ID: 1140810458

View in Genome Browser
Species Human (GRCh38)
Location 16:78572224-78572246
Sequence GAGATAGCAGTGATAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140810451_1140810458 25 Left 1140810451 16:78572176-78572198 CCGTCTACAATGAAATGGGGAAA 0: 1
1: 0
2: 2
3: 20
4: 322
Right 1140810458 16:78572224-78572246 GAGATAGCAGTGATAATGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140810458 Original CRISPR GAGATAGCAGTGATAATGGG TGG Intronic
900369393 1:2324663-2324685 GAGGTAGCAGTGAGGATGGGAGG + Intronic
904821576 1:33248306-33248328 GAGATAGCAGTGAAATGGGCAGG - Intergenic
906091634 1:43184698-43184720 GGGATGGTAGTGAAAATGGGTGG - Intronic
906224006 1:44106154-44106176 GAGATAGGAGTGGTGATGGAAGG - Intergenic
907529492 1:55079614-55079636 GAGGGAGCAATGCTAATGGGTGG + Exonic
908443143 1:64175161-64175183 TAGATAGCAGTGATTATTGGGGG - Intronic
908463699 1:64370599-64370621 GAGATGGAGGTGGTAATGGGTGG + Intergenic
910124120 1:83821351-83821373 GAGATAACAGTGGTAAAAGGAGG - Intergenic
914192757 1:145425520-145425542 GAGACAGCGGCGATATTGGGAGG - Intergenic
914590661 1:149103468-149103490 GAGACAGCGGCGATATTGGGAGG - Exonic
917105575 1:171487885-171487907 GACATATCAGGGATAAGGGGAGG - Intronic
917381221 1:174410448-174410470 GTAATAGCAGGGATAATGTGTGG + Intronic
918057918 1:181038623-181038645 GAGAGAGCAGTGATAATCCAGGG + Intronic
919579597 1:199355234-199355256 GAGGTAGCAGTGGAAATGGATGG - Intergenic
920628559 1:207628222-207628244 GAGATAGTAGTAATAGTGAGTGG - Intronic
921464368 1:215468812-215468834 GAGCTAGCAAAGATAATGGTGGG + Intergenic
1063185897 10:3651292-3651314 GAGAGAGAAATGAAAATGGGTGG - Intergenic
1063692695 10:8302376-8302398 GAGATACCAGTGAGAAAGGATGG + Intergenic
1063731787 10:8705822-8705844 GATTTATCAGTGATATTGGGAGG + Intergenic
1063818973 10:9812611-9812633 GAGATAGCAGTGCTGGTGGCAGG + Intergenic
1064364840 10:14698348-14698370 GAGAAAGAAGTGATACTGGCAGG + Intronic
1064846014 10:19654148-19654170 TAGATGGCAGTGCTTATGGGAGG - Intronic
1065412450 10:25444214-25444236 CAGAGAGCAGGAATAATGGGGGG + Intronic
1068232423 10:54186181-54186203 GAGAAAGGAGTGATACAGGGAGG + Intronic
1068618496 10:59149753-59149775 GAGATAGCAGTGGGAAGGTGAGG - Intergenic
1072429861 10:95361277-95361299 GAAAAAACGGTGATAATGGGTGG - Intronic
1073442171 10:103558739-103558761 GAGGCAGCAGTGACACTGGGAGG + Intronic
1076883755 10:133252072-133252094 GAGCTGGCGGTGATAACGGGTGG + Intergenic
1077793857 11:5470287-5470309 GGGGAAGAAGTGATAATGGGTGG - Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084155170 11:67309262-67309284 GAGGCAGCAGTGACAGTGGGAGG - Intronic
1086325113 11:85690871-85690893 GATAGAGGAGTGATAGTGGGAGG + Intergenic
1087835707 11:102872736-102872758 GAGATAGCATTAACAATGGAGGG + Intronic
1091925874 12:4348226-4348248 GAGATAGCAGAGAGAATGGGAGG + Intronic
1093608753 12:21128170-21128192 GAGCTAGGAGTGATAAAGAGTGG + Intronic
1094638857 12:32253911-32253933 GATACAGCAGTGATTATGGCAGG - Intronic
1098491319 12:71083310-71083332 GAGATAGCATTGATTATTGCTGG + Intronic
1099046498 12:77727188-77727210 GAGAAAGCTGTTATAGTGGGAGG + Intergenic
1100250286 12:92814090-92814112 GAGAAAACAGTAAAAATGGGGGG + Intronic
1100250516 12:92817519-92817541 GAGATAGCAGTGGAAATGGCTGG - Intronic
1103621651 12:122190560-122190582 GAGACAGAAGTGATAGGGGGAGG + Intronic
1104835208 12:131785729-131785751 GAGGAATCAGTGTTAATGGGTGG + Intronic
1106051305 13:26192434-26192456 CAGATGGCAGGGATAATTGGGGG - Intronic
1106548807 13:30753795-30753817 GAGCTAACAGAGATTATGGGTGG - Intronic
1107332018 13:39311674-39311696 GACATAGAAGTAATACTGGGAGG - Intergenic
1107597407 13:41977224-41977246 GAGGGAGCAGTGAGACTGGGTGG - Intergenic
1108389622 13:49935874-49935896 GAGATTCCTGTGAAAATGGGAGG + Intronic
1108896078 13:55330568-55330590 GAAATAGGAGGGATAATGAGAGG + Intergenic
1109710196 13:66149185-66149207 GATATAGATGTGAGAATGGGGGG - Intergenic
1115532468 14:34340000-34340022 GAGATCGCAGTGTTACTGGAAGG + Intronic
1115845615 14:37530108-37530130 TTGGTAGCAGTGAGAATGGGAGG + Intronic
1117327071 14:54679001-54679023 GAGATAGCAGGGAGAAGTGGGGG + Intronic
1118355077 14:65006820-65006842 GAGATATGAGGGAAAATGGGAGG + Intronic
1121523643 14:94603371-94603393 GAGATGGCAGAGGTAGTGGGTGG - Intronic
1126450926 15:48808195-48808217 CTGGTAGCAGTGATAATGAGTGG - Intronic
1129207133 15:74044029-74044051 GGGATAGCAGTCAGAAGGGGAGG - Intronic
1129753678 15:78083228-78083250 GAGATAGCTGTGTTACTTGGGGG + Intronic
1130153350 15:81329075-81329097 GAGATAGAGGTGCTCATGGGAGG - Intergenic
1130617233 15:85422373-85422395 GAGTTAGCAGGGAAAAGGGGAGG + Intronic
1130624440 15:85499239-85499261 GAGATAGCAGTGATTTTCAGTGG + Intronic
1130795408 15:87203471-87203493 GGAATAGCAGTGATGGTGGGTGG - Intergenic
1133777674 16:8910256-8910278 GAGAGAGCAGTGAGCATGGTGGG - Intronic
1134224284 16:12379597-12379619 GGGGAAGCAGTGATAAAGGGAGG + Intronic
1135849870 16:25953559-25953581 GAGAAAGCAATGAAAAGGGGTGG - Intronic
1138023680 16:53505646-53505668 GAGAGAGCAGTGGTCAGGGGAGG - Intergenic
1139163254 16:64536559-64536581 GTAATAGCAGTGAAGATGGGAGG - Intergenic
1139448341 16:67012448-67012470 GAAATATCAGAGATAAAGGGGGG - Intergenic
1140810458 16:78572224-78572246 GAGATAGCAGTGATAATGGGTGG + Intronic
1144647281 17:16983873-16983895 GAAATAGCTGTGATTATGTGTGG - Intergenic
1144947658 17:18978091-18978113 GGGACAGCAGTGATATTGGCTGG - Exonic
1148439820 17:47706149-47706171 GATACAGCAGTGAAAATGGATGG + Intronic
1148459202 17:47828521-47828543 GAGATGGCAGGCATGATGGGTGG + Exonic
1150057985 17:62037366-62037388 AAGAAAGCAGTGACAATGGCTGG + Intronic
1150149102 17:62794266-62794288 GAGGCAGCAGTGGTAATGGTGGG - Intronic
1153012409 18:551038-551060 AAGAAAGCAGTGAGAATGGCTGG + Intergenic
1153399301 18:4666269-4666291 GAGAAAGCACTGAAAATGGATGG + Intergenic
1155699194 18:28722358-28722380 GAGGGAGAAGTGATAAGGGGGGG - Intergenic
1157303526 18:46498597-46498619 GAGATAGCAGTGACAAGCTGAGG - Intronic
1157655187 18:49379361-49379383 GCAGCAGCAGTGATAATGGGGGG + Intronic
1162157248 19:8686873-8686895 GACATAGCAGTGACACGGGGGGG + Intergenic
1165299768 19:34961391-34961413 AAGGTAGCAGTGGCAATGGGAGG - Intronic
1168223474 19:54977865-54977887 GAGATAGCAGCAAGAACGGGGGG - Intronic
925037150 2:696820-696842 ATGATAGCAGAGATAATGGGGGG - Intergenic
928272982 2:29873807-29873829 AGGATAGCAGTGATAATGACTGG + Intronic
929921398 2:46174272-46174294 CAGATGGCAGTTAAAATGGGAGG - Intronic
932453811 2:71833395-71833417 GTGATAGTGGTGATTATGGGAGG - Intergenic
933790031 2:85876354-85876376 AAAATAGCAGTGGCAATGGGTGG + Intronic
935343777 2:102084125-102084147 GATGTAGCAGTTATAATGTGAGG + Intronic
938939963 2:136161524-136161546 GAGAGAGCAGGGATGAGGGGAGG - Intergenic
942463333 2:176184807-176184829 CAGACAGAAGTGATAAAGGGTGG - Intergenic
943585803 2:189738360-189738382 GTCATAGCAGTGATCATAGGGGG - Intronic
945284599 2:208069935-208069957 GAGATGGCAGTGAGGATGGGAGG - Intergenic
947561035 2:231152328-231152350 TAGATTGCAGAGATAATAGGAGG + Intronic
1169654160 20:7903793-7903815 GTGATAGCAGTGGTGGTGGGTGG + Intronic
1173183962 20:40825514-40825536 GAGAGAGCAGAGACAATGGAAGG + Intergenic
1176309988 21:5144478-5144500 GAGACAGCAGTGCCCATGGGAGG + Intronic
1179847068 21:44117554-44117576 GAGACAGCAGTGCCCATGGGAGG - Intronic
949213431 3:1534581-1534603 GAGAGTTCAGTGAAAATGGGGGG - Intergenic
950332578 3:12168256-12168278 GAGGGAGCAGTGGGAATGGGAGG + Intronic
955796415 3:62641986-62642008 GAGATGGCACTGATAAAAGGAGG + Intronic
956593562 3:70942632-70942654 GAGATAACGGTGATGATGAGAGG - Intergenic
956607685 3:71089397-71089419 GAGATTGCAGTCAAAATGTGAGG - Intronic
960461874 3:117945762-117945784 GAAATAGAAGTGATAAACGGTGG - Intergenic
961523616 3:127483001-127483023 GAGACAGCAGCAATAATGGCAGG + Intergenic
964028862 3:152112898-152112920 GAGGTATCAGTTTTAATGGGAGG + Intergenic
964257954 3:154799188-154799210 GAGACAGCAGAGATAATTGTTGG - Intergenic
965663849 3:171070375-171070397 GAGATAACAGTCATAAAGGTGGG + Intronic
968138357 3:196235717-196235739 GAGAAAGCAGTCAACATGGGTGG - Exonic
969306475 4:6328815-6328837 GAGACAGTAGTGGTGATGGGAGG + Intronic
970333721 4:15009841-15009863 GAGATAGGGGTGATAATGAAAGG + Intronic
971108639 4:23556853-23556875 GAGATAAGAGAGACAATGGGTGG + Intergenic
975661246 4:76690476-76690498 GAGATTGCTGTGATATCGGGGGG + Intronic
977190663 4:93996815-93996837 GAGATAGCAATGATAATTATAGG + Intergenic
978077794 4:104554614-104554636 GAGGTTGCAGTGGTAATGAGGGG + Intergenic
982822360 4:159957579-159957601 AAGATAGCTGTGGTGATGGGGGG + Intergenic
986603911 5:9502671-9502693 GAGAGCGCAGTCATAGTGGGAGG + Intronic
990451912 5:55941649-55941671 GACACAGCAGTGGTATTGGGGGG - Exonic
991211551 5:64110732-64110754 GAGGTAGCAGTGCTAATAGTTGG - Intergenic
992745312 5:79814728-79814750 GAGAAAGCAGAAATAATGTGTGG - Intergenic
992834121 5:80623463-80623485 GAGATAGCAGTGTTAATGATAGG + Intergenic
996053151 5:118954442-118954464 GATATAGCAGTGAAAAAGGTAGG - Intronic
998074073 5:139222031-139222053 GAGGTAGTAGTGAGAATGGAGGG + Intronic
1005075299 6:21901251-21901273 TATAGAGCAGTGATAATGAGGGG + Intergenic
1005112013 6:22292812-22292834 GAGTTTACAGAGATAATGGGGGG - Intronic
1008098398 6:47364266-47364288 GAGATTACAGTGCAAATGGGTGG + Intergenic
1008977521 6:57445479-57445501 AAGATAGCAGTGTAATTGGGAGG - Intronic
1009165661 6:60338433-60338455 AAGATAGCAGTGTAACTGGGAGG - Intergenic
1012313955 6:97762086-97762108 GACATAGCCTTGACAATGGGTGG + Intergenic
1014293292 6:119586610-119586632 GAGATAGGAGTGATACTAAGGGG + Intergenic
1015199525 6:130563678-130563700 GAGGAAGAAGTGATAAAGGGGGG + Intergenic
1017149679 6:151267790-151267812 AAAATAGCAGGGATAATGGCAGG + Intronic
1017713499 6:157190816-157190838 CAGATAGCAGTGGCACTGGGTGG + Intronic
1017871449 6:158489967-158489989 GGGTTAGCAGTGATGGTGGGTGG + Intronic
1018927217 6:168214864-168214886 GTGAGAGCAGTGTCAATGGGAGG - Intergenic
1019435015 7:1018111-1018133 GAGAGAGCAGAGATGATGGCAGG - Intronic
1021139160 7:17002525-17002547 GAGATTGCAGTGAGCCTGGGCGG + Intergenic
1024036333 7:45510319-45510341 GACACAGCAATGATGATGGGAGG - Intergenic
1027712403 7:81622084-81622106 GGGAGTGCAGTGATAATGGAAGG - Intergenic
1029811606 7:103054683-103054705 CAGACAGCAGAGAGAATGGGCGG + Intronic
1030238299 7:107291573-107291595 GAGATGGCAGTGCTAATGGCAGG + Intronic
1030377609 7:108771386-108771408 GAGAAAGCATTGAAAATGTGGGG + Intergenic
1030552101 7:110974589-110974611 GAGAAAGAACTGATAAAGGGTGG - Intronic
1031663565 7:124457067-124457089 ATGATAACAGCGATAATGGGGGG + Intergenic
1033594375 7:142845752-142845774 GAGCCAGCAGAGAGAATGGGAGG - Intergenic
1037274760 8:17166024-17166046 GAGAAAGCAGAGATCATGGAGGG + Intronic
1039773800 8:40716035-40716057 AAGATAGCAGTGGAAATTGGAGG - Intronic
1041056111 8:53988053-53988075 GAGATGGCAGTGGTTGTGGGTGG + Intronic
1041576486 8:59402129-59402151 GTGAAAGCAGTGCTAAGGGGGGG + Intergenic
1042177141 8:66048006-66048028 GAGATAATGGTGATAAAGGGTGG - Intronic
1046169324 8:110485131-110485153 GAGATAGCAATAATAGTTGGTGG - Intergenic
1047634913 8:126750942-126750964 GAGGTAGGAGTGGAAATGGGAGG + Intergenic
1048682802 8:136864680-136864702 AAAATTGCAGTAATAATGGGAGG + Intergenic
1051650793 9:19322428-19322450 GAGAAAGAAGTGAAGATGGGAGG + Intronic
1051714657 9:19969698-19969720 GAGAGAGCAGTGATGAAGAGGGG + Intergenic
1053237215 9:36466433-36466455 GAGGTAGCAGGCACAATGGGAGG + Intronic
1053310254 9:37013628-37013650 GGGATAGCAATGATGATGGTAGG - Intronic
1055116687 9:72612546-72612568 GAGATAGCAGAGTTAAGTGGTGG - Intronic
1056286423 9:85091964-85091986 GTGATTGCAGAGAAAATGGGAGG + Intergenic
1058242576 9:102584442-102584464 GAAATAGAAGTGATAATGAAAGG - Intergenic
1058324241 9:103675567-103675589 GAGAAAGCAGTGATAGGGTGGGG - Intergenic
1058903314 9:109460485-109460507 GAGATAACAGGGGTAAGGGGTGG - Intronic
1060096766 9:120797742-120797764 GAGGTAACAGTTATTATGGGAGG + Intergenic
1192826989 X:74707611-74707633 GAGTTGGGAGTGATAAGGGGAGG + Intergenic
1193027804 X:76863860-76863882 GAGATGGCAGTGACAGTGGGGGG - Intergenic
1199665595 X:150094271-150094293 GAGAAGGCAGTGACCATGGGGGG + Intergenic