ID: 1140801481

View in Genome Browser
Species Human (GRCh38)
Location 16:78492180-78492202
Sequence GTGCACACACTGTCACCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140801481_1140801486 16 Left 1140801481 16:78492180-78492202 CCATTAGGTGACAGTGTGTGCAC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1140801486 16:78492219-78492241 AGCGGGAAACCTGAGCCACAAGG 0: 1
1: 0
2: 1
3: 15
4: 134
1140801481_1140801485 -1 Left 1140801481 16:78492180-78492202 CCATTAGGTGACAGTGTGTGCAC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1140801485 16:78492202-78492224 CAGTTTATGGAGGATGAAGCGGG 0: 1
1: 0
2: 5
3: 28
4: 378
1140801481_1140801488 25 Left 1140801481 16:78492180-78492202 CCATTAGGTGACAGTGTGTGCAC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1140801488 16:78492228-78492250 CCTGAGCCACAAGGCAGTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 206
1140801481_1140801484 -2 Left 1140801481 16:78492180-78492202 CCATTAGGTGACAGTGTGTGCAC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1140801484 16:78492201-78492223 ACAGTTTATGGAGGATGAAGCGG 0: 1
1: 0
2: 0
3: 25
4: 267
1140801481_1140801489 29 Left 1140801481 16:78492180-78492202 CCATTAGGTGACAGTGTGTGCAC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1140801489 16:78492232-78492254 AGCCACAAGGCAGTAGAGGTTGG 0: 1
1: 0
2: 0
3: 16
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140801481 Original CRISPR GTGCACACACTGTCACCTAA TGG (reversed) Intronic
902638710 1:17752085-17752107 GAACACACAATGTCTCCTAAGGG + Intergenic
904556309 1:31367077-31367099 GTGCATACACTGTCTCTTACAGG + Intronic
907590791 1:55668954-55668976 GGGGCCACACTGTCCCCTAAGGG - Intergenic
911365780 1:96935825-96935847 GTAAACACATTCTCACCTAAGGG - Intergenic
916691885 1:167197895-167197917 GAACACTCACTGTCATCTAAAGG - Intergenic
916894870 1:169151685-169151707 GTGCACACATTCTTACCCAAGGG - Intronic
917983396 1:180289481-180289503 GTGTACACTCTGACATCTAAAGG - Intronic
918240602 1:182616831-182616853 GAGCACACACTGCCTCCTAAGGG + Intergenic
922457090 1:225783655-225783677 GTTCAAACACTGTCATTTAAAGG - Intronic
923868365 1:237964164-237964186 GTCCAGACACTGTTACCAAACGG + Intergenic
1065876567 10:30002120-30002142 GTTCCTACACTGTCTCCTAAGGG + Intergenic
1070529967 10:77328014-77328036 GTGCACACAACGTGACCTCAAGG + Intronic
1070952868 10:80444857-80444879 GTGCATACACTGCCACCTAGAGG - Intergenic
1071312074 10:84352427-84352449 GAGGAGACACTGCCACCTAATGG - Intronic
1074339775 10:112616325-112616347 GTGCACACACTCACACACAATGG + Intronic
1074736893 10:116444707-116444729 GTAGACACACTGCCACCTAGTGG - Intronic
1079639599 11:22788457-22788479 GTGCTTACACTGGCATCTAATGG - Intronic
1085193581 11:74650902-74650924 GTGCACACACAGGCAGCTGAGGG + Intronic
1088221380 11:107573722-107573744 GAGCACACACTGTAACCAACTGG - Intergenic
1092071479 12:5634877-5634899 GGGCACTCACTATCCCCTAAGGG - Intronic
1093392765 12:18642594-18642616 CTGCAAACACTGTCACCTCGTGG + Intronic
1093844038 12:23945733-23945755 GTTCACATTCTGTCACCTAATGG - Intronic
1099179789 12:79463530-79463552 GTGCACCCACTGTGACATTAGGG - Intergenic
1099534026 12:83823765-83823787 GTTCACACACTGCCGCCTATCGG - Intergenic
1112706148 13:102071176-102071198 GTGCACACACTTGCTTCTAAGGG - Intronic
1113803920 13:113102526-113102548 GTGCACACACTGTCAGCCATTGG + Intergenic
1114870303 14:26647426-26647448 ATGCACATACTTTCATCTAATGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG + Intronic
1124859003 15:33419614-33419636 GTGCTCACACTGTCAAATAAAGG - Intronic
1131883651 15:96886033-96886055 GTGCACAGATTATTACCTAAGGG + Intergenic
1132949286 16:2551541-2551563 GAGCACACACTGCCATTTAAAGG + Intronic
1132965302 16:2650587-2650609 GAGCACACACTGCCATTTAAAGG - Intergenic
1133079818 16:3309724-3309746 GTTCTCACTCTGTCACCCAAGGG - Intronic
1140298748 16:73735834-73735856 TTGCACAGAATGTCACCTATGGG - Intergenic
1140801481 16:78492180-78492202 GTGCACACACTGTCACCTAATGG - Intronic
1143701523 17:8664226-8664248 GTGGAGATACTGTCAGCTAAAGG - Intergenic
1144363650 17:14520930-14520952 CTCCACACACTGGGACCTAATGG - Intergenic
1144426732 17:15150126-15150148 TTGGTCACACTCTCACCTAAGGG + Intergenic
1145822460 17:27849859-27849881 GTGCACACACCATCACCTGGGGG - Intronic
1147723084 17:42550528-42550550 GTACACACACTGTCACAGAGGGG - Exonic
1147724296 17:42556754-42556776 GTACACACACTGTCACAGAGGGG - Intergenic
1148504666 17:48117869-48117891 GTGCACACAGTGGCACGTACCGG + Intronic
1151767684 17:76140602-76140624 GTACACACACTGTCCCCTCGGGG - Intronic
1151842767 17:76629421-76629443 GTGAACACACTGTCACCCAGAGG - Exonic
1152009647 17:77704320-77704342 GTACACACACAGTCAACAAATGG - Intergenic
1153938803 18:9958026-9958048 GTGCACACACTGTGTCAGAAGGG - Intronic
1164578577 19:29420271-29420293 GTGCACACACATACACATAACGG + Intergenic
1167713149 19:51124643-51124665 CTGCAGAAAATGTCACCTAAGGG + Intergenic
925351855 2:3206522-3206544 CGGCACATCCTGTCACCTAATGG - Intronic
926419744 2:12685113-12685135 ATGCAGACTCTATCACCTAATGG + Intergenic
929411210 2:41698979-41699001 GTGCTCACACTGCCACCTGCTGG + Intergenic
931390441 2:61838369-61838391 GTGCACACACACTCACCTCATGG - Intronic
932017473 2:68046608-68046630 GTCCACACATTTTCACCTTAGGG + Intronic
933113426 2:78434139-78434161 GTCGACACACTTTCAACTAATGG - Intergenic
944912653 2:204325576-204325598 ATGCACACACTGCCCCCTAGGGG - Intergenic
946239111 2:218343264-218343286 TTGCACACAGTGACACCTGAAGG - Intronic
1173943357 20:46930988-46931010 GTTATCACACTGGCACCTAATGG - Intronic
1177316570 21:19469833-19469855 GTTCTCACTCTGTCTCCTAAAGG - Intergenic
1178073045 21:28990504-28990526 TTCCACAAACTTTCACCTAATGG - Intronic
1179719348 21:43306523-43306545 ATGCACACACTGTCAGCCAGTGG - Intergenic
1180934988 22:19619589-19619611 TTGCACACACACTCACCTCAGGG + Intergenic
1181523901 22:23467250-23467272 AAGGACACACTGTCACCTAGAGG - Intergenic
1184506917 22:44909405-44909427 GTGCAGACACTGCCACAGAATGG + Intronic
954458783 3:50614246-50614268 GGGCCCACACTGCCACCTAGCGG + Intronic
954930288 3:54275277-54275299 GTGCACACCCTGAGACCTGAAGG - Intronic
960699980 3:120429856-120429878 TTTCACACTTTGTCACCTAAGGG + Intronic
961971623 3:130974374-130974396 GAGCACACACTGTCACAGCAGGG + Intronic
966367376 3:179204539-179204561 GTGTTCACATTGTCACATAAGGG - Exonic
967913275 3:194559355-194559377 TTGCCCCCACTGTCACCTGAAGG + Intergenic
973174771 4:47191603-47191625 GTGAAAACACTGTTATCTAAGGG - Intronic
979411848 4:120388969-120388991 GTGAACACATTGGAACCTAATGG - Intergenic
983095115 4:163552347-163552369 GTGCACACACTGTCTCAAGATGG - Intronic
983621546 4:169766556-169766578 GAGCACAAACTGGCACATAATGG + Intergenic
984754930 4:183316184-183316206 GTGCTCACACTGCCTCCAAATGG - Exonic
986350263 5:6871318-6871340 GTGCATACACTGACACAAAATGG + Intergenic
987789809 5:22550635-22550657 GTCCACACACTGCAACTTAATGG + Intronic
992709790 5:79440539-79440561 GTGCATTGACTGTCAGCTAAAGG - Intronic
996647002 5:125828591-125828613 GTGGGCACAGTGTCACCAAAGGG + Intergenic
996813849 5:127551751-127551773 CTTCACCCACTGTCACCAAAAGG - Exonic
997840770 5:137237199-137237221 CTGCACACAGTGCCACCAAATGG - Intronic
1000222046 5:159223647-159223669 GTAAACACACTGTCTCCTGAGGG + Intergenic
1001723620 5:173877479-173877501 GTGCACACCCTGGGACCCAAGGG - Intergenic
1002906229 6:1451406-1451428 GTGCACCTACAATCACCTAATGG + Intergenic
1008117631 6:47570598-47570620 GTGCTCTCTCTGTCACTTAATGG + Intronic
1012173339 6:96047155-96047177 GTCCTCACAGTGTCACCGAATGG + Intronic
1013693320 6:112670602-112670624 GAGCACACATTGTCAAGTAATGG - Intergenic
1016866594 6:148773643-148773665 GTGAACAAAATGTCACCCAACGG - Intronic
1021792345 7:24218170-24218192 TTGGACTCACTGTCATCTAATGG + Intergenic
1029235198 7:99109578-99109600 GTGCAGACACTGTCACTTCCAGG - Intronic
1031579916 7:123460520-123460542 GTTCACAGACTGTCAAATAAGGG - Intronic
1032480272 7:132240490-132240512 GTGCACTCACAGCCAGCTAATGG + Intronic
1033226274 7:139565157-139565179 TTACACAAACTGTGACCTAATGG - Exonic
1035643891 8:1203775-1203797 ATGCAGCCAATGTCACCTAAAGG + Intergenic
1037277867 8:17200825-17200847 CTTCCCACACTGCCACCTAAGGG - Intronic
1038027880 8:23608427-23608449 GTGCACACAGATTCACCTAAAGG - Intergenic
1043655226 8:82656055-82656077 GTTCACACACTGTGACCAATAGG + Intergenic
1048383263 8:133887352-133887374 TTCCAGCCACTGTCACCTAATGG + Intergenic
1050299327 9:4241139-4241161 GTGCACACTCTGAAATCTAAAGG + Intronic
1051234491 9:14984934-14984956 GAGCACAAACTGGCACATAATGG - Intergenic
1057722630 9:97545270-97545292 GTGCACACACTCTCCCATTAGGG - Intronic
1060410646 9:123397981-123398003 CTGCACACCTTGTCTCCTAATGG - Intronic
1186197057 X:7120064-7120086 ATGCACACACAGACACCCAAAGG + Intronic
1187263911 X:17713259-17713281 GTGCACATACTGTGTCCTATTGG - Intronic
1190828646 X:54041638-54041660 GTGCACACACGGTTAACTGAAGG + Intronic
1192003645 X:67185795-67185817 GTGCACACACTATTACATGAAGG + Intergenic
1198717864 X:139580793-139580815 GTGTACACTCTTCCACCTAAAGG + Intergenic
1198810406 X:140530483-140530505 TTGCACACACAGGTACCTAAGGG - Intergenic