ID: 1140801227

View in Genome Browser
Species Human (GRCh38)
Location 16:78490257-78490279
Sequence CACTTCCAAAAGGCTTCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140801227_1140801229 26 Left 1140801227 16:78490257-78490279 CCAACGGAAGCCTTTTGGAAGTG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1140801229 16:78490306-78490328 CTCAGCGTTTAGTAACTTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140801227 Original CRISPR CACTTCCAAAAGGCTTCCGT TGG (reversed) Intronic
906274068 1:44503366-44503388 CACCTCCAAAATGCTTTCCTTGG - Intronic
907902687 1:58755481-58755503 CACATGGAAAAGGCTTCCGGTGG + Intergenic
910190198 1:84587165-84587187 CACTTCGAAATGGCTTTTGTTGG + Intergenic
911134608 1:94426166-94426188 CAATTGAAAAAGGCTTCCTTTGG - Intronic
920853431 1:209644925-209644947 CAGTTCCCAGAGGCTTCTGTGGG + Intronic
922754398 1:228087149-228087171 CATTTCCAAAGGGCTTCCAGTGG + Intronic
1068842668 10:61632601-61632623 CTCTTCCAAAAGCCTTCATTTGG + Intergenic
1069441625 10:68433972-68433994 CTCTTCGAAAAGGCTTCCCTTGG + Intronic
1072541248 10:96399501-96399523 CAATTCCAAAAGGCTACAGGTGG - Intronic
1076258874 10:129050257-129050279 CATTTGCAAAAGGTTTCTGTGGG + Intergenic
1078434195 11:11311037-11311059 CACCTCCAAAAGGCCTCTGGAGG - Intronic
1078938704 11:15976585-15976607 CAATTCCAAATGGCTTCTGTGGG - Intronic
1081081987 11:38752884-38752906 CCCTTCCAAAAGGCTCCCATTGG + Intergenic
1084591734 11:70094323-70094345 CACATCCACAAGGCCTCCATGGG - Intronic
1086097892 11:83068865-83068887 CATTTCCAAAAGGGTTGGGTAGG - Intronic
1087307215 11:96501470-96501492 CACTTCAAACAGGCTTCCGGTGG - Intronic
1093911019 12:24747630-24747652 CATTTCCAAAAGGCTGCCTGCGG + Intergenic
1094453228 12:30604061-30604083 CAGTTCCGTAAGGCTTCCCTTGG - Intergenic
1103101036 12:118176094-118176116 CAGTTAGAAAAGGCTTCCTTAGG + Intronic
1108631875 13:52292257-52292279 AACTTCCTGAAGGCTTCAGTAGG - Intergenic
1110164741 13:72426949-72426971 CACTGCCAGAAGTCTTCCTTAGG + Intergenic
1111634344 13:90884259-90884281 AACTTGCCAAGGGCTTCCGTTGG + Intergenic
1118078138 14:62325435-62325457 CACTTCTAAGAGTCTTCCGGTGG + Intergenic
1126749255 15:51859997-51860019 CACTTCCACATGGCCTCCCTTGG + Intronic
1130800336 15:87256017-87256039 CACTTCCAAATAGCATCCCTGGG + Intergenic
1131667322 15:94584491-94584513 CATTTTCAAAATGCTTCCCTAGG - Intergenic
1140801227 16:78490257-78490279 CACTTCCAAAAGGCTTCCGTTGG - Intronic
1141909784 16:87050802-87050824 CTCTTCCAAAAGGCCCCTGTGGG - Intergenic
1141923186 16:87150073-87150095 CACTTACAAACTGCTTCTGTGGG - Intronic
1146125510 17:30228280-30228302 TACTTCCTAAAGGCTGTCGTGGG + Intronic
1148217421 17:45840614-45840636 CACTCACAGAAGGCTTTCGTGGG - Intergenic
1159228477 18:65572809-65572831 GACTTCCAAAAGACTTCCCTTGG - Intergenic
1165745439 19:38227883-38227905 CCCTTCCAAAAGGTCTCTGTGGG - Intronic
935127820 2:100239702-100239724 CACTTCAAACAGGCCTCCCTGGG - Intergenic
935615927 2:105081991-105082013 CACTACAAAAACGCTTCTGTAGG - Intronic
936253844 2:110891897-110891919 CATTTCAAAAAGGCTTCGGGAGG - Intronic
937509958 2:122584052-122584074 CACTTGCAAAAGAATTCAGTTGG + Intergenic
946555440 2:220851701-220851723 CACTTCCAAAAACATGCCGTTGG + Intergenic
946897909 2:224343555-224343577 CACAAACAACAGGCTTCCGTAGG - Intergenic
948082442 2:235217457-235217479 AACTTCAAAAAGGCTTTCTTGGG - Intergenic
1169590904 20:7141177-7141199 CAATACCAAAATGCTTCCCTTGG + Intergenic
1173752036 20:45484840-45484862 CACTGAGATAAGGCTTCCGTGGG - Intergenic
1175431027 20:58903200-58903222 CACTTCCTAAAGGCTTCTCCTGG - Intronic
1175961998 20:62642100-62642122 CCCTTCCGAAAGGCTGCCGCAGG - Exonic
1176990952 21:15495860-15495882 CACTTCCCATTGGCTTCCATCGG + Intergenic
1184422652 22:44390863-44390885 CACTTTCAAATGGCTTCTGGGGG - Intergenic
953002339 3:38947484-38947506 CATTTCCAAATGCCTTCTGTAGG - Intronic
953089591 3:39711339-39711361 CACTTCCAAAATGTTAACGTAGG + Intergenic
956310554 3:67874708-67874730 CACTTACAAAGGGCTTCTTTGGG + Intergenic
959947745 3:112144826-112144848 CTCTACCAAAAGGCTTCTGGAGG - Intronic
960194270 3:114746139-114746161 GTCTTCCCAAAGGCTTCAGTAGG - Intronic
961987799 3:131156467-131156489 CACTTCTAAAAGTCTTCAGAGGG - Intronic
964918554 3:161867290-161867312 AACTTCCAAAAGGCTTGCAAAGG + Intergenic
974076074 4:57169765-57169787 CCCTTCCCAAAGGCTGCCATTGG + Intergenic
975189741 4:71446404-71446426 GACTTCCATAAGTCTTCCATAGG - Intronic
977792868 4:101128666-101128688 CAGTTCCTCAAGGCTTCCCTTGG - Intronic
980070742 4:128240932-128240954 TAGTTCCACAAGGCTTCTGTGGG - Intergenic
983602817 4:169549180-169549202 CAGTTCCTAATGGCTTCCCTTGG + Intronic
990974646 5:61548770-61548792 CACTTCCCTCAGGCATCCGTGGG - Intergenic
1008000849 6:46358323-46358345 CACTTCCCCAGGGCTTCCCTGGG + Intronic
1012777927 6:103521780-103521802 CAGTCCCTAAAGGCTTCCCTTGG - Intergenic
1013294770 6:108749323-108749345 CACCACCAAAAGGCATCCTTTGG - Intergenic
1013889116 6:115005002-115005024 CACTGCCAAGAGGATTCTGTGGG - Intergenic
1014637155 6:123861479-123861501 CACTTCCAAATGTCTTCCAATGG - Intronic
1024974427 7:55100277-55100299 CACTTCACAAAGGCCTCCTTGGG + Intronic
1025978549 7:66388948-66388970 CACTTCAAAGAGGCTGCGGTGGG + Intronic
1026140057 7:67698174-67698196 CCCTTCCCCATGGCTTCCGTAGG - Intergenic
1029890435 7:103923778-103923800 TACTTCCAAAAGGCTTTAGATGG + Intronic
1030189467 7:106795966-106795988 CCCTTCCCAAAGGCTACCTTTGG - Intergenic
1031391241 7:121217502-121217524 CATTTCCTAAAGGCATCTGTTGG + Intronic
1036038829 8:5051160-5051182 CACCTACAAAAGGCTTCAGAGGG - Intergenic
1036870440 8:12431684-12431706 AACTTCCAACAGGGGTCCGTGGG + Intronic
1047462591 8:125081618-125081640 CACTTCCGAAACGCTGCTGTCGG - Intronic
1062422633 9:136490750-136490772 CACTTGCAAAGGGTGTCCGTGGG - Intergenic
1185745156 X:2566817-2566839 CAGTTCCAATGGGCTTCCCTTGG + Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1192934015 X:75839470-75839492 CAGTTCCTTAAGGCTTCCCTTGG + Intergenic
1200672389 Y:6110334-6110356 CACTTCCACACTGCTTCGGTGGG + Intergenic