ID: 1140801683

View in Genome Browser
Species Human (GRCh38)
Location 16:78494248-78494270
Sequence TGTTCTCTGCAGGAACTAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140801683_1140801689 12 Left 1140801683 16:78494248-78494270 CCGTCTAGTTCCTGCAGAGAACA 0: 1
1: 0
2: 1
3: 29
4: 209
Right 1140801689 16:78494283-78494305 ATGCAGCACACACCTTTGTGAGG 0: 1
1: 0
2: 1
3: 12
4: 131
1140801683_1140801691 30 Left 1140801683 16:78494248-78494270 CCGTCTAGTTCCTGCAGAGAACA 0: 1
1: 0
2: 1
3: 29
4: 209
Right 1140801691 16:78494301-78494323 TGAGGTCCCTTCTCCAACACAGG 0: 1
1: 3
2: 12
3: 216
4: 1271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140801683 Original CRISPR TGTTCTCTGCAGGAACTAGA CGG (reversed) Intronic
901848293 1:11998703-11998725 TGTTCTCAGCAGGAAGAATAGGG + Intronic
902175590 1:14647842-14647864 TCAACTCTGCAGGAACGAGATGG + Intronic
902705344 1:18200431-18200453 TATTCCCTGCAGGAATCAGAGGG - Intronic
904236552 1:29121059-29121081 TGTTCAATGCAGGAGCCAGACGG + Exonic
906074841 1:43044416-43044438 TGGCCCCTGCAGAAACTAGACGG - Intergenic
907278337 1:53328900-53328922 TGTCTTCTGCAGGAAGGAGAAGG + Intergenic
908813740 1:68010685-68010707 TGTTTTGTGCAGGAAATACAAGG - Intergenic
910567999 1:88667099-88667121 TATTTCCTGAAGGAACTAGAAGG - Intergenic
911654788 1:100431235-100431257 TTTTGTCTGCTGGAACAAGAAGG + Intronic
913715061 1:121525204-121525226 TGTCCTTTGTAGGAAATAGATGG + Intergenic
914318946 1:146541019-146541041 TGTTATCTGCAGGAACAACTGGG - Intergenic
914348626 1:146821010-146821032 TGGTCTCTGCAGGAGCTGAAGGG + Intergenic
914495411 1:148192338-148192360 TGTTATCTGCAGGAACAACTGGG + Intergenic
914859501 1:151374376-151374398 TGGTCTCTGCAGCAACTCCATGG + Intergenic
918071683 1:181137825-181137847 TGTTCTCTGAAGGAACAAATGGG - Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
921101761 1:211934553-211934575 TGGTCTCTGCAGGAAAGAGGGGG + Intergenic
921710645 1:218369810-218369832 TGTGCTCTGCATGCAATAGAAGG + Intronic
924508480 1:244709124-244709146 TGTGCTCGGCAGGAACATGACGG + Intergenic
1063080177 10:2760475-2760497 TTTTGTCTTAAGGAACTAGAAGG + Intergenic
1063293042 10:4771162-4771184 TGTTCTCTGCAGAGACTAGGAGG + Intergenic
1063959141 10:11292541-11292563 TTTGCCCTGCATGAACTAGAAGG - Intronic
1064912160 10:20414730-20414752 TGTCCTCTGCAGGGACATGATGG + Intergenic
1065088451 10:22204331-22204353 TGGTCCCTCCAGAAACTAGATGG + Intergenic
1067753629 10:48987453-48987475 AGTTCTCTGCAGGCCCCAGAGGG - Intergenic
1068199865 10:53769278-53769300 TGTTCTTTTAAGGAAATAGAGGG - Intergenic
1070055270 10:72928634-72928656 TGTCCTCTGCAGCAACCAGCAGG + Intronic
1073315371 10:102577028-102577050 TGGTCTCTTCAGGAAGAAGATGG + Intronic
1075923238 10:126230273-126230295 TGTTAGCTGCAGGAAATATAAGG - Intronic
1076447883 10:130530851-130530873 TGTTCTCAGCAGTAACAAGGGGG - Intergenic
1076467784 10:130696995-130697017 TGTGTTCTGCGGGAACTACAGGG - Intergenic
1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG + Intronic
1077929792 11:6719159-6719181 TAGTTTCTGCAGGAAATAGAAGG + Intergenic
1078451847 11:11446444-11446466 AGTCCCCTGCAGGAACTAGAGGG + Intronic
1078488025 11:11742045-11742067 TCTCCTCTGCTGGAACCAGAAGG + Intergenic
1081482679 11:43504245-43504267 TGTTCTCTGCAGGCCCTCGGTGG + Intergenic
1082907462 11:58325702-58325724 TGTCCTTTGCAGGAACAAGATGG - Intergenic
1084478069 11:69400169-69400191 TGTTCTCTACAGGCCCTGGATGG + Intergenic
1085720567 11:78908873-78908895 TGTTGTATGCAGGGACTTGATGG + Intronic
1085905298 11:80753451-80753473 TGTTCTATGCAGGTACTCAAGGG + Intergenic
1086512992 11:87580251-87580273 TCTTCTCTCCAGGATCTGGATGG + Intergenic
1089796739 11:120986649-120986671 TTTTTTCTGTAAGAACTAGACGG - Exonic
1089930580 11:122306838-122306860 TGTTCAGTGCAACAACTAGATGG - Intergenic
1091223259 11:133943387-133943409 GGTACTCTGGAGGAGCTAGAAGG - Intronic
1092261873 12:6957242-6957264 TGTTTCCTCCAGGACCTAGAGGG + Intronic
1093139790 12:15495985-15496007 TGTTCTGTGCAGTGACTAGAGGG - Intronic
1099302524 12:80915711-80915733 TGTGCTTTGCAGCAACTGGATGG + Intronic
1100034766 12:90236845-90236867 TGGTTTCTGCAGGAACAAAAGGG - Intergenic
1101000555 12:100353436-100353458 TGTTCTTTGCAGGGACTGGATGG - Intergenic
1101006648 12:100407482-100407504 TTTTTTCTGCAGAAACTAGAAGG + Intronic
1101264012 12:103065207-103065229 TGGCCTCTGCAGAAAATAGATGG + Intergenic
1101319154 12:103658018-103658040 TGGTCTCTGCAGGAATGGGAGGG - Intronic
1101683806 12:106996273-106996295 TGTTCTTTGCAGGGACATGATGG - Intronic
1102446156 12:113004345-113004367 TTTTCTCTACAGAAACTAAATGG + Intronic
1103538737 12:121651639-121651661 TGTTCTCTGCAGGGGAGAGAGGG + Exonic
1104711540 12:130990366-130990388 TGTTCTCATCAGGAAATAGTGGG + Intronic
1104914149 12:132256156-132256178 TGTTCTCTGCTGGAAAAGGATGG - Intronic
1107574968 13:41708672-41708694 TGATCTCTGCAGGACCTAGGTGG - Intronic
1110303575 13:73957773-73957795 TGTTCTTCACAGAAACTAGATGG - Intronic
1112599442 13:100840615-100840637 TCCTCTCTGCAGGCTCTAGAAGG - Intergenic
1113273434 13:108700812-108700834 TGTGTTCCTCAGGAACTAGAAGG + Intronic
1113310403 13:109126548-109126570 TTTTCTCTGCTGGAACTAAACGG + Intronic
1117146921 14:52845072-52845094 TTTTCTCTAGAGGACCTAGATGG + Intergenic
1117344250 14:54817401-54817423 TGTGCTCTGCTGGAACTGGACGG - Intergenic
1117476501 14:56100799-56100821 TGCTCTCTGAAGGAAATTGAAGG - Intergenic
1119666025 14:76485743-76485765 CTGTCTGTGCAGGAACTAGATGG - Intronic
1119811805 14:77527362-77527384 AGTTCTCTTAAGGAACTAGAAGG + Intronic
1120177993 14:81315603-81315625 TGTTCTCTGCGGGAGCAGGAGGG - Intronic
1121686005 14:95835707-95835729 TGTGGTCTGCAGAAACAAGAGGG + Intergenic
1123033218 14:105460845-105460867 CGTGCTCTGCAGGGACGAGATGG + Exonic
1124415132 15:29467415-29467437 TGTTCCCTTCAGAAACTAAATGG + Intronic
1125552547 15:40557181-40557203 TGATTTCAGCTGGAACTAGACGG + Intronic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1126222410 15:46229452-46229474 AGGTCTCAGCAGGAACTAAATGG - Intergenic
1126535854 15:49763409-49763431 TGTTCTTTTCAGGAGCTAAAAGG - Intergenic
1127359279 15:58230667-58230689 TGTTCTCTGCAGAAACTGGAAGG + Intronic
1128091985 15:64925491-64925513 TGTGGTCTGCAGGGAGTAGAGGG - Intronic
1128252651 15:66173825-66173847 TGGTCTCTGCAGGAAGCAGGTGG - Intronic
1128561108 15:68668308-68668330 TGTTGTCTGCATGATCCAGAAGG - Intronic
1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG + Intergenic
1130149885 15:81303537-81303559 TTTCCTCTGCAGCAATTAGACGG + Exonic
1133121120 16:3608637-3608659 TCTTCTCTGCAGGGCCTTGAAGG + Exonic
1133899205 16:9957540-9957562 TGTTCTCTGCATGCACTGGGTGG + Intronic
1134057828 16:11181408-11181430 TGCTCTCTGCAGGGACTTGGGGG - Exonic
1135911307 16:26563927-26563949 TGTTCTTTGCAGGAACATCAGGG + Intergenic
1136098339 16:27974837-27974859 GGGTCTCTGCAGGAAACAGATGG + Intronic
1137352454 16:47725531-47725553 TGTGCTCAGCAGCAACCAGAAGG + Intergenic
1137476716 16:48815727-48815749 TGTCCTTTGCAGGGACAAGATGG + Intergenic
1137486635 16:48896541-48896563 TGGTATCTGCAGGAGCTGGAAGG - Intergenic
1138790892 16:59902806-59902828 TTTTTCCTACAGGAACTAGAGGG - Intergenic
1139985412 16:70894538-70894560 TGGTCTCTGCAGGAGCTGAAGGG - Exonic
1140136612 16:72211346-72211368 TCTTCTCTGAATAAACTAGATGG + Intergenic
1140801683 16:78494248-78494270 TGTTCTCTGCAGGAACTAGACGG - Intronic
1141399305 16:83733217-83733239 TGTTCTGTGAAGGAGCTGGAGGG - Intronic
1141526558 16:84615466-84615488 TGTTCTCTCCAGCAAGTAGAAGG - Intronic
1144072285 17:11685466-11685488 TGTTCTCTGCAGCCATGAGAAGG - Intronic
1144261476 17:13526200-13526222 TGTTCTCAGAAGGAAGCAGAAGG - Intronic
1150921478 17:69488609-69488631 TGTTCTTTGCAGGAACATGGAGG + Intronic
1151232664 17:72695864-72695886 TGCTCTCTGCAGGCTCTGGAAGG - Intronic
1152748996 17:82053974-82053996 GGTTCTCTGCACGAAGGAGAGGG - Exonic
1153169939 18:2304031-2304053 TGTTCACTGAAGTACCTAGAGGG - Intergenic
1154332441 18:13440968-13440990 GGTTCTCTGCAGGAGCCCGAGGG + Intronic
1155900190 18:31380071-31380093 TGGACTCTGCAGGAATTTGAAGG - Intronic
1159316292 18:66778002-66778024 AGTGCTCTGCATGAACTAGTTGG - Intergenic
1162828137 19:13266941-13266963 TGTTCTCTGCAAGAACTGGTGGG + Intronic
1163966741 19:20753199-20753221 TGTTAGCTGCAGCAATTAGAGGG - Intronic
1164774129 19:30837828-30837850 TGTCCTCTGCAGAAACATGATGG - Intergenic
1167552126 19:50168526-50168548 TTTTCTCTGCAGGGACAAGGGGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925282520 2:2694751-2694773 AGTTCGTTGCAGGATCTAGACGG + Intergenic
926275147 2:11397925-11397947 TGGCCCCTGCAGGAACCAGAGGG - Intergenic
931962942 2:67502051-67502073 TATTCTCTGCAGGTTCTAGATGG - Intergenic
932802182 2:74750705-74750727 TGTTCTAGGCAGGAAGTAGAAGG + Intergenic
934572844 2:95383321-95383343 AGTTCTCTGCAGGCTCTACACGG + Intronic
937844509 2:126564979-126565001 TGTTTGATGCAGGAAGTAGAAGG + Intergenic
938561211 2:132473716-132473738 TGGCCTCTGCAGAAACCAGATGG - Intronic
939903764 2:147884032-147884054 TGGTTTTTGCAGGAACTAGTAGG + Intronic
940801720 2:158140013-158140035 GGGTCTCAGCAGGAACCAGATGG - Intergenic
941182840 2:162282215-162282237 TGTTTCCTCCAGGAAGTAGAAGG + Intronic
941232596 2:162930104-162930126 TGCACTCTGCAGGAACTCTAAGG + Intergenic
945528314 2:210917763-210917785 GCTTCTGTGCATGAACTAGAAGG + Intergenic
946888136 2:224245448-224245470 TGTGCTCTGCAAAAACAAGAAGG + Intergenic
947708380 2:232294382-232294404 TGTTTGCTACAGGAACCAGATGG + Intronic
1169010368 20:2245175-2245197 TGTTCTGTGCAGGAAGTGGAGGG + Intergenic
1172278513 20:33694295-33694317 TGTTCTATACATGAACTAGAAGG + Intergenic
1172628329 20:36361519-36361541 TCTTCTCTGCAGCAGCCAGAAGG - Intronic
1173394674 20:42668389-42668411 TGTTCTCTGGAAGAAATAGCTGG - Intronic
1176423854 21:6535754-6535776 GGTTCTCTGCATGAACTCCAAGG + Intergenic
1177204248 21:17993519-17993541 TGTCCTTTGCAGGAACATGATGG - Intronic
1179493307 21:41755612-41755634 TGTCCCCTGCATGAACTACATGG + Intronic
1179699347 21:43144069-43144091 GGTTCTCTGCATGAACTCCAAGG + Intergenic
1181599226 22:23939463-23939485 TATTCTCTGTAGGAATTAGCTGG - Intergenic
1182013033 22:27016430-27016452 TGGACTCTGCAGGACCTAGCTGG - Intergenic
1182178816 22:28322831-28322853 TCTTCTCTGGAGGATCCAGAAGG - Intronic
1184688146 22:46105604-46105626 TGTTCTGTCCAGGAACCACAGGG - Exonic
1184874328 22:47263601-47263623 TGTTCTCACCAGGGACTAGAAGG - Intergenic
949334034 3:2953807-2953829 TGTTCTCTGAATCACCTAGAGGG + Intronic
950256383 3:11510106-11510128 TGGTGTCTGCAGAAATTAGAAGG + Intronic
954456848 3:50604271-50604293 TGCTGTCTCCAGGACCTAGATGG + Intergenic
954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG + Exonic
957780146 3:84808579-84808601 TGTTCCCTGAAGGTATTAGAAGG - Intergenic
957925933 3:86811421-86811443 TGTCGTTTGCAAGAACTAGATGG + Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960265282 3:115614345-115614367 TGTCCTTTGCAGGGACTAGATGG + Intergenic
964016208 3:151950224-151950246 TGTTCTTTGCAGGAACAGGATGG + Intergenic
967778696 3:193412357-193412379 TGTACTGTGCAGGCACTAAAAGG + Exonic
971478668 4:27095277-27095299 TGTTCTTTGCAGGATGGAGAAGG - Intergenic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972032517 4:34478957-34478979 TGTTCTCTCCAGGGACTCTAGGG + Intergenic
972575391 4:40346428-40346450 TGATCCCTGTAGGAAATAGATGG - Intronic
973168923 4:47114232-47114254 TGACCTGTGCAGGAAGTAGATGG - Intronic
975581591 4:75911709-75911731 TGTTCTCTACAGGAACAATTGGG + Intergenic
979997607 4:127450902-127450924 TATTCTCTGCAGGCACTGCATGG - Intergenic
980852626 4:138401576-138401598 CGTTCTCTGTAAGAACAAGATGG - Intergenic
981838475 4:149082840-149082862 TGTTCTCTCCAGTCACAAGAAGG - Intergenic
981890325 4:149728790-149728812 TGTTCTGTAAAGGAACAAGAAGG - Intergenic
984900723 4:184584115-184584137 TTTTGTCTTCAGGAACTAAAAGG - Intergenic
986904207 5:12473666-12473688 TGTTCTTTGCAGGATCAGGATGG + Intergenic
987296727 5:16559441-16559463 TGCTCTCTGCAGGAAGTGGATGG - Intronic
988327631 5:29790443-29790465 TTTTCTTTGCAGAAACCAGATGG + Intergenic
988522991 5:31963013-31963035 TGTTCTCAGCAGGAAATAACAGG - Intronic
989326550 5:40203032-40203054 TTTACTGTGCAGGAAATAGAAGG + Intergenic
989962678 5:50435250-50435272 TGTCCTTTGTAGGAAATAGACGG - Intronic
989989303 5:50742396-50742418 AGTTCTGTGCAGCAAGTAGATGG + Intronic
990366215 5:55073053-55073075 TCTTATCTCCAGGAATTAGAAGG - Intergenic
993794393 5:92249054-92249076 TGTTGTCTTCAGACACTAGAGGG + Intergenic
994041386 5:95263532-95263554 TGTTCTATCCAGAAATTAGAAGG + Intronic
995155742 5:108910792-108910814 TGTCCTTTGCAGCAACTAGATGG - Intronic
998822659 5:146070681-146070703 TCTCCTCTGCAGGAACAAAAGGG + Intronic
1000658213 5:163907565-163907587 TGTCCTTTGCAGGAACCAGATGG - Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001836971 5:174840795-174840817 GCTTCTCTGCAGGAAGAAGAGGG + Intergenic
1002063766 5:176642138-176642160 TGTTCTCTGCCTGACCTGGATGG - Exonic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002804200 6:556515-556537 TGTTCTCTGCAGTCACTGAAGGG - Exonic
1004722488 6:18279097-18279119 TATTATCTCTAGGAACTAGAAGG + Intergenic
1007338883 6:41176705-41176727 TGTTCTCAGGAGGAAATAGTTGG - Intergenic
1007357440 6:41331887-41331909 TGTCTTCTGCAGGCACTGGATGG + Intergenic
1008186252 6:48394639-48394661 TGTCCTTTGCAGGAACATGATGG - Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1008431693 6:51425374-51425396 TGTTTGCTGCAGTAACTAGTTGG + Intergenic
1008725670 6:54415338-54415360 TGTCCTTTGCAGGAACATGATGG - Intergenic
1009877448 6:69522475-69522497 TTTTCTGTGCAGAAACTAGTTGG - Intergenic
1012094314 6:94939318-94939340 TGTTCTTTGCAGCAACATGACGG + Intergenic
1014638950 6:123884255-123884277 TGTTCTTTGCACGGACTGGATGG - Intronic
1014707012 6:124760099-124760121 TGTTCTTTGCAGGAACATGGAGG + Intronic
1014844555 6:126259126-126259148 TGTCCTTTACAGGAACTAGATGG - Intergenic
1017193365 6:151676442-151676464 AGTCCTTTGCAGGAACCAGAAGG - Intronic
1018910681 6:168099616-168099638 TGTTCTCTGCAGGATGCAGCAGG - Intergenic
1022858423 7:34339951-34339973 TGTTCTCTGCAGGAAGCAGGAGG + Intergenic
1023254608 7:38300491-38300513 TGTTCTCTGCACGAATGTGAGGG + Intergenic
1023816266 7:43952576-43952598 TGTTCTCTGCAGCACATTGAAGG + Intronic
1023939309 7:44759793-44759815 ATTTCTCTGCAGCAAGTAGAAGG - Intronic
1024157931 7:46645393-46645415 TGCTCTCAGCAGAGACTAGATGG - Intergenic
1024782922 7:52873404-52873426 TGTCCTGTGCAGGAAACAGATGG - Intergenic
1026365183 7:69641292-69641314 TTTTGTCTGGAGGATCTAGAGGG - Intronic
1027662806 7:81007254-81007276 TGTTCTCTGCTGGAAAATGAAGG - Intergenic
1028147265 7:87331744-87331766 TGTTCTCTGCAGGAATAATTGGG - Intergenic
1028198356 7:87933577-87933599 AGGTCTCTGCAGGTAATAGAGGG - Intergenic
1028750184 7:94374244-94374266 TTTTCTCTTCATGAACTTGAAGG - Intergenic
1031493390 7:122417455-122417477 TGTTGGCTGTAGGAAGTAGAAGG + Intronic
1031914889 7:127553805-127553827 TGTTATCTGAAGGAACTAAAAGG - Intergenic
1032739008 7:134720297-134720319 TTTCCTCTGCAGGAAATAGAAGG - Intergenic
1034352865 7:150428634-150428656 TGTTTTCTGCAGGTTCTAGTGGG - Intergenic
1035414200 7:158669072-158669094 TGTTCTTTGCAGGGAATGGATGG - Intronic
1036387680 8:8296150-8296172 TGTTCTCTGCTGGGAGTGGAGGG + Intergenic
1037598206 8:20372350-20372372 AGATCCCTGCAGGAAATAGAAGG + Intergenic
1037702178 8:21285155-21285177 TGGCCTCTGCAGAAATTAGATGG + Intergenic
1038798734 8:30730976-30730998 TGTTAGCTGCAGCAATTAGAGGG + Intergenic
1040718727 8:50291133-50291155 TGTTCTCTGCTGAAACTTCAAGG - Intronic
1041025324 8:53679618-53679640 TGATATCTTCAGAAACTAGAGGG + Intergenic
1042114193 8:65413784-65413806 TGTTCTCTGCTGTAACTCAAAGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1050085887 9:1965377-1965399 GGTTCCCAGCAGGAAATAGATGG + Intergenic
1052437218 9:28444345-28444367 TGTTCTCTGCTGGCACTGGGTGG + Intronic
1053184831 9:36006874-36006896 TGTTCACAGCAGGTAGTAGAAGG - Intergenic
1053653394 9:40191759-40191781 TGATATCTTCAGGAAATAGAGGG + Intergenic
1053903797 9:42821049-42821071 TGATATCTTCAGGAAATAGAGGG + Intergenic
1054531190 9:66184459-66184481 TGATATCTTCAGGAAATAGAGGG - Intergenic
1056817494 9:89812151-89812173 TGTGCGCTGCAGGAGCCAGACGG + Intergenic
1056876943 9:90342746-90342768 TGTTCTCTGCCGTAACTCAATGG - Intergenic
1057917177 9:99065744-99065766 TGTCCTCTGCAGGAAGGAAAGGG + Intronic
1057948984 9:99354652-99354674 TAATCTCTGCAGGAATTAAATGG - Intergenic
1058188504 9:101884965-101884987 TTTTCTATGCAGGAAGAAGACGG + Intergenic
1058716541 9:107727401-107727423 TGTTCTGTGCCTGAACAAGAAGG + Intergenic
1060316793 9:122519108-122519130 TTCTCTCTGCTGGAAATAGAGGG - Intergenic
1060580718 9:124743877-124743899 GGTTCTCTGGAGGAACAAAAGGG + Intronic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1186421323 X:9429246-9429268 GGGTCTCTGCAGGAAGCAGATGG + Intergenic
1187237980 X:17486041-17486063 ATTTCACTGCAGGAACTAAACGG + Intronic
1188379704 X:29476503-29476525 TGTTCTCTGTAGGACCTAGCAGG + Intronic
1189266240 X:39718824-39718846 TGGTGTCTGCTGGATCTAGAAGG - Intergenic
1193471526 X:81909699-81909721 TGGTCCTTGTAGGAACTAGATGG + Intergenic
1194785157 X:98074323-98074345 GGTTATCTGCTGGCACTAGAGGG + Intergenic
1194942836 X:100032880-100032902 GGTTCCCTCCAGGAACTGGATGG - Intergenic
1195425878 X:104729809-104729831 TGTCCTTTGCAGGAACATGATGG - Intronic
1198787947 X:140311945-140311967 TGTTCTTTGCAGGAACATGGAGG + Intergenic
1199241593 X:145553960-145553982 TGTTCCCTGCAGGGGCCAGAGGG - Intergenic
1199826657 X:151506947-151506969 GGTTCTCTAGAGGGACTAGAGGG + Intergenic