTTGTAGCAGAGATAGGG - Intergenic
1165182490 19:33984586-33984608 TTGAATAAGTAGATGTAATATGG + Intergenic
1166964042 19:46516992-46517014 TTGTATTTTTAGTAGGGATAGGG - Intronic
1167013963 19:46827547-46827569 TTGTATTATTAGTAGGGACAGGG - Intergenic
1167083682 19:47294602-47294624 TTGTATTAGTAGTAGAGACAGGG + Intronic
1167350723 19:48972649-48972671 TTGTATTTGTAGTAGAGATAGGG + Intronic
1167392174 19:49202709-49202731 TTGTATTTGTAGTAGAGATAGGG + Intronic
1167931282 19:52867782-52867804 TTGTATTTGTAGTTGAGATGAGG + Intronic
1168022203 19:53617384-53617406 TTGTATTTGTAGTAGGGATGGGG - Intergenic
925699896 2:6625925-6625947 TTTTATTATTGGATTGGATAGGG + Intergenic
927748503 2:25644578-25644600 TTGTATTTTTAGTAGGGATAGGG - Intronic
928248572 2:29653887-29653909 TTGTATTTTTAGTAGGGATAGGG - Intronic
928627482 2:33155236-33155258 TTGTATTTTTAGAAGAGATACGG + Intronic
930388894 2:50735542-50735564 GTGTCTTAGGATATGGGATATGG - Intronic
930800812 2:55440786-55440808 TTGTATTTTTAGAAGCGATAGGG + Intergenic
930917284 2:56708710-56708732 TTGCATTAGTAAATTGGCTACGG + Intergenic
931330894 2:61282161-61282183 TTGTATTTTTAGTAGGGATAGGG + Intronic
931351260 2:61490980-61491002 TTGTATTTGTAGAAGAGATGGGG - Intronic
931922557 2:67037095-67037117 TTGTATTATTAGTTGAGATGGGG + Intergenic
932233022 2:70097995-70098017 TTGTATTTTTAGAAGAGATAGGG + Intergenic
932528720 2:72502373-72502395 TTGTATTTTTAGTGGGGATAAGG - Intronic
933649319 2:84837164-84837186 TTGTATTATTAGTAGAGATAGGG + Intronic
933756474 2:85643104-85643126 TTGTGTTAGTAAATAGGAAAAGG - Intronic
934696076 2:96401199-96401221 TTGTATTTGTAGTAGAGATAGGG + Intergenic
935446680 2:103164728-103164750 TTGGATTGGTAGATGGAGTAGGG + Intergenic
936549999 2:113428883-113428905 TTGTATTATTAGTAGGGACACGG + Intergenic
936801393 2:116271614-116271636 TTATACAAGTAGATGGAATATGG + Intergenic
936844346 2:116812783-116812805 TTGTATTTTTAGTAGGGATAGGG - Intergenic
937182568 2:120009859-120009881 TTGTATTTTTAGAAGAGATAGGG + Intergenic
937689326 2:124737116-124737138 TTGTATTTTTAGAAGAGATAGGG - Intronic
937748069 2:125439191-125439213 TTGTATTTTTAGATGAGACAGGG - Intergenic
941371775 2:164674231-164674253 TTGTATTTTTAGTTGAGATAGGG + Intronic
942363705 2:175199597-175199619 TTGTATTTGTAGTAGAGATAGGG - Intergenic
942410906 2:175708639-175708661 TAGTATGAGTAGTTGGTATAAGG - Intergenic
942652357 2:178182061-178182083 TTGTATTTTTAGTAGGGATAGGG + Intergenic
943083068 2:183279839-183279861 TTGTATTTTTAGTTGGGACAGGG + Intergenic
943507800 2:188783673-188783695 TTGTATTTTTAGTTGGGACAGGG + Intronic
943722241 2:191217263-191217285 ATGTACTAGTAGATGTGAAAGGG - Intergenic
943829094 2:192436025-192436047 TTGTGTCAGTAGATGGGACCTGG + Intergenic
945203235 2:207305880-207305902 TTGTGTCATTAGATGGCATAAGG - Intergenic
945762032 2:213925522-213925544 TTGTATTTTTAGTAGGGATATGG + Intronic
945854216 2:215048520-215048542 TTGTATTATTAGTAGAGATAGGG - Intronic
1169128806 20:3151930-3151952 TTGTATTTGTAGTAGAGATAGGG - Intronic
1170688405 20:18589176-18589198 TTGTATTTGTAGTAGAGATAGGG - Intronic
1170694047 20:18642029-18642051 TAGTTTTAGTATATGGTATAAGG + Intronic
1171208036 20:23296263-23296285 TTGTATTTTTAGTAGGGATAGGG - Intergenic
1171217042 20:23360040-23360062 TTGTATTATTAGCAGGGAAAGGG + Intergenic
1171564258 20:26163640-26163662 TTTTATGAGTAGCTGTGATATGG - Intergenic
1173811031 20:45955644-45955666 TTGTATTTTTAGTAGGGATAGGG - Intronic
1174614309 20:51824185-51824207 TTGTATTATTAGTAGAGATAGGG - Intergenic
1174618145 20:51852325-51852347 TTGTATTTTTAGTAGGGATAGGG + Intergenic
1174667983 20:52278158-52278180 TTGTATTTTTAGTTGAGATAAGG + Intergenic
1175350909 20:58317267-58317289 TTGTATTATTAGTTGAGATGGGG + Intronic
1177531346 21:22361810-22361832 GTGTTTTAGTAAATAGGATATGG + Intergenic
1178005757 21:28218238-28218260 TTGTATTAGTATTTGGGTTGGGG - Intergenic
1179170255 21:38967582-38967604 TTGTATTTGTAGTAGAGATAGGG + Intergenic
1179175643 21:39005958-39005980 ATGGATTAGTGGATGGGATGGGG + Intergenic
1181539079 22:23563685-23563707 TTGTATTTGTAGTAGAGATAGGG + Intergenic
1184107348 22:42375881-42375903 TTGTATTTTTAGTTGCGATAGGG + Intergenic
1184178665 22:42804686-42804708 TTGTATTTTTAGAAGGGATGGGG + Intronic
1184929495 22:47670498-47670520 TTGTATTTTTAGTAGGGATAGGG - Intergenic
949103057 3:169229-169251 TTGTATTTGTAGCAGGGATGGGG + Intergenic
949965485 3:9352444-9352466 TTGTATTATTAGTAGAGATAGGG + Intronic
950067005 3:10120365-10120387 TTGTATTAGTAGTAGAGATGGGG + Intronic
951027359 3:17844230-17844252 TTGTATTTGTAGCAGAGATAGGG + Intronic
951111707 3:18811695-18811717 TTGCATTACTAGCTGGGATTGGG - Intergenic
951438760 3:22697211-22697233 TTGTATTTTTAGTTGAGATAGGG + Intergenic
952363322 3:32652603-32652625 TTGTATTTGTAGTAGGGATGGGG + Intergenic
953461656 3:43086036-43086058 CTATATTAGTAAAAGGGATAGGG + Intronic
954888381 3:53898536-53898558 TTGTATTTTTAGAAGAGATAGGG - Intergenic
955128118 3:56135123-56135145 TTGTATTATTAGTAGAGATAGGG + Intronic
955344524 3:58151217-58151239 TTGTATTTTTAGAAGAGATAGGG - Intronic
957000853 3:74882894-74882916 TCTTATTAGTATATGGTATAAGG - Intergenic
958727957 3:97928998-97929020 TTATTTTAGTTGATGGGATGAGG + Intronic
958758641 3:98280111-98280133 TTGGACTAGTACATGGGAGACGG - Intergenic
960602689 3:119473500-119473522 TTGTATATGTAGCTAGGATAGGG - Intronic
961469125 3:127100531-127100553 TTCTGTTAGTAGATGGGAGTGGG + Intergenic
961572671 3:127811480-127811502 TTGTATTAATAGTTGGGACGAGG - Intronic
961695300 3:128700079-128700101 TTGTATTTGTAGTAGAGATAGGG + Intergenic
962718471 3:138149625-138149647 TTGTATTTTTAGTAGGGATAGGG - Intergenic
962720503 3:138169757-138169779 TTGTATTTGTAGTAGGGATGGGG - Intronic
962812856 3:138973996-138974018 TTGGATAAGTAGAGAGGATAGGG - Intergenic
963116230 3:141731694-141731716 TTGTATTATTAGTAGGGACAGGG - Intergenic
963133878 3:141882754-141882776 TTGTATTTTTAGCTGAGATAGGG + Intronic
963636389 3:147802487-147802509 TTGTATACATAGATGGGATATGG - Intergenic
963768586 3:149365214-149365236 TTGTATTTTTAGTTGAGATAGGG + Intergenic
964357737 3:155865824-155865846 TTGTATTTGTAGTAGAGATAGGG - Intergenic
964837032 3:160950452-160950474 TTGTATGTGTAGTTGGGGTATGG - Intronic
965047419 3:163597448-163597470 TTGTATTATTAGTAGGGATGGGG - Intergenic
965323320 3:167273181-167273203 TTGTAGCAGTAGATGGTCTAAGG + Intronic
965328404 3:167337343-167337365 TTGTATTTTTAGTAGGGATAGGG - Intronic
965608652 3:170521746-170521768 TTGTATTTGTAGTTGAGACAGGG - Intronic
966498355 3:180607061-180607083 TTGTGTCAGTAGACTGGATATGG - Intronic
966590844 3:181681074-181681096 TTGTATTTTTAGTAGGGATAGGG - Intergenic
967194024 3:187011169-187011191 TTGTATTTTTAGTAGGGATAGGG + Intronic
967424855 3:189315352-189315374 TTGTATTAATTGATGTGATATGG + Intronic
967518947 3:190405254-190405276 TTGTATTTTTAGTGGGGATAGGG - Intronic
967607412 3:191464214-191464236 TTGTATTTTTAGAAGAGATAGGG + Intergenic
968219279 3:196923053-196923075 TAGTATTAGAAAATGGTATAAGG - Intronic
968257739 3:197293055-197293077 TTTTTTGAGTAGACGGGATATGG - Intronic
968785438 4:2618765-2618787 TTGTATTTTTAGAAGGGACAAGG + Intronic
970822190 4:20230826-20230848 TTGTATTTGTAGTAGAGATAAGG - Intergenic
973312009 4:48719975-48719997 TTGTATTTTTAGTAGGGATAGGG - Intronic
973780613 4:54285066-54285088 TTGTATTATTAGTAGAGATAGGG + Intronic
974786045 4:66620549-66620571 TTGTATCAGTAGATTGAGTAAGG + Intergenic
974872781 4:67663468-67663490 TTGTAGCAGTAAATGTGATAAGG - Intronic
977044830 4:92056067-92056089 TTGTATTTTTAGTAGGGATAGGG - Intergenic
977727904 4:100319015-100319037 TTCTACTAATAGATGGGAGATGG + Intergenic
977837362 4:101661082-101661104 TTTTATTAGTTAATGGGAGAAGG + Intronic
977932633 4:102765154-102765176 GCGTATTAGTAGATGGAACACGG + Intergenic
978393975 4:108258386-108258408 ATGTATTGGGAGATGGAATATGG - Intergenic
978759717 4:112343664-112343686 TTGTGTTTGGAGATGGGATCAGG - Intronic
978881223 4:113705141-113705163 TTGTATTTGTAGTAGAGATAGGG - Intronic
980210281 4:129778789-129778811 TGGTATTGGTATATGGTATATGG - Intergenic
980540622 4:134189057-134189079 CATTATTAGTAGATTGGATAAGG - Intergenic
980912627 4:139007465-139007487 TTGTATTTGTAGTAGAGATAGGG + Intergenic
981668930 4:147262721-147262743 TTGTATTTGTAGAAGAGATGGGG - Intergenic
982425813 4:155258145-155258167 TTGTATTTTTAGAAGAGATAGGG - Intergenic
982692217 4:158561798-158561820 TTGTATTATTAGTAGGGACAGGG + Intronic
983400905 4:167264323-167264345 TTGTATTTTTAGAAGGGATGGGG + Intergenic
983528533 4:168785389-168785411 TTGTATTTGTAGAGAAGATAAGG - Intronic
986535375 5:8781277-8781299 TTCTATTAATAGATTGGAAATGG - Intergenic
987317478 5:16737428-16737450 TCGTGTTAGGAGATGGGAAATGG - Intronic
987550627 5:19375537-19375559 ATGTATTAGTAAAAGTGATAGGG + Intergenic
989078600 5:37591158-37591180 TTGTATTTTTAGAAGAGATAGGG - Intronic
990755597 5:59066061-59066083 TTCTTTTAGTAGAAGGAATAAGG - Intronic
992401569 5:76416698-76416720 TTGTATTACTAGTAGGGACAGGG + Intronic
993721996 5:91330855-91330877 TTGTATTTTTAGTAGGGATAGGG + Intergenic
993879893 5:93349613-93349635 TCATATTAGTAGATGGGTTTGGG + Intergenic
993977946 5:94505184-94505206 TTGTATTTGTAGTAGAGATAGGG - Intronic
994079761 5:95695423-95695445 TTGTATTTGTAGTAGAGATAGGG - Intronic
994157447 5:96519777-96519799 TTGTATTTGTAGAAGGGATGGGG + Intergenic
995104171 5:108354365-108354387 ATACATTAGTAGATGGGACATGG + Intronic
995799044 5:115973100-115973122 TTGTATTTTTAGTAGGGATAGGG + Intronic
995867876 5:116711076-116711098 TTGTATTTGTAGTAGAGATAGGG + Intergenic
996444615 5:123531776-123531798 TTTTAGTAGTAGATGGATTAAGG + Intronic
996693989 5:126372674-126372696 TTGTATTAGTAGTTGAGCAAGGG + Intronic
996729685 5:126705108-126705130 TTGTATTTTTAGTAGGGATAGGG + Intergenic
996741455 5:126803010-126803032 TTGTATTTGTAGTAGAGATAGGG - Intronic
996850154 5:127942616-127942638 TTGTATTGAGAGATGGGAAATGG + Intergenic
997697933 5:135875937-135875959 TAGTATAAGAAGATGTGATACGG + Intronic
998006417 5:138659871-138659893 TTGGATAAGTAGATGAGAAAAGG - Intronic
998146264 5:139730575-139730597 TTGAAGTAGGAGATGGGACAGGG + Intergenic
998275652 5:140750688-140750710 TTGTATTTTTAGTAGGGATAGGG + Intergenic
998776723 5:145611490-145611512 TTCTATTAGTTGCTGGGTTATGG - Intronic
999799262 5:155018114-155018136 TTTTAACAGTAGATGGGCTAAGG - Exonic
1000326876 5:160178986-160179008 TTGTATTTGTAGTAGAGATAGGG + Intergenic
1000334656 5:160233152-160233174 TTGTATTTTTAGCTGAGATAGGG + Intronic
1003539927 6:7009722-7009744 TTGTATTTTTAGCAGGGATAGGG - Intergenic
1003703820 6:8500924-8500946 TTGTATTTTTAGAAGAGATAGGG - Intergenic
1003798981 6:9640709-9640731 TTGTATTTTTAGAAGAGATAGGG + Intronic
1004584522 6:16986794-16986816 TTGTATTTGAAGATGGGTTGGGG + Intergenic
1005229222 6:23681027-23681049 TTGTATTTGTAGTAGAGATAGGG + Intergenic
1005287651 6:24346004-24346026 TTGTATTATTAGTTGAGATGGGG - Intronic
1006231063 6:32587206-32587228 TTGTATTTTTAGTAGGGATAGGG - Intronic
1006851862 6:37104237-37104259 TTGTATTTTTAGCTGAGATAGGG + Intergenic
1006882219 6:37350405-37350427 TTGTATTTTTAGTAGGGATAGGG - Intergenic
1008112566 6:47508715-47508737 TTGTATTTGTAGTAGAGATAAGG + Intronic
1008517795 6:52334574-52334596 TTGTACAAATTGATGGGATATGG + Intergenic
1008699505 6:54081583-54081605 TTGTATTTTTAGTTGAGATACGG + Intronic
1009424612 6:63500591-63500613 TTGTATTTTTAGTAGGGATAGGG + Intergenic
1010133985 6:72528582-72528604 TTGTATTTTTAGTAGGGATAGGG - Intergenic
1010208300 6:73342501-73342523 TTGTATTGGCAGATTGGATGAGG - Intergenic
1010469061 6:76204219-76204241 TTGTATTTGTATATGGGCAATGG - Intergenic
1011491621 6:87899072-87899094 TTGTATTATTAGAAGAGACAGGG + Intergenic
1011968117 6:93186021-93186043 TTGTATTAGGAGATGGGCCTTGG + Intergenic
1012008712 6:93752410-93752432 TTTTATTATTAAATGGGAAAGGG + Intergenic
1012536388 6:100302989-100303011 TTGTTTTTGTATATGGTATAAGG - Intergenic
1012841000 6:104328979-104329001 TTATATTTGTAGATGGGGTGGGG - Intergenic
1013106679 6:107031771-107031793 TTGTATTAGTAGTAGAGACAGGG + Intronic
1015630911 6:135231007-135231029 TTGTTTTTGTAGATGGGGTGGGG - Intergenic
1016830807 6:148431369-148431391 TTGTATTTTTAGAAGAGATAGGG + Intronic
1016966770 6:149725284-149725306 TTGTATTAGTAGAGACGACAGGG - Exonic
1017276419 6:152574308-152574330 TTGTTTTCGTAGATGAGATCTGG + Intronic
1017511215 6:155115937-155115959 TTGTATTTGTAGTAGAGATAGGG - Intronic
1018522022 6:164659903-164659925 TTTTATTATTAGATTGGATATGG - Intergenic
1019512562 7:1425316-1425338 TTGTATTGGTAGTTGAGACAGGG + Intergenic
1020123810 7:5521205-5521227 TTGTATTTGTAGTAGGGACAGGG + Intergenic
1021152903 7:17173843-17173865 TTATTTTAGTAGATAGGAAATGG + Intergenic
1021549541 7:21855203-21855225 TTGTATTTTTAGAAGGGATGGGG + Intronic
1022162365 7:27724633-27724655 TTGTATTATTAGTAGAGATAAGG + Intergenic
1023182309 7:37497116-37497138 TTGTATTTGTAGCAGAGATAGGG - Intergenic
1023754586 7:43404800-43404822 TTGTATTTTTAGTAGGGATAGGG - Intronic
1024542444 7:50489177-50489199 TTGTATTTGTAGTAGAGATAAGG + Intronic
1025273473 7:57550576-57550598 TTTTATGAGTAGCTGTGATATGG + Intergenic
1026034828 7:66823511-66823533 TTGTATTTTTAGCTGAGATAGGG - Intergenic
1026289792 7:68996291-68996313 TTGTATTTGTAGTAGAGATAGGG + Intergenic
1027147324 7:75704937-75704959 ATGTATTAAAACATGGGATAAGG - Intronic
1027551668 7:79605304-79605326 TTGTATTTTTAGTTGAGATAGGG + Intergenic
1027720793 7:81739160-81739182 TTATACTAGGAAATGGGATAGGG - Intronic
1028145720 7:87318029-87318051 TTATATTTGTAGATGTAATATGG + Intergenic
1028739074 7:94251238-94251260 TGGAATAAGTAGATGAGATAAGG - Intergenic
1029588927 7:101494297-101494319 TTGTATTTTTAGTAGGGATAGGG + Intronic
1029672252 7:102041424-102041446 TTGTATTATTAGAAGAGATGGGG + Intronic
1030271840 7:107676999-107677021 TTGTATTATTAGTAGGGACAAGG - Intronic
1031185558 7:118475274-118475296 TTGTAAGATGAGATGGGATAAGG + Intergenic
1031943753 7:127816833-127816855 TTGTATTTTTAGTAGGGATAGGG + Intronic
1032823693 7:135548734-135548756 TTGTATTTTTAGTAGGGATAGGG - Intergenic
1033300521 7:140180461-140180483 TTGTATTTTTAGAAGGGACAGGG - Intergenic
1033342017 7:140499504-140499526 TTGTATTTGTAGTAGGGATGGGG + Intergenic
1035838637 8:2786658-2786680 TTGTATTTTTAGAAGAGATAAGG - Intergenic
1036133914 8:6141267-6141289 TTGTCTTAGGAAAAGGGATATGG + Intergenic
1038027412 8:23604116-23604138 TTGTTTCAGTATATGGTATAAGG - Intergenic
1038178334 8:25202188-25202210 TTGTATTTTTAGAAGAGATAGGG + Intronic
1038546836 8:28432299-28432321 TTGTATTTTTAGTAGGGATAGGG - Intronic
1038634977 8:29278776-29278798 TTGTATTTTTAGAAGAGATAGGG - Intergenic
1039043512 8:33429821-33429843 TTGTATTTTTAGTAGGGATAGGG - Intronic
1040830312 8:51668668-51668690 TTGTGTATGTAAATGGGATATGG - Intronic
1041065489 8:54078786-54078808 TTGTCTTAGCAGATGGTAGAAGG - Intronic
1041372153 8:57172942-57172964 TTGTATTATTAGTAGAGATAAGG + Intergenic
1041546553 8:59050626-59050648 TTGTATTAGTACAAGGAATTAGG - Intronic
1042841064 8:73124347-73124369 TTGTGTTAGTGGATGGGGAAAGG - Intergenic
1043068220 8:75603612-75603634 TTGTATTTTTAGTAGGGATAGGG + Intergenic
1043959868 8:86405215-86405237 TTGTTTTTGGAGATGGGATAGGG + Intronic
1044017050 8:87057674-87057696 TTGTATTATTAGTAGGGACAGGG - Intronic
1044521840 8:93207595-93207617 TTGTATTAATATATGGTGTAAGG - Intergenic
1045105994 8:98893214-98893236 TTGTATTTTTAGTAGGGATAGGG - Intronic
1045316716 8:101049653-101049675 TTGTATTTTCAGAAGGGATAGGG + Intergenic
1045627256 8:104069078-104069100 TTGTATTAGTACTTGATATATGG - Intronic
1046062633 8:109157461-109157483 TTGTATTTTTAGATGAGATGGGG - Intergenic
1046313943 8:112476216-112476238 TTGTATTATTAGTAGGGATGGGG + Intronic
1046809915 8:118522005-118522027 TTGTATTACCATATAGGATAGGG - Intronic
1046949865 8:120009438-120009460 TTGTATTTTTAGTAGGGATAGGG - Intronic
1047348653 8:124052610-124052632 TTGTATTTTTAGTAGGGATAGGG - Intronic
1048106285 8:131413792-131413814 TTGTATGAGTTGCTAGGATAGGG - Intergenic
1048239795 8:132730128-132730150 TTGTATTTTTAGTTGAGATAGGG + Intronic
1048949199 8:139479937-139479959 CTGTCTTAGTAGATGTGATGTGG - Intergenic
1049902946 9:187945-187967 TTGTATTATTAGTAGGGACACGG - Intergenic
1050171330 9:2821268-2821290 TTGTATTAGTAGTAGAGATGGGG - Intronic
1050533838 9:6613947-6613969 TTGTATTTTTAGTTGAGATAGGG + Intronic
1050548534 9:6729365-6729387 TTGTATTTTTAGTAGGGATAGGG - Intronic
1050844277 9:10194600-10194622 TTCTATTAGCATATGTGATATGG - Intronic
1051242248 9:15070971-15070993 GTGTATTTGTAGAAGAGATAAGG - Intergenic
1051928449 9:22356834-22356856 TTGTTTTAGTAAAGGGGAAAAGG + Intergenic
1052591911 9:30508162-30508184 TTGTATTTGTAGAAGGTATGAGG - Intergenic
1053250237 9:36568131-36568153 TTGTATTTTTAGTAGGGATAGGG - Intergenic
1053745965 9:41198227-41198249 TTGTATTATTAGTAGGGACACGG - Intronic
1054481305 9:65666991-65667013 TTGTATTATTAGTAGGGACACGG + Intergenic
1054682378 9:68233053-68233075 TTGTATTATTAGTAGGGACACGG + Intronic
1055628523 9:78199199-78199221 TTGTATTTGTAGTAGAGATAGGG + Intergenic
1056210818 9:84363587-84363609 TTTCACTAGTAGATGGGATTAGG + Intergenic
1056499087 9:87190292-87190314 TTGTATTCTTAGTAGGGATAGGG - Intergenic
1056781160 9:89552381-89552403 TTGTATTTTTAGAAGAGATAGGG + Intergenic
1058007209 9:99930083-99930105 TTGTATTTTTAGTTGAGATAGGG + Intronic
1058571751 9:106353646-106353668 TTGTATTTTTAGTAGGGATAGGG + Intergenic
1058672525 9:107372033-107372055 TTGTATTTTTAGTAGGGATAGGG - Intergenic
1059146884 9:111907799-111907821 TTGTATTTTTAGAAGAGATAGGG + Intronic
1059407651 9:114111762-114111784 TTGTATTTTTAGTAGGGATAGGG + Intergenic
1059845128 9:118267097-118267119 TAGTTTTATTAGATGGGACAGGG + Intergenic
1061131683 9:128712080-128712102 TTGTATTTTTAGTTGGGATGGGG + Intronic
1061172932 9:128971942-128971964 TTGTATTTGTAGTAGGGATGGGG + Intronic
1062659914 9:137624632-137624654 TTGTATTTTTAGTTGGGATGGGG + Intronic
1202782097 9_KI270718v1_random:9000-9022 TTGTATTATTAGTAGGGACACGG - Intergenic
1185488855 X:504016-504038 TTGTATTTTTAGTTGAGATAGGG + Intergenic
1185583926 X:1231177-1231199 TTGTATTATTAGTAGAGATAGGG - Intergenic
1185645301 X:1611280-1611302 TTGTATTTGTAGAAGAGATGGGG + Intergenic
1185670581 X:1806369-1806391 TTGTATTTGTAGTAGAGATAGGG - Intergenic
1185821092 X:3205249-3205271 TTGTATTACTATGTGTGATAAGG - Intergenic
1187418688 X:19115779-19115801 TTGTATTTTTAGTAGGGATAGGG - Intronic
1187795886 X:23003901-23003923 TTGTATTTGTAGTAGGGACAGGG - Intergenic
1188561651 X:31475085-31475107 TGGTAATAGTAGATGTGATTGGG - Intronic
1188678148 X:32968647-32968669 TAGTATTAGGAGATGGGTTTGGG + Intronic
1189281591 X:39822890-39822912 TTGTATTTGTAGTAGAGATAGGG + Intergenic
1189808121 X:44755227-44755249 TTGTATTTTTAGTAGGGATAGGG + Intergenic
1189836545 X:45029260-45029282 TTGTATTTTTAGTAGGGATAGGG - Intronic
1189844960 X:45127485-45127507 TTGTATTTTTAGTTGAGATAGGG + Intergenic
1190181942 X:48199709-48199731 TTGTATTAGTAGTAGAGATGGGG + Intronic
1190186862 X:48242942-48242964 TTGTATTAGTAGTAGAGATGGGG - Intronic
1190195089 X:48310426-48310448 TTGTATTAGTAGCAGAGATGGGG + Intergenic
1194476293 X:94363660-94363682 TTGTTTTATTAAATGGGAAATGG - Intergenic
1195737914 X:108032817-108032839 TTGGATAAGTTGATGGCATATGG - Intergenic
1195934174 X:110109343-110109365 TTGTATTATTAGTAGAGATAGGG - Intronic
1196837112 X:119823734-119823756 TTGTATTTTTAGTTGGGACAGGG + Intergenic
1197074075 X:122334872-122334894 TTGGATTAATAGATGGGAGATGG - Intergenic
1197516546 X:127438789-127438811 ATGTATTATTACATGAGATAGGG + Intergenic
1197609764 X:128624600-128624622 TTGTATTTTTAGTAGGGATAGGG + Intergenic
1197719310 X:129734189-129734211 TTGTATTTTTAGTTGAGATAGGG - Intergenic
1197947908 X:131860482-131860504 TTGAATCAGTAGATTGAATAAGG - Intergenic
1199164567 X:144656324-144656346 TTGTATTTTTAGAAGGGATGGGG - Intergenic
1199180151 X:144844811-144844833 TTGTATTTGTAGAAGAGATGTGG - Intergenic
1199834586 X:151576038-151576060 TTGTATTTTTAGAAGGGATAGGG + Intronic
1201257889 Y:12127459-12127481 CTGTATTAATATATGTGATAAGG + Intergenic