ID: 1140812664

View in Genome Browser
Species Human (GRCh38)
Location 16:78593397-78593419
Sequence ATGGGATAGTACAAGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140812664_1140812671 11 Left 1140812664 16:78593397-78593419 CCATCACCCTTGTACTATCCCAT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1140812671 16:78593431-78593453 ATGCACCTGTCTTCCTCTTCAGG 0: 1
1: 0
2: 1
3: 22
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140812664 Original CRISPR ATGGGATAGTACAAGGGTGA TGG (reversed) Intronic
902114792 1:14112533-14112555 AAGTGATCATACAAGGGTGAGGG - Intergenic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
904106764 1:28091134-28091156 ATGGGAAAGTACAAAGAGGATGG - Intergenic
904385170 1:30136414-30136436 ATGGGATTGTGTGAGGGTGAAGG + Intergenic
904853209 1:33474908-33474930 ATGGGGTAGAGCAAGGGAGAAGG - Intronic
906633383 1:47391111-47391133 AGGGCACTGTACAAGGGTGAGGG - Intergenic
906826094 1:48982125-48982147 TTGGTAAAGTACAAGGGAGAAGG + Intronic
906985441 1:50678273-50678295 ATGGGATAGTTCAAGGGGGGTGG + Intronic
909896768 1:81080974-81080996 ATGGGATAGTAATAGGGTTTTGG - Intergenic
910003627 1:82367333-82367355 TTGGGCAAGAACAAGGGTGAAGG + Intergenic
914914043 1:151807384-151807406 ATGGGAAAGGAAAAGGGTGAGGG + Exonic
922476944 1:225912857-225912879 GTGGGATTGTAGAAGGGGGAGGG + Intronic
1065440922 10:25752663-25752685 ATGGACTAATACAAGGGGGAAGG + Intergenic
1065603707 10:27394487-27394509 ATGGGATTGCACAAGGGTAGGGG - Intergenic
1065805389 10:29389287-29389309 AGGGTCTAGTACAAGGTTGAAGG + Intergenic
1067838861 10:49660107-49660129 ATGGGAGAGTAGAAGTGTGCTGG + Intronic
1071074333 10:81732877-81732899 ATGGGGTAGGAGAAGGGAGATGG - Intergenic
1074072504 10:110086556-110086578 ATGAGATAGCACTAGGGGGATGG - Intronic
1074107104 10:110396550-110396572 CAGGGATAGAACCAGGGTGATGG + Intergenic
1077046057 11:545702-545724 AAGGGAAAGAACAAGGCTGAAGG + Intronic
1079293158 11:19206974-19206996 CTGGGCTATCACAAGGGTGATGG - Intronic
1079430249 11:20382766-20382788 ATGGAATAGGACTAGTGTGATGG - Intronic
1080678957 11:34455546-34455568 AAGGAATAGGACAGGGGTGAAGG + Intronic
1082878926 11:58018882-58018904 AGGGGAGGGTGCAAGGGTGATGG + Intergenic
1088774277 11:113067265-113067287 ACCGGATAGTAAAAGGCTGAAGG - Intronic
1098020555 12:66150871-66150893 ATGTAATAGAACAAGGGAGAGGG + Intronic
1102057532 12:109907852-109907874 ATGGGAAAGCACAAGGCAGATGG - Intronic
1108732513 13:53249286-53249308 ATGAGATGGCACCAGGGTGAAGG + Intergenic
1111350833 13:87028787-87028809 ATGGGATAGTAGAATGTGGAAGG + Intergenic
1112090729 13:96080481-96080503 ATAGGATTATACAAGGGTAAGGG + Intergenic
1112450803 13:99507791-99507813 ATGTGACTGTACAAGGGTCATGG - Intronic
1113437414 13:110304123-110304145 ATGGAATTGGACTAGGGTGAAGG - Intronic
1115413506 14:33103246-33103268 TTGGGAAAGTAGAAGGGTCAGGG - Intronic
1117496678 14:56312563-56312585 ATGAGATAGCACTAGGGGGATGG + Intergenic
1117610027 14:57473659-57473681 AGGGGAAAGTAAAAGGATGAAGG - Intronic
1118874611 14:69773009-69773031 ATGGGATAGTACATGTTTAAGGG + Intergenic
1118901066 14:69986310-69986332 ATGGAATAGTTCTAGGCTGATGG + Intronic
1119598968 14:75961809-75961831 ATGGGATGTCACAAGGGAGAAGG - Intronic
1120281197 14:82440203-82440225 ATGGGAAATAACCAGGGTGAAGG - Intergenic
1121774204 14:96579617-96579639 ATGGGAATGTTTAAGGGTGATGG + Intergenic
1124960789 15:34392429-34392451 ATGGGATACTCCAATGATGAGGG - Intronic
1124977418 15:34538650-34538672 ATGGGATACTCCAATGATGAGGG - Intronic
1126267473 15:46771420-46771442 ATGGGATTGTACAAGAAAGAGGG - Intergenic
1129118371 15:73379358-73379380 ATGGGAAGGTAGAAGAGTGATGG - Intergenic
1129481199 15:75827803-75827825 ATGGGAGAGTTCAAGGGAGCAGG + Intergenic
1132997607 16:2831306-2831328 CTGGGAGAGCACCAGGGTGAGGG + Intronic
1137914887 16:52419181-52419203 ATGGGACTGGACAAGAGTGAAGG - Intergenic
1139234274 16:65318188-65318210 AAGGGATATTCCAAGGATGAGGG - Intergenic
1140812664 16:78593397-78593419 ATGGGATAGTACAAGGGTGATGG - Intronic
1143557067 17:7668463-7668485 ATGGGATATAAAAAGGGAGAAGG + Exonic
1143599139 17:7932516-7932538 AAGGGAAAGTACAAGGGAGCTGG + Exonic
1149053919 17:52339783-52339805 GTGGGATAGTGAAAGGCTGATGG + Intergenic
1150936083 17:69637185-69637207 ATTGGATTATACAAGGGTTAGGG + Intergenic
1153523698 18:5976088-5976110 ATTGGATAGTACACAGGTGTGGG - Intronic
1156148285 18:34213052-34213074 AAGGGATTATACAAGGGTGGGGG + Intronic
1159890800 18:73951393-73951415 ATGGAATGGCACAAGGTTGAAGG - Intergenic
1162966747 19:14159822-14159844 ATGTGACAGTATTAGGGTGAGGG - Intronic
1163575653 19:18109683-18109705 TTGGGATCGTATATGGGTGAGGG + Intronic
1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG + Intergenic
925170372 2:1746495-1746517 ATAGGATACTGCAGGGGTGATGG - Intergenic
925882329 2:8363221-8363243 AGGGGAAAGAACAAGGATGAAGG - Intergenic
926972745 2:18483310-18483332 ATGGGATGGTACAAAGGGCAAGG - Intergenic
927906431 2:26861832-26861854 ATAGGATACAACAGGGGTGATGG + Intronic
928715329 2:34054202-34054224 ATGGCATATTTAAAGGGTGAAGG - Intergenic
929053167 2:37855081-37855103 GTGAGGAAGTACAAGGGTGATGG - Intergenic
929125583 2:38520244-38520266 ATGGGTTAGTACCAAGGTGAAGG + Intergenic
932508233 2:72257809-72257831 ATGGGACAGTACGAGGTTGATGG + Intronic
932564064 2:72894637-72894659 ATGGGAAAGGACGAAGGTGAAGG - Intergenic
936363785 2:111832444-111832466 CTAGGATAGTACAGTGGTGATGG + Intronic
936497394 2:113034396-113034418 AGGGGCTAGGACATGGGTGAGGG - Intronic
937303723 2:120858501-120858523 ATGAGACAGGACAAGGGTGGAGG - Intronic
939141548 2:138359898-138359920 AGGGGCTAGGACAGGGGTGAAGG + Intergenic
940174584 2:150864158-150864180 ATGGAATAATACATGGGGGAAGG - Intergenic
940787153 2:157993907-157993929 ATGAGACAGTACTAGGGGGATGG + Intronic
944398179 2:199293669-199293691 ATGATATGCTACAAGGGTGAAGG + Intronic
948561752 2:238858596-238858618 ATGGGAAACTGCAAGGCTGAGGG - Intronic
1170536304 20:17344371-17344393 ATGGAACAGTTCCAGGGTGACGG - Intronic
1172767806 20:37360031-37360053 ATGGGATAGAACAGGTGTGGAGG - Intronic
1174703191 20:52630141-52630163 AGGGGATTACACAAGGGTGAGGG - Intergenic
1175637394 20:60597245-60597267 AGGGGAAAGACCAAGGGTGATGG - Intergenic
1175816400 20:61885266-61885288 ATGGGATGGTTCTGGGGTGATGG - Intronic
1177770784 21:25513338-25513360 ATGGGATAGTTCAGGGCAGATGG - Intergenic
1177856864 21:26409255-26409277 ATGGGAAAGTACAAATGGGAGGG + Intergenic
1183616273 22:38947684-38947706 AAGGGACAGTACCAGGGAGAGGG + Intergenic
1184579488 22:45404991-45405013 ATGTGCTAGTACAAGGGAGGGGG + Intronic
951038208 3:17957608-17957630 ATGGGATAAGAAAAGGGTTAGGG - Intronic
953923340 3:46967187-46967209 ATGGCAAAGTACAGGGGAGAGGG - Intronic
954121258 3:48501458-48501480 GTGGGATAGGGCAAGGCTGAGGG - Intronic
955227871 3:57075932-57075954 ATGGGATAGTATCAGCATGATGG - Intronic
957136757 3:76298242-76298264 AATGGATTGTACAAGGGTGAGGG + Intronic
958706513 3:97663138-97663160 ATGGGGTAGGACAAAGGGGAAGG + Intronic
959340463 3:105123197-105123219 AAGGGAAAATAAAAGGGTGAGGG + Intergenic
961325713 3:126108220-126108242 AGGGGAGAGTACAAGGTAGATGG - Intronic
961471524 3:127116079-127116101 ATGGGATGGGACAGAGGTGAGGG - Intergenic
966549471 3:181188082-181188104 ATGGGTTAGGACAAGGGGGCCGG + Intergenic
967143103 3:186580351-186580373 ATAGGATAGCACAATGGTTAAGG + Intronic
967927420 3:194662406-194662428 GTGGTATAATACAAGGGTGCTGG - Intronic
971249114 4:24957472-24957494 ATGGGATTGTACTATGGTGGTGG - Intronic
972030828 4:34456109-34456131 ATGAGATAGTGCCAGGGTGGAGG - Intergenic
973043875 4:45510657-45510679 AAAGGATAGCAGAAGGGTGAGGG - Intergenic
973545239 4:51974286-51974308 ATGGGATGGTTGTAGGGTGAAGG - Intergenic
974146075 4:57949009-57949031 AGGGGATGGTACTGGGGTGAGGG + Intergenic
976337127 4:83902100-83902122 ATGAGAAAGTGAAAGGGTGAAGG - Intergenic
976666810 4:87603543-87603565 AGGGGATTATATAAGGGTGAGGG - Intergenic
976896624 4:90119970-90119992 AGGGGATTATACAAGGGTGAGGG - Intergenic
977993927 4:103479605-103479627 ATGGAAAAGTACAAAGGTGAGGG + Intergenic
979428319 4:120595331-120595353 ATGGGAGAGTGCAAAGGTGATGG + Intergenic
980861174 4:138501125-138501147 AATGGATAGTAAAAGTGTGAGGG + Intergenic
983052245 4:163062030-163062052 TTGGGATGGTACAAAGATGAGGG + Intergenic
983830661 4:172322692-172322714 ATGGGATAGCACTAGGAGGATGG + Intronic
984320460 4:178189461-178189483 ATGAGGTAGGACATGGGTGATGG + Intergenic
987467145 5:18285354-18285376 ATGGGATACTCTAAGGCTGAAGG + Intergenic
987524632 5:19031316-19031338 ATGAGAAAGTTCAAGGCTGAGGG + Intergenic
990478363 5:56184142-56184164 ATGGGCAAGCAAAAGGGTGAGGG - Intronic
992201210 5:74385843-74385865 ATGGGGAAGTCCAAGGTTGAGGG - Intergenic
992259546 5:74956103-74956125 ATGGTATAGTTCCAGGCTGAAGG - Intergenic
992829045 5:80576684-80576706 ATGGGAAAGTAAAATGGTGCAGG + Intergenic
992862026 5:80920865-80920887 ATGGGATATTTTAAGGGAGAAGG + Intergenic
992879979 5:81098150-81098172 ATGTGAGAGTAAAAGGGTGAAGG + Intronic
993720118 5:91313875-91313897 ATGGCATATAAAAAGGGTGATGG + Intergenic
994839270 5:104900685-104900707 ATGGGAGAGTTCAAGCGTAAGGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997665385 5:135626077-135626099 ATGGGGTAGGACAGGGGTCAGGG + Intergenic
997888591 5:137654881-137654903 CTGGGATGGAACAGGGGTGATGG + Intronic
999733271 5:154492347-154492369 ATGGGAAGGTAAGAGGGTGAAGG + Intergenic
1004410467 6:15377062-15377084 ATGAGATAGGACATGAGTGATGG - Intronic
1005566023 6:27095425-27095447 AATGTATAGTACAATGGTGAAGG + Intergenic
1006789020 6:36686613-36686635 AAGGGAAAGGACAAGGGGGAGGG - Exonic
1008379903 6:50829741-50829763 ATGGGATAGTAGGAGGGTTGTGG + Intronic
1014794804 6:125712852-125712874 ATGGACTAATACAAGGATGATGG - Intergenic
1015329565 6:131961712-131961734 ATGAGACAGCACCAGGGTGATGG - Intergenic
1016154334 6:140784825-140784847 ATGGGAAAAGACAAGGGGGAAGG + Intergenic
1018285797 6:162236407-162236429 ATGGGATAGTAAATGAGAGAGGG - Intronic
1019817435 7:3211451-3211473 AAGGGTTATTACAAGGGGGAGGG + Intergenic
1019950522 7:4368580-4368602 CTGAGATAGAACAAGGATGAAGG + Intergenic
1021171761 7:17405923-17405945 ATGAGATAATACAAGGGAGAAGG + Intergenic
1021297830 7:18930846-18930868 ATGGGATAGTAAAAAGTGGAAGG - Intronic
1022791477 7:33693468-33693490 ATGGGAGAGTAGGGGGGTGATGG + Intergenic
1024572722 7:50737287-50737309 ATGAGATAGCACTAGGGGGATGG - Intronic
1024766059 7:52661415-52661437 AATGGATAGAACAAGGCTGATGG + Intergenic
1030042502 7:105464688-105464710 ATGGTTTAGTCCAAGTGTGAAGG - Intronic
1033604528 7:142916302-142916324 AAGGTATAGTCCAAGGGTCAAGG + Intronic
1034112267 7:148548426-148548448 ATGGAAGAGAACAAGGATGAGGG - Intergenic
1034720290 7:153285791-153285813 ATGTGATATTATAAGGGGGAGGG - Intergenic
1036530040 8:9576610-9576632 ATGTGACAGCACTAGGGTGATGG + Intronic
1038819497 8:30939364-30939386 AGGGGATCATACAAGGGTGTGGG + Intergenic
1040791554 8:51236328-51236350 ATGAGACAGTACAAGGGGGATGG - Intergenic
1043579608 8:81697205-81697227 ATGGGACAGCACTAGGGCGATGG - Intergenic
1046319465 8:112553191-112553213 TTGGGAGAGTACAAGGGAAAGGG - Intronic
1048873789 8:138820935-138820957 ATGAGTTAATACATGGGTGATGG + Intronic
1050387739 9:5108853-5108875 ATGGGTAATTATAAGGGTGACGG - Intronic
1056482135 9:87016342-87016364 ATGAGATAGTCCAAGGGTAAAGG + Intergenic
1057877462 9:98768674-98768696 AAGGGAGAGTCAAAGGGTGAGGG - Intronic
1061241645 9:129377937-129377959 AAGGCATAGCACAAGGGTTAGGG - Intergenic
1190057177 X:47187672-47187694 ATGGGAGAAAAAAAGGGTGAAGG + Intergenic
1191901537 X:66045805-66045827 ATGGGAACGGAAAAGGGTGAGGG + Intergenic
1192784514 X:74323371-74323393 CTGGACTAGTACAAGGGTGGGGG + Intergenic
1195062100 X:101206121-101206143 ATGGCATAGTAAAAGGGAGTGGG + Intergenic
1195903867 X:109825309-109825331 ATGGGATTATACATGGCTGATGG - Intergenic
1199091955 X:143702939-143702961 ATGGCCTAATACAGGGGTGATGG + Intergenic