ID: 1140813783

View in Genome Browser
Species Human (GRCh38)
Location 16:78602520-78602542
Sequence TATCGAGAAGAGGCCGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 1, 2: 3, 3: 68, 4: 578}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140813783_1140813788 14 Left 1140813783 16:78602520-78602542 CCACACCCGGCCTCTTCTCGATA 0: 1
1: 1
2: 3
3: 68
4: 578
Right 1140813788 16:78602557-78602579 GACAACGAAAGCTGTTGTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140813783 Original CRISPR TATCGAGAAGAGGCCGGGTG TGG (reversed) Intronic
901093043 1:6655811-6655833 AAACAAGAACAGGCCGGGTGTGG + Intronic
901270350 1:7948378-7948400 TGTTGAGCATAGGCCGGGTGCGG + Intergenic
901502456 1:9661568-9661590 TTTTTAGTAGAGGCCGGGTGTGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902140502 1:14349844-14349866 TAGTGACAAGAGGCCCGGTGCGG + Intergenic
902190903 1:14762433-14762455 AAAGAAGAAGAGGCCGGGTGCGG + Intronic
903143068 1:21351504-21351526 TATTTAGTAGAGGCCAGGTGTGG - Intergenic
904065711 1:27748769-27748791 CTTCAATAAGAGGCCGGGTGCGG - Intronic
904080772 1:27871460-27871482 CAGGGAGAAGAGGCTGGGTGTGG - Intergenic
904100252 1:28019990-28020012 TATGGAGAAGTAGCCGGGCGTGG - Intronic
904476449 1:30768094-30768116 AATGGTGAAAAGGCCGGGTGTGG - Intergenic
904690105 1:32287438-32287460 TAAAAAAAAGAGGCCGGGTGTGG - Intergenic
906072365 1:43026365-43026387 AAGGGAGAACAGGCCGGGTGCGG + Intergenic
906291046 1:44619346-44619368 TCTAGAGAAGAGGCGGGGTGTGG + Intronic
907221878 1:52912974-52912996 TATAAAGAAATGGCCGGGTGTGG - Intronic
907352566 1:53844871-53844893 AATCAAGAACTGGCCGGGTGCGG - Intergenic
908234210 1:62134633-62134655 TAAAGAAAAGAGGCCGGGCGTGG - Intronic
908353848 1:63312489-63312511 TAACTAAAAGAGGCTGGGTGCGG - Intergenic
908577328 1:65474715-65474737 TAGCAAGAAAAGGCCAGGTGCGG + Intronic
910909310 1:92216987-92217009 TATAAACAAGAGGCCAGGTGTGG + Intergenic
911995288 1:104758222-104758244 TATGGGGAAGAGGGGGGGTGGGG + Intergenic
912658283 1:111507130-111507152 TTACTAGAAGAGGCTGGGTGTGG + Intronic
913187807 1:116385834-116385856 AGTAGAGAAGAGGCCGGGTGCGG + Intronic
913968030 1:143392990-143393012 TAAAGAGAAGAAGCCAGGTGTGG - Intergenic
914062411 1:144218580-144218602 TAAAGAGAAGAAGCCAGGTGTGG - Intergenic
914116739 1:144747774-144747796 TAAAGAGAAGAAGCCAGGTGTGG + Intergenic
914350269 1:146834222-146834244 ATTAGAGAATAGGCCGGGTGCGG - Intergenic
914735766 1:150415032-150415054 TATAAATAAGAGGTCGGGTGCGG + Intronic
914819095 1:151085953-151085975 GGTAGAGAAGAGGCTGGGTGTGG + Intronic
915393578 1:155564829-155564851 TATTGAAATGAGGCTGGGTGTGG + Intergenic
915959719 1:160255422-160255444 GAGGGAGAAGAGGCCAGGTGTGG - Intronic
916102010 1:161400690-161400712 AATTAAGAAGAGGCCGGGCGCGG + Intergenic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
917869577 1:179229538-179229560 TGCCGTGAGGAGGCCGGGTGCGG - Exonic
920130630 1:203729254-203729276 AGTGGAAAAGAGGCCGGGTGCGG + Intronic
920170155 1:204066965-204066987 GATCTGGAAGAAGCCGGGTGCGG - Intergenic
920283503 1:204861777-204861799 AAGTGAGAAGAGGCCGGGTGCGG - Intronic
920801188 1:209189051-209189073 TACTGAAAAGAGGCCAGGTGTGG + Intergenic
921192577 1:212723976-212723998 AATCAAGCAGAGGCCAGGTGTGG + Intergenic
921517948 1:216120667-216120689 AGTGGAGACGAGGCCGGGTGCGG - Intronic
922166605 1:223120789-223120811 GTTTGAGAAGAGGCAGGGTGTGG + Intronic
922688485 1:227667033-227667055 AAAAGAGGAGAGGCCGGGTGCGG - Intronic
923714477 1:236413152-236413174 TTTCAAAAAGAGGCTGGGTGCGG - Intronic
924366708 1:243301955-243301977 TATTTAGGAGAGGCTGGGTGTGG + Intronic
924804260 1:247349838-247349860 CATCTAGCAGAGGCTGGGTGTGG + Intergenic
1062794446 10:333191-333213 TAAAAAGAATAGGCCGGGTGCGG - Intronic
1063140053 10:3248063-3248085 AAATAAGAAGAGGCCGGGTGTGG + Intergenic
1063187338 10:3663391-3663413 TGTAGAAAAGAGGCTGGGTGTGG - Intergenic
1063788780 10:9415695-9415717 TTTGGAGAAGAGACCGTGTGGGG - Intergenic
1064016518 10:11776850-11776872 AATCAAGAAGGGGCCTGGTGAGG - Intergenic
1064545293 10:16444281-16444303 AAAAGAAAAGAGGCCGGGTGCGG - Intronic
1064609924 10:17087763-17087785 TTCCACGAAGAGGCCGGGTGTGG - Intronic
1065557169 10:26928142-26928164 TAGTAAGAAGAGGCCGGATGTGG + Intergenic
1065708168 10:28490093-28490115 TAACTAAAAGAGGCCGGGCGTGG - Intergenic
1067271922 10:44799200-44799222 TATAGCAAAGAGGCTGGGTGTGG + Intergenic
1068475173 10:57515227-57515249 TATATAAAAGAGGCCAGGTGCGG - Intergenic
1069036264 10:63648936-63648958 AGTGGAGAGGAGGCCGGGTGTGG + Intergenic
1069037581 10:63661527-63661549 CATCAAGAAGAGGCCGGGCGTGG + Intergenic
1069310147 10:67024837-67024859 AAACCACAAGAGGCCGGGTGGGG + Intronic
1069505165 10:68990978-68991000 TATGTAGAAAAGGCCGGATGTGG + Intronic
1069580024 10:69559542-69559564 GAGTGAGAAGAGGCGGGGTGGGG + Intergenic
1069763697 10:70835445-70835467 TGCCAAGAAGAGGCCGGGTGCGG + Intronic
1072095555 10:92175797-92175819 TATCTAAACGTGGCCGGGTGTGG + Intronic
1072354203 10:94589975-94589997 AAGGGAGAAGAGGCCGGGTACGG - Intronic
1073040794 10:100603688-100603710 AAACGAATAGAGGCCGGGTGCGG + Intergenic
1073140820 10:101246453-101246475 AGTCCAGGAGAGGCCGGGTGTGG + Intergenic
1073238483 10:102037472-102037494 AATCCAGAAGAGGCTAGGTGTGG - Intronic
1073264346 10:102215975-102215997 TAAAGAGAATAGGCCAGGTGCGG - Intergenic
1073265801 10:102227771-102227793 TCTAGAGAAGAGGCAGGGAGTGG - Intronic
1075335047 10:121602636-121602658 GATCTAGGAGAGGCCGGGTGCGG - Intergenic
1075403829 10:122180626-122180648 TCGAGGGAAGAGGCCGGGTGCGG - Intronic
1075825552 10:125354677-125354699 TAGCTAGACGAGGCCGGGCGCGG + Intergenic
1075882692 10:125867444-125867466 AATCAAGGACAGGCCGGGTGTGG + Intronic
1076745851 10:132513213-132513235 TATTAAGAATAGGCCGGGCGTGG + Intergenic
1077099980 11:818422-818444 AAATGAGAGGAGGCCGGGTGTGG - Intergenic
1077132815 11:982339-982361 AATCTCAAAGAGGCCGGGTGCGG - Intronic
1077885811 11:6386929-6386951 TATGGCAAAGTGGCCGGGTGCGG + Intergenic
1078005082 11:7526579-7526601 TGTGCAGAAGCGGCCGGGTGCGG + Intronic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1079287067 11:19144823-19144845 TATTGCTAATAGGCCGGGTGTGG + Intronic
1079405013 11:20137147-20137169 TTTCAAGATAAGGCCGGGTGTGG + Intergenic
1079435206 11:20440353-20440375 TCTTAAAAAGAGGCCGGGTGTGG + Intronic
1081362811 11:42201049-42201071 TATCCAGTAAAGGCCAGGTGCGG - Intergenic
1081411070 11:42759199-42759221 AAGTGACAAGAGGCCGGGTGTGG + Intergenic
1082772589 11:57219854-57219876 AATGGAGAAGAGGAGGGGTGGGG + Intergenic
1084224710 11:67708730-67708752 TATAGAGCTGAGGCCGGGCGTGG - Intergenic
1084262529 11:67988595-67988617 TATAGAGCTGAGGCCGGGCGTGG - Intergenic
1084677305 11:70643271-70643293 TAAAAAGCAGAGGCCGGGTGCGG + Intronic
1085468451 11:76740060-76740082 TGTCGAGCACAGGCAGGGTGAGG + Intergenic
1085632779 11:78133123-78133145 TAGGAAGAAGAGGCTGGGTGTGG - Intronic
1086357823 11:86023835-86023857 TTTCAAAAAGAGGCCAGGTGTGG + Intronic
1087465797 11:98503515-98503537 TAGAGAGTAGAGGCCGAGTGCGG - Intergenic
1087764072 11:102130691-102130713 TATCCAGGAGAGGTCAGGTGTGG - Intronic
1088061210 11:105653199-105653221 AAGCAAGAAAAGGCCGGGTGCGG - Intronic
1088112940 11:106282791-106282813 TGTAGAGAAGAGGCTGGCTGAGG - Intergenic
1088769579 11:113020284-113020306 CATCAGGAAGAGGCTGGGTGAGG + Intronic
1089013650 11:115149393-115149415 TGTCAAGATGAGGCAGGGTGTGG + Intergenic
1089531254 11:119131377-119131399 AATGGAGGAGTGGCCGGGTGCGG - Intronic
1090062780 11:123478080-123478102 AAAAGAGAAGAGGCTGGGTGTGG - Intergenic
1090365496 11:126201908-126201930 AATGGAGAAGAGGCTGGGCGCGG - Intergenic
1090389530 11:126379766-126379788 TAAGGATAACAGGCCGGGTGTGG - Intronic
1091710427 12:2736268-2736290 CATAGAGAAGAGGCCACGTGAGG + Intergenic
1092153226 12:6265580-6265602 TATGAAGAAGCGGCCGGGCGTGG + Intergenic
1092176128 12:6408530-6408552 TAAGAAGAAGAGGCTGGGTGTGG - Intergenic
1092891228 12:12971017-12971039 AAGTGAGAATAGGCCGGGTGTGG + Intergenic
1093462488 12:19419297-19419319 TATGGAAAATAGGCCGGGTGCGG + Intronic
1094364314 12:29663805-29663827 TATGGAGAATTGGCTGGGTGTGG - Intronic
1094610342 12:31989559-31989581 AATTGAGTAGAGGCCGGGCGAGG + Intronic
1095880206 12:47127652-47127674 TAAAAAGCAGAGGCCGGGTGTGG - Intronic
1096067361 12:48751774-48751796 TATTGTGGAGAGGCCGGGTGCGG + Intergenic
1097295047 12:57953907-57953929 TAATGAAAAGAGGCCTGGTGCGG + Intronic
1099960072 12:89388363-89388385 GAAAAAGAAGAGGCCGGGTGCGG - Intergenic
1100476039 12:94936190-94936212 AATTGATATGAGGCCGGGTGTGG - Intronic
1100545597 12:95599063-95599085 TATAGGGAAGAGGCCGGGCGCGG - Intergenic
1100952635 12:99868765-99868787 TTTAAGGAAGAGGCCGGGTGTGG + Intronic
1100976714 12:100130248-100130270 TAATGAAATGAGGCCGGGTGTGG - Intronic
1101354472 12:103964406-103964428 TAACGTGAGGAGGCCGGGCGTGG - Intronic
1101666986 12:106826461-106826483 TATATAAAATAGGCCGGGTGTGG + Intronic
1101901787 12:108796204-108796226 GGTCAAGATGAGGCCGGGTGTGG - Intronic
1102061321 12:109933889-109933911 TATGCAGTCGAGGCCGGGTGTGG - Intronic
1102163304 12:110786576-110786598 AACCCTGAAGAGGCCGGGTGTGG + Intergenic
1102258977 12:111431898-111431920 GACAGAGAAGAGGCTGGGTGTGG - Intronic
1102310230 12:111838990-111839012 TATCAAGAATTGGCCAGGTGTGG + Intergenic
1102370322 12:112377578-112377600 TACTGGGAAGAGGCCGGGTGCGG + Intronic
1102526631 12:113516580-113516602 AAAAGAAAAGAGGCCGGGTGTGG - Intergenic
1103750375 12:123154862-123154884 TACCAAGAATAGGCCGGGTGTGG + Exonic
1103831885 12:123786845-123786867 TATATAGATGAGGCCGGGTGCGG + Intronic
1105366890 13:19773526-19773548 TATAAAAAACAGGCCGGGTGCGG - Intronic
1105381453 13:19891251-19891273 CATGGAGAAGAGGCCGCGTGAGG + Intergenic
1105985592 13:25563117-25563139 TTTCAAGAGGAGGCCAGGTGCGG + Intronic
1106580653 13:31015620-31015642 AAACGAGAAAAGGCCGGGCGCGG + Intergenic
1107078835 13:36352653-36352675 AACTGAGAAGAGGCCAGGTGTGG + Intronic
1107389070 13:39944550-39944572 TATGGAGAAGAGGGGTGGTGAGG - Intergenic
1107507668 13:41050837-41050859 AATCTGAAAGAGGCCGGGTGTGG - Intronic
1107640739 13:42440796-42440818 TAAGGAAAAGAGGCCGGGCGCGG + Intergenic
1107954443 13:45496961-45496983 TAACTTGAAGGGGCCGGGTGCGG - Intronic
1108670860 13:52686778-52686800 TATCCAGATGGGGCTGGGTGCGG + Intronic
1110208297 13:72944154-72944176 TATTCAGAATAAGCCGGGTGTGG + Intronic
1110601337 13:77377849-77377871 TATAAAGCAGAGGCCGGGCGCGG - Intergenic
1111244054 13:85511767-85511789 TTGAGAGGAGAGGCCGGGTGCGG + Intergenic
1111813264 13:93118912-93118934 ATTGGAGAAGAGGCTGGGTGTGG + Intergenic
1112380781 13:98887324-98887346 TATGGATAATAGGCCGGGTGGGG + Intronic
1112456859 13:99570917-99570939 AATCCAGTGGAGGCCGGGTGCGG - Intergenic
1112853233 13:103732835-103732857 TTTTCAGTAGAGGCCGGGTGCGG - Intergenic
1113044449 13:106140464-106140486 TAACAATAATAGGCCGGGTGCGG - Intergenic
1113111052 13:106823958-106823980 CATGAAGAAGAGGCCGGGCGCGG - Intergenic
1113480059 13:110614198-110614220 TATTATGAAGAGGCCGGGCGTGG - Intergenic
1113535130 13:111060224-111060246 TAGCAAGAACAGGCCAGGTGTGG + Intergenic
1113647860 13:112011635-112011657 GAAGGAGAAGAGGCCGGGCGCGG - Intergenic
1114428567 14:22640809-22640831 TATCAAGAAGAGGCTGGGTGTGG - Intergenic
1115534411 14:34358929-34358951 TATGAAGAAAAGGCCAGGTGCGG - Intronic
1115995340 14:39189815-39189837 TAGAAAGGAGAGGCCGGGTGTGG - Intergenic
1117017861 14:51536705-51536727 TATGGACAAGAGGCCAGGTGCGG - Intronic
1117802068 14:59454809-59454831 AATCAAGGAGAGGCCGGGTGCGG + Intronic
1118296355 14:64573620-64573642 AAGCGAAAATAGGCCGGGTGTGG + Intronic
1118555166 14:67010258-67010280 AATCAAGAATAGGCCGGGCGCGG + Intronic
1119036462 14:71233786-71233808 TATGAATAACAGGCCGGGTGTGG + Intergenic
1119297158 14:73542286-73542308 TGTCTATAAGAGGCCAGGTGTGG - Intronic
1119301401 14:73574159-73574181 TGTCTATAAGAGGCCAGGTGTGG - Intronic
1119589307 14:75870396-75870418 AATTGAGGAGAGGCCGGGCGTGG - Intronic
1119658685 14:76435537-76435559 TATGGAAATGAGGCGGGGTGTGG + Intronic
1119914715 14:78387069-78387091 TATTAAGTATAGGCCGGGTGCGG - Intronic
1120517668 14:85489810-85489832 TATAGCGAAGAAGCAGGGTGAGG - Intergenic
1121000155 14:90445963-90445985 TACCTAGAAGAGGCCGGGCATGG - Intergenic
1121068549 14:90994163-90994185 TATAGAGGATAGGCCGGGTGTGG - Intronic
1121090624 14:91179459-91179481 TATATAGATGAGGCTGGGTGCGG + Intronic
1122514074 14:102294154-102294176 TAGCCAGGTGAGGCCGGGTGCGG + Intronic
1122686801 14:103512440-103512462 TTTAGGGAGGAGGCCGGGTGTGG - Intergenic
1122897547 14:104767867-104767889 TATCCCTAAGAGGCCAGGTGTGG + Intronic
1122955974 14:105071466-105071488 AAGCCAGAAGTGGCCGGGTGCGG - Intergenic
1123911570 15:24973177-24973199 AACAGAGAAGAGGCTGGGTGTGG - Intronic
1124058860 15:26268611-26268633 TAACGCGAAGTGGCTGGGTGTGG - Intergenic
1124350224 15:28949757-28949779 CAACAACAAGAGGCCGGGTGTGG - Intronic
1124930783 15:34117274-34117296 AAACAAGAAGAGGCAGGGTGTGG - Intergenic
1125427691 15:39566253-39566275 TGTCCCGCAGAGGCCGGGTGCGG + Intergenic
1125712180 15:41795897-41795919 TATAAATGAGAGGCCGGGTGTGG - Intronic
1125934841 15:43626191-43626213 GATTCAGAAGTGGCCGGGTGTGG - Intergenic
1126414274 15:48401626-48401648 TATGGAGAGGAGGCAGGCTGGGG + Intergenic
1126847224 15:52772102-52772124 AAGCGAGATGTGGCCGGGTGCGG + Intronic
1127251340 15:57241380-57241402 GATCAATAATAGGCCGGGTGCGG - Intronic
1128047498 15:64631832-64631854 TATAGAGTTGTGGCCGGGTGTGG - Intronic
1128352631 15:66901245-66901267 GAACCAGAAGAGGCAGGGTGTGG + Intergenic
1128493524 15:68174660-68174682 TATTAAGTAGAGGCTGGGTGTGG - Intronic
1129123920 15:73421729-73421751 AATCTAGAAGTGGCCAGGTGTGG + Intergenic
1129768170 15:78183284-78183306 TTACAAAAAGAGGCCGGGTGTGG + Intronic
1129775812 15:78235619-78235641 TAACGAAAATAGGTCGGGTGCGG + Intronic
1130318230 15:82815058-82815080 TATGAAAAACAGGCCGGGTGCGG - Intronic
1130638404 15:85647106-85647128 TTACAAGAATAGGCCGGGTGTGG + Intronic
1131504690 15:93006413-93006435 GAGAGAGAAAAGGCCGGGTGCGG - Intronic
1131540930 15:93274735-93274757 TAACAAGGAGAGGCCGGGTGTGG + Intergenic
1131710818 15:95054318-95054340 TACCAACTAGAGGCCGGGTGCGG - Intergenic
1133375915 16:5287012-5287034 TAAAAAGAAGAGGCTGGGTGTGG + Intergenic
1134133588 16:11665985-11666007 AATGGAGATGAGGCCGGGTGCGG - Intergenic
1134263566 16:12673754-12673776 AATAAAGATGAGGCCGGGTGCGG + Intronic
1134542531 16:15079098-15079120 TATGAAGAGGAGGCCGGGCGTGG - Intronic
1135010320 16:18871687-18871709 AATAGCAAAGAGGCCGGGTGTGG + Intronic
1135032285 16:19047987-19048009 CATCAAGAGTAGGCCGGGTGCGG - Intronic
1135116757 16:19730244-19730266 AATCAGCAAGAGGCCGGGTGCGG - Intronic
1135360108 16:21805176-21805198 TATGAAGAGGAGGCTGGGTGTGG - Intergenic
1135789142 16:25377409-25377431 TACACAGGAGAGGCCGGGTGTGG - Intergenic
1136262698 16:29091764-29091786 TATGAAGAGGAGGCCGGGTGTGG + Intergenic
1136353773 16:29729890-29729912 TACCGCCAACAGGCCGGGTGCGG + Intergenic
1137290043 16:47046303-47046325 TTTCAAGAATAGGCCGGGAGCGG + Intergenic
1137700901 16:50497061-50497083 TAAAGAAAATAGGCCGGGTGAGG - Intergenic
1139740279 16:69029815-69029837 TAAGAAGAACAGGCCGGGTGTGG + Intronic
1139839119 16:69864071-69864093 TACCTAGGAGAGGCCAGGTGTGG + Intronic
1139938493 16:70588193-70588215 TAACAAGTAGAGGCCGGGTGCGG + Intronic
1139983771 16:70881316-70881338 ATTAGAGAATAGGCCGGGTGCGG + Intronic
1140343034 16:74184280-74184302 TAACTAAAAGAGGCCGGGAGTGG + Intergenic
1140759164 16:78096028-78096050 AAGGGAGAAGAGGCCGGGAGTGG + Intergenic
1140813783 16:78602520-78602542 TATCGAGAAGAGGCCGGGTGTGG - Intronic
1141952403 16:87347401-87347423 TATCAGAATGAGGCCGGGTGCGG + Intronic
1142737048 17:1907699-1907721 AATGGAGAAGGGGCCGGGTGGGG + Intergenic
1142918262 17:3161605-3161627 TAACGAGAAAAGGCCGGGCGCGG - Intergenic
1143638525 17:8181422-8181444 TATCCAGAAGAGACAGGATGAGG + Intergenic
1144101827 17:11948518-11948540 GAGCCAGAGGAGGCCGGGTGCGG - Intronic
1144552370 17:16252360-16252382 AAAGGAAAAGAGGCCGGGTGGGG - Intronic
1146185911 17:30724092-30724114 TCTAGAGAAGAGGCCCTGTGAGG + Intergenic
1146444993 17:32926677-32926699 TGACAAGAACAGGCCGGGTGCGG + Intergenic
1147379199 17:40043224-40043246 TATTAACAACAGGCCGGGTGTGG - Intronic
1147680267 17:42238957-42238979 AAAAAAGAAGAGGCCGGGTGCGG + Intronic
1147975167 17:44243369-44243391 TATAGGGGTGAGGCCGGGTGCGG + Intergenic
1148321903 17:46761623-46761645 TAATGAGAACAGGCTGGGTGGGG - Intergenic
1148621663 17:49039164-49039186 ATTAGAGAAAAGGCCGGGTGTGG - Intronic
1148761551 17:50004724-50004746 ACACAAGAAGAGGCCGGGTGTGG + Intergenic
1148878046 17:50704222-50704244 AATCTACAAGAGGCCGGGCGCGG + Intronic
1149054765 17:52350317-52350339 AATGGAAAATAGGCCGGGTGTGG - Intergenic
1149151510 17:53570235-53570257 TAAACAGAGGAGGCCGGGTGCGG + Intergenic
1149546928 17:57510716-57510738 AACCAAGAGGAGGCCGGGTGTGG - Intronic
1149710278 17:58735485-58735507 TATAGAAATGAGGCCAGGTGTGG - Exonic
1149771361 17:59324439-59324461 TTTTTAGAAGAGGCCGGGTTTGG + Intergenic
1149866099 17:60151858-60151880 TTGAGACAAGAGGCCGGGTGAGG + Intronic
1150115669 17:62546848-62546870 CTCCCAGAAGAGGCCGGGTGCGG - Intronic
1150255172 17:63738859-63738881 AATGGGGAACAGGCCGGGTGCGG + Intronic
1150315577 17:64166146-64166168 CATCCTGAAGAGGCTGGGTGGGG - Intronic
1150954626 17:69843557-69843579 TTTTAAAAAGAGGCCGGGTGTGG + Intergenic
1152026765 17:77814940-77814962 AATTAAAAAGAGGCCGGGTGTGG - Intergenic
1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG + Intergenic
1152435163 17:80271992-80272014 AAAAGAAAAGAGGCCGGGTGGGG + Intronic
1152584999 17:81185051-81185073 TAAAAAGAAGGGGCCGGGTGCGG + Intergenic
1152620484 17:81361876-81361898 TAAATAAAAGAGGCCGGGTGCGG - Intergenic
1153014493 18:571376-571398 TAACTAGCTGAGGCCGGGTGAGG + Intergenic
1153175147 18:2363558-2363580 TAATGAGAAGAGGCCAGGCGAGG - Intergenic
1153639728 18:7146497-7146519 TATCTAGAAGAGGCCAGGTGCGG + Intergenic
1153765680 18:8372362-8372384 TATAGAGTGGAGGCCGGGCGCGG - Intronic
1154313703 18:13286828-13286850 TGTGGAGAAGAGGCCTGGGGTGG + Intronic
1155235425 18:23813830-23813852 TGTTCAGAATAGGCCGGGTGTGG - Intronic
1157828136 18:50831140-50831162 AATAGACAAGAGGCCGGGCGCGG - Intergenic
1157868335 18:51205931-51205953 TATGGAAAAAAGGCCAGGTGCGG + Intronic
1158020835 18:52839553-52839575 TGTCAAGAAGAGGGCTGGTGGGG - Intronic
1158938245 18:62384516-62384538 TAAAGAGAAGAGGCGGGGAGAGG - Intronic
1158977657 18:62726935-62726957 TAGGAAGGAGAGGCCGGGTGCGG + Intronic
1159030088 18:63221988-63222010 TATAGAAAAGAGGCCGGGCATGG + Intronic
1159556933 18:69955575-69955597 TTTCCACAGGAGGCCGGGTGCGG + Intronic
1159833789 18:73311617-73311639 TGTCAAGAATAGGCCGGGCGCGG + Intergenic
1160556119 18:79726680-79726702 CATCAAAAAGAGGCCGTGTGGGG - Intronic
1160753825 19:747643-747665 GATGGAGAAGAGGCCGGGGGCGG - Exonic
1160969937 19:1763071-1763093 TAGCCAGATGTGGCCGGGTGCGG + Intronic
1161071067 19:2261362-2261384 TAGCAAAAATAGGCCGGGTGTGG - Intronic
1161161941 19:2766724-2766746 AAGCAAGAAGAGGCCGGGCGCGG - Intronic
1161371927 19:3917292-3917314 AAAAGAGAAGAGGCCGGGCGCGG + Intronic
1161679861 19:5674503-5674525 TAATAAGAAGAGGCCGGGCGCGG - Intergenic
1162259738 19:9522727-9522749 GATTGAAAAGAGGCCAGGTGTGG + Intergenic
1162324359 19:9990101-9990123 TAACTAAAAGAGGCCGGGCGTGG + Intronic
1162364826 19:10242215-10242237 AAGCAAAAAGAGGCCGGGTGCGG + Intergenic
1162972865 19:14191637-14191659 TCTAGAGAAGAGGCCCTGTGAGG - Intronic
1163341724 19:16712304-16712326 TATCAGGTACAGGCCGGGTGTGG - Intergenic
1163498541 19:17661742-17661764 TCTCTAGAAGAGGCGGGGTATGG + Intronic
1163565240 19:18047227-18047249 AATCAAAGAGAGGCCGGGTGCGG - Intergenic
1163575215 19:18107104-18107126 TAGCCAGAGTAGGCCGGGTGCGG - Intronic
1163666867 19:18607364-18607386 AATCGAAAAGAGGCAGGATGAGG - Intronic
1163689901 19:18732798-18732820 TAACTACAGGAGGCCGGGTGTGG + Intronic
1163921183 19:20290388-20290410 AAAGGAGAAGAGGCCGGGCGCGG - Intergenic
1164000874 19:21097154-21097176 TATCCTGAACAGGCCGGGCGTGG - Intronic
1164968492 19:32509342-32509364 TATGAACAACAGGCCGGGTGCGG - Intergenic
1165043118 19:33082946-33082968 AATAGAGATGAGGCCGGGCGTGG + Intronic
1165499280 19:36174837-36174859 AAAAGAGAAGGGGCCGGGTGCGG - Intergenic
1165559640 19:36667936-36667958 TCTCAAAAAGAGGCCGGGCGCGG - Intergenic
1165763518 19:38336310-38336332 CATCGAGAAGGGGCAGGGCGAGG + Intronic
1165844992 19:38812519-38812541 TCTGGAGAAGAGGCCTGGTGAGG + Exonic
1166006061 19:39907678-39907700 TAGAGTGAAGAGGCCGGGCGCGG + Intronic
1166649297 19:44559425-44559447 TAATTAAAAGAGGCCGGGTGGGG + Intergenic
1166834961 19:45661731-45661753 TAACCAGAAAAGGCCTGGTGCGG - Intergenic
1167793736 19:51695773-51695795 GAGAGAGAAGAGGCTGGGTGAGG + Intergenic
1167969631 19:53180140-53180162 AATAGAGAACAGGCTGGGTGTGG + Intronic
1168135205 19:54346383-54346405 AAACAAGAATAGGCCGGGTGCGG + Intergenic
1168212537 19:54900992-54901014 TACCAAAAAAAGGCCGGGTGCGG + Intergenic
1168217076 19:54934229-54934251 TACCAAAAACAGGCCGGGTGCGG - Intronic
1168362335 19:55752529-55752551 TAACTAAAAGAGGCCGGGCGCGG - Intergenic
1168514180 19:56996984-56997006 TATTCAGTACAGGCCGGGTGCGG + Intergenic
1202634418 1_KI270706v1_random:31405-31427 AATTGAAGAGAGGCCGGGTGCGG + Intergenic
1202651458 1_KI270707v1_random:8626-8648 AATTGAAGAGAGGCCGGGTGTGG - Intergenic
1202701819 1_KI270712v1_random:170458-170480 TAAAGAGAAGAAGCCAGGTGTGG - Intergenic
925236852 2:2286270-2286292 AATGAAGAACAGGCCGGGTGTGG - Intronic
925315867 2:2922598-2922620 AATGAAGATGAGGCCGGGTGCGG + Intergenic
926211614 2:10874970-10874992 TATCCCTCAGAGGCCGGGTGTGG - Intergenic
927302627 2:21533733-21533755 AATAGAGGAGAGGCTGGGTGCGG - Intergenic
927419783 2:22918445-22918467 GATAGAGATTAGGCCGGGTGTGG + Intergenic
927549941 2:23989541-23989563 TATAGAAATAAGGCCGGGTGTGG - Intronic
928650377 2:33397810-33397832 GATGGAGAAGAGGCCAGGCGTGG - Intronic
928667708 2:33567277-33567299 TATGGAGTATAGGCCGGGTGCGG + Intergenic
929220231 2:39456392-39456414 TGGCAAGAAGAGGCCAGGTGTGG + Intergenic
929290155 2:40181248-40181270 TATAGAAAATAGGCCAGGTGTGG - Intronic
929290526 2:40185590-40185612 TAGAGATAAAAGGCCGGGTGGGG + Intronic
930097288 2:47574939-47574961 TATCCCAAGGAGGCCGGGTGCGG + Intergenic
930808447 2:55516636-55516658 TATGTATAACAGGCCGGGTGCGG - Intergenic
931378783 2:61732641-61732663 TATCTAGAACAGGCCGGGCGCGG - Intergenic
931780673 2:65576956-65576978 TAGTGAGAAGAGCCAGGGTGTGG - Intergenic
932590864 2:73066265-73066287 GATACAAAAGAGGCCGGGTGTGG + Intronic
932843933 2:75115614-75115636 AATAGAGAAGAGGCCGGGCACGG + Intronic
932856288 2:75237084-75237106 AATCAAGAAGAGGCCGGGCGCGG - Intergenic
933676190 2:85059922-85059944 TATAGAAATGAGGCCAGGTGTGG - Intergenic
933871670 2:86572536-86572558 CATGGAGAAGAGGCCATGTGTGG - Intronic
934172729 2:89553905-89553927 TAAAGAGAAGAAGCCAGGTGTGG - Intergenic
934283044 2:91628257-91628279 TAAAGAGAAGAAGCCAGGTGTGG - Intergenic
934554372 2:95279583-95279605 TATGCAGAAGCGGCCGGGCGCGG - Intronic
936915189 2:117633063-117633085 AATTGAGATGAGGCTGGGTGCGG - Intergenic
937765388 2:125655255-125655277 TAAAGAAAAGAGGCCGGGCGCGG + Intergenic
939380126 2:141424400-141424422 TAAGAAGATGAGGCCGGGTGCGG - Intronic
939669736 2:144995449-144995471 TAAGGGGAAAAGGCCGGGTGTGG - Intergenic
940223196 2:151375416-151375438 TATCAAGCATAGGCCTGGTGTGG + Intronic
940558939 2:155269272-155269294 AAGCAAGAAGAGGCCAGGTGCGG + Intergenic
940918100 2:159280399-159280421 TACCCAGAAGTGGCCGGGCGCGG + Intronic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
943614274 2:190074359-190074381 AATAGAGAAAAGGCCAGGTGCGG + Intronic
944239053 2:197468148-197468170 TAGTCAGAGGAGGCCGGGTGTGG + Intronic
944743324 2:202633492-202633514 CCTAGAGAGGAGGCCGGGTGTGG - Intergenic
944809957 2:203318290-203318312 TAAAGAGAAAAGGCCGGGTGTGG + Intergenic
945081238 2:206088036-206088058 AATCCAGAATAGGCCGGGCGCGG - Intergenic
945254997 2:207796054-207796076 TATCTACATGCGGCCGGGTGTGG + Intergenic
945488020 2:210421519-210421541 AAATGAGAATAGGCCGGGTGTGG - Intergenic
945693833 2:213077876-213077898 TACATAGAATAGGCCGGGTGCGG - Intronic
945738074 2:213625978-213626000 TTTTTAGTAGAGGCCGGGTGTGG - Intronic
945988679 2:216374924-216374946 GATTGAGAAGTGGCCGGGCGTGG + Intergenic
946722634 2:222626741-222626763 TATTGAAAAGAGGCTGGATGCGG + Intronic
946739310 2:222786174-222786196 AATCTGGAACAGGCCGGGTGCGG - Intergenic
946830362 2:223722365-223722387 TAGCGTGAACAGGCCGGGCGTGG - Intergenic
947377919 2:229515930-229515952 TAACTTGAAGAGGCTGGGTGCGG - Intronic
947457448 2:230268231-230268253 TAGACAGAAGAGGCCGGGTGTGG + Intronic
948025540 2:234773165-234773187 TATTGAGAAGAGGCTGGAGGGGG + Intergenic
948389935 2:237604712-237604734 AATGGAGAAACGGCCGGGTGTGG + Intergenic
1170683995 20:18552521-18552543 TATACAGCACAGGCCGGGTGTGG + Intronic
1171485557 20:25483042-25483064 TAAAGAAAAGAGGCCAGGTGTGG + Intronic
1172568624 20:35951899-35951921 AATATAGAATAGGCCGGGTGCGG - Intergenic
1172609765 20:36241494-36241516 TATCATCAAGTGGCCGGGTGTGG + Intronic
1172636507 20:36413707-36413729 TGTCCAGAATAGGCCGGGCGCGG - Intronic
1172739455 20:37154287-37154309 AATCCAGAAGAGGACGGGCGTGG + Intronic
1173442980 20:43094685-43094707 TAAAGAGAAGAGGCCGGGCATGG - Intronic
1174805740 20:53603137-53603159 TATAGACAACAGGCCGGGCGCGG + Intronic
1175637938 20:60601161-60601183 AATCGAGACCAGGCCGGGTGTGG - Intergenic
1175730710 20:61352005-61352027 TAACTAAAGGAGGCCGGGTGCGG - Intronic
1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG + Intronic
1176646641 21:9357179-9357201 AATTGAAGAGAGGCCGGGTGCGG + Intergenic
1177663896 21:24126544-24126566 TATTGAGTAGCGGCCGGGTACGG + Intergenic
1177679511 21:24347556-24347578 TATTGAGAAGAGGCTGGGCGTGG - Intergenic
1178073557 21:28994819-28994841 TACAGAGAATAGGCCGGGTGCGG + Intergenic
1178138815 21:29658668-29658690 TATCTAAAATAGGCAGGGTGTGG + Intronic
1178320424 21:31600974-31600996 AAAAGAGAAGAGGCCGGGTGTGG + Intergenic
1180342973 22:11682558-11682580 AATTGAAGAGAGGCCGGGTGTGG + Intergenic
1180734052 22:18002338-18002360 TATAGAGCAGAGGGCGGGCGCGG + Intronic
1180795050 22:18599267-18599289 AATAGAGATGAGGCCGGGTGTGG + Intergenic
1181226688 22:21396049-21396071 AATAGAGATGAGGCCGGGTGTGG - Intergenic
1181251961 22:21538803-21538825 AATAGAGATGAGGCCGGGTGTGG + Intergenic
1181845148 22:25700872-25700894 TACCCAAAAGAGGCCGGGCGCGG - Intronic
1182214109 22:28701500-28701522 TATAGACAACAGGCTGGGTGTGG - Intronic
1182536502 22:31007756-31007778 TAAGAAGAGGAGGCCGGGTGTGG + Intergenic
1182660378 22:31920761-31920783 AATACAGAACAGGCCGGGTGTGG + Intergenic
1183273584 22:36877425-36877447 AAGGGAGAAGAGGCTGGGTGCGG - Intronic
1183288582 22:36983504-36983526 TCCAGAGGAGAGGCCGGGTGCGG - Intergenic
1183451799 22:37900170-37900192 TAGAGAGTAGAGGCCTGGTGTGG - Intergenic
1183906399 22:41044149-41044171 TATCAAAAATAGGCCAGGTGTGG - Intergenic
1184000122 22:41667174-41667196 AAACCAGAAGAGGCCGGGCGCGG + Intergenic
1184772114 22:46603497-46603519 AAAAGAGAAGAGGCCGGGCGCGG - Intronic
1185022390 22:48385664-48385686 TATAGAGGAGAGGCCATGTGAGG - Intergenic
1185290663 22:50025374-50025396 TACACAGAAGAGGCCGGGCGCGG + Intronic
950896864 3:16460570-16460592 TTTCAAGCAGAGGCTGGGTGGGG + Intronic
951369940 3:21833492-21833514 AATCTAGAAGAGGCCAGGAGTGG + Intronic
952498273 3:33935184-33935206 TGTCCAGAATAGGCCGGGCGCGG - Intergenic
952812208 3:37414211-37414233 TAGCTAGAAAAGGCCAGGTGTGG - Intronic
953164019 3:40448129-40448151 TACCTAAAAGAGGCCGGGCGCGG + Intergenic
954154522 3:48678114-48678136 TGGCGAGAAGAGGCCAGCTGTGG - Intronic
954409579 3:50364613-50364635 AAAGGCGAAGAGGCCGGGTGAGG + Intronic
954606984 3:51919696-51919718 TATACAGATGAGGCCGGGTGCGG + Intergenic
955189538 3:56747545-56747567 TAAAGAGACTAGGCCGGGTGCGG + Intronic
955315239 3:57933131-57933153 TATGAAAAAGACGCCGGGTGTGG + Intergenic
955677361 3:61462876-61462898 TAGGGACAAGAGGCCGGGTGCGG + Intergenic
955881594 3:63552186-63552208 TAGCCAGATGCGGCCGGGTGCGG - Intronic
955983438 3:64549594-64549616 TACCGAGAAGATGCAGGGTTGGG + Intronic
956258833 3:67314507-67314529 TATGAGGAAGAGGCAGGGTGAGG - Intergenic
956381895 3:68673035-68673057 TGTAGAGAAGAGGCCAGGAGAGG + Intergenic
956465587 3:69517701-69517723 TCTGAAGAAGAGGCTGGGTGGGG - Intronic
956606502 3:71078120-71078142 TATACAGAGGAGGCCGGGCGGGG - Intronic
956840589 3:73136177-73136199 TATACAGAATAGGCCAGGTGCGG - Intergenic
957899733 3:86473839-86473861 TAACTAGAATAGGCCGGGTGCGG - Intergenic
959087958 3:101871059-101871081 TATCATGCAGAGGCCGGGCGCGG - Intergenic
961317444 3:126050231-126050253 TATAGAGTAGAGGGCAGGTGGGG - Intronic
961514806 3:127425849-127425871 GATGCAGAAGGGGCCGGGTGAGG + Intergenic
962209219 3:133463016-133463038 TCTAGAGCAGAGACCGGGTGCGG + Intronic
962533868 3:136309507-136309529 AATCGTTAAGAGGCCAGGTGTGG + Intronic
962668036 3:137675801-137675823 TGGGGAGAAGAGGCCAGGTGTGG + Intergenic
962730705 3:138280916-138280938 AATAGAGAACAGGCTGGGTGCGG - Intronic
962869389 3:139475029-139475051 GAACATGAAGAGGCCGGGTGCGG + Intronic
963137996 3:141924972-141924994 TAATGATAATAGGCCGGGTGTGG + Intronic
963808050 3:149746479-149746501 TATAAAGAAAAGGCCGGGTACGG + Intronic
963819033 3:149867553-149867575 AAGAGACAAGAGGCCGGGTGCGG - Intronic
964628233 3:158779826-158779848 AATCAAAAAGAGGCCGGGCGTGG - Intronic
964753340 3:160072470-160072492 AATCAAGAATAGGCTGGGTGTGG - Intergenic
965472301 3:169109704-169109726 TACTTAGAAGAGGCCGGGTGCGG - Intronic
965970690 3:174552502-174552524 AATCAATAATAGGCCGGGTGTGG + Intronic
966047933 3:175575573-175575595 ACTAGAGAAGAGGCCGGGCGTGG - Intronic
966163750 3:176993968-176993990 AATGGAGCTGAGGCCGGGTGCGG - Intergenic
966402947 3:179565155-179565177 TATGTAGAAGGGGCCGGGTGCGG + Intronic
967490642 3:190087244-190087266 TACCATCAAGAGGCCGGGTGCGG + Intronic
967723586 3:192840906-192840928 TATAGACAAGAGGCAGGTTGTGG + Intronic
1202740244 3_GL000221v1_random:47861-47883 AATTGAAGAGAGGCCGGGTGCGG - Intergenic
968419695 4:473700-473722 CATCGGGAAGACGCCAGGTGCGG - Intronic
968539105 4:1154105-1154127 TGTCGAGGGGAGGCTGGGTGCGG + Intergenic
968587045 4:1423813-1423835 TACCTAAAAGAGGCCGGGCGCGG - Intergenic
968823763 4:2877675-2877697 AATCAAGAGGGGGCCGGGTGTGG + Intronic
969011582 4:4068273-4068295 TACTGCAAAGAGGCCGGGTGAGG + Intergenic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
969802675 4:9581731-9581753 AAACAAGAAGAGGCTGGGTGTGG + Intergenic
971492875 4:27232641-27232663 TATCCAGAATGGGCCGGGCGTGG - Intergenic
972096403 4:35352081-35352103 TATCTACAAGAGGCCAGGCGTGG + Intergenic
972417811 4:38859854-38859876 AATGGTGAAGAGGCCGGGCGGGG - Intergenic
973313353 4:48732983-48733005 TAGTGAGAAAAGGCCGGGTGTGG + Intronic
973330663 4:48907421-48907443 TATAGAAAACAGGCCGGGTGCGG + Intergenic
974259768 4:59510683-59510705 TATCACTAAGAGGCCGGGCGCGG - Intergenic
975156001 4:71073789-71073811 AATCCAGAAAAGGCCGGGTGCGG + Intergenic
975298015 4:72756418-72756440 AACCCAGAAGAGGCCGGGCGTGG + Intergenic
975613234 4:76221608-76221630 AATGGGGAATAGGCCGGGTGCGG - Intronic
976245695 4:83004105-83004127 TGTAGAAAACAGGCCGGGTGCGG + Intronic
976626255 4:87186336-87186358 TATATAAAAGAGGCCGAGTGTGG - Intronic
976880782 4:89922394-89922416 TATTGAGTACAGGCCAGGTGCGG - Intronic
977310124 4:95375785-95375807 TATACAGAATAGGCCGGGCGTGG + Intronic
978534569 4:109747445-109747467 AATTGATAAGAGGCCAGGTGCGG - Intronic
979480788 4:121214530-121214552 TATGGAGAGGTGGCCGGGTGAGG + Intronic
979499463 4:121422590-121422612 TCACGAGAGGAGGCCGGGTGCGG - Intergenic
979670620 4:123356964-123356986 TATCTGGCAGAGGCCGGGTGTGG - Intergenic
979709454 4:123761281-123761303 TATAGAACAGAGGCCAGGTGCGG + Intergenic
980246587 4:130253127-130253149 TAAAGAGATGAGGCTGGGTGTGG + Intergenic
981472103 4:145148207-145148229 TGTTGATTAGAGGCCGGGTGCGG + Intronic
982016053 4:151154567-151154589 AAAAGAAAAGAGGCCGGGTGTGG - Intronic
982837948 4:160146469-160146491 AATCTAGCAGAGGCCGGGCGGGG + Intergenic
982922075 4:161288374-161288396 AATCAAAAAGAGGCCGGGCGCGG + Intergenic
983522604 4:168725814-168725836 TAAAGAGAACAGGCTGGGTGTGG - Intronic
985049688 4:185976753-185976775 AATGGAAAAGAGGCCAGGTGCGG + Intergenic
985195102 4:187420795-187420817 AATCGAGCTGAGGCCGGGCGCGG + Intergenic
985281717 4:188293571-188293593 TAGAGAGAGGAGGCCGGGTACGG + Intergenic
985300121 4:188479398-188479420 TCCCTAGAAGAGGCCGGGCGCGG - Intergenic
985335764 4:188892015-188892037 TAGCTAGAAGAGGCCGGGCGCGG - Intergenic
1202761439 4_GL000008v2_random:114876-114898 AATTGAAGAGAGGCCGGGTGCGG + Intergenic
985872438 5:2568230-2568252 AATTGAGGAGAGGCTGGGTGTGG + Intergenic
986529398 5:8720100-8720122 TATAGAGAGGCAGCCGGGTGCGG + Intergenic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
986823265 5:11492778-11492800 TATTAAGAAAAGGCTGGGTGTGG + Intronic
987727835 5:21725667-21725689 TATATAATAGAGGCCGGGTGTGG - Intergenic
987926016 5:24342874-24342896 TATAAAGATGGGGCCGGGTGCGG + Intergenic
988524802 5:31977653-31977675 TGTCCAGAATAGGCCTGGTGAGG + Intronic
988874940 5:35433663-35433685 TATAAAAAAGAGGCCAGGTGTGG + Intergenic
988882016 5:35514395-35514417 TGTGGAGAAGAGGCCAGCTGTGG + Intergenic
988983247 5:36592770-36592792 TATCCAGTAGAGGCCGGGCACGG + Intergenic
989231802 5:39095572-39095594 AATGTATAAGAGGCCGGGTGTGG + Intergenic
989611082 5:43292279-43292301 TATACAGTAAAGGCCGGGTGCGG - Intronic
989754196 5:44932784-44932806 AATTGAAAAGAGGCTGGGTGTGG - Intergenic
990582957 5:57182659-57182681 TAAAGAGAAGAAGCCGAGTGCGG - Intronic
990804750 5:59646743-59646765 TGTAGACAATAGGCCGGGTGCGG + Intronic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
991687848 5:69198208-69198230 CATAGGTAAGAGGCCGGGTGCGG - Intronic
992224244 5:74604047-74604069 TAGGGAGTAGAGGCTGGGTGCGG + Intergenic
992543569 5:77787321-77787343 AATAGGGTAGAGGCCGGGTGTGG - Intronic
993336426 5:86665407-86665429 TAGCAAGAAAAGGCCAGGTGCGG + Intergenic
993999822 5:94765952-94765974 AACCTAGAAGAGGCCTGGTGCGG + Intronic
995579275 5:113577658-113577680 TATACAAAAGAGGCCAGGTGCGG - Intronic
995999441 5:118341285-118341307 GATCCAGTAGAGGCCAGGTGCGG + Intergenic
996375604 5:122803846-122803868 TATTGGGTAGAGGCCGTGTGTGG + Intronic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
997503932 5:134401077-134401099 TAAAAAAAAGAGGCCGGGTGCGG - Intergenic
997866026 5:137463657-137463679 TAACTAAAAGAGGCCGGGCGTGG + Intronic
998120539 5:139573009-139573031 TATCAAGATGAGGCTGGGCGCGG + Intronic
998141154 5:139700223-139700245 TACTGGGAAGAGGCCGGGCGCGG + Intergenic
999414861 5:151386166-151386188 GATACAGAAGGGGCCGGGTGCGG - Intergenic
999790927 5:154938590-154938612 TATGCACAAGAGGCCGGGTGCGG + Intergenic
1001552663 5:172615694-172615716 GATCCAAAAGAGGCCGGGCGTGG + Intergenic
1002275489 5:178101860-178101882 TACAGAGAAAAGGCCGGGCGCGG - Intergenic
1002276318 5:178106636-178106658 GATGGTTAAGAGGCCGGGTGTGG - Intergenic
1002486630 5:179542574-179542596 TATCCAGAATGGGCCAGGTGCGG + Intergenic
1002511044 5:179718004-179718026 TAAAGAAAAGAGGCCAGGTGTGG - Intronic
1002549614 5:179977560-179977582 TAAAGAAAACAGGCCGGGTGCGG + Intronic
1002933587 6:1652080-1652102 TATCCTTAACAGGCCGGGTGTGG + Intronic
1003002557 6:2349771-2349793 AAGTGAGAACAGGCCGGGTGTGG + Intergenic
1003587812 6:7409009-7409031 TAAATAAAAGAGGCCGGGTGCGG - Intronic
1003672540 6:8172855-8172877 TAAAAATAAGAGGCCGGGTGTGG + Intergenic
1004105232 6:12661217-12661239 AATGGAGAAGAGGCCGGGCGCGG - Intergenic
1004239035 6:13902173-13902195 TCTGTAGTAGAGGCCGGGTGCGG + Intergenic
1004256098 6:14066018-14066040 AATCCAGACAAGGCCGGGTGCGG + Intergenic
1004521432 6:16364591-16364613 TATCTAGAACTGGCTGGGTGCGG - Intronic
1005047431 6:21655330-21655352 AAGCTAGGAGAGGCCGGGTGTGG + Intergenic
1005050874 6:21683002-21683024 TAACAAGAAGAGGCTGGGTGTGG - Intergenic
1005133289 6:22537486-22537508 TAACTGGAAGAGGCCAGGTGCGG + Intergenic
1005306607 6:24520192-24520214 CATTGGGAAGAGGCTGGGTGTGG - Intronic
1005427723 6:25720933-25720955 TTTAGGGAAGAGGCCGGGCGCGG + Intergenic
1005572311 6:27157255-27157277 TAAAGAGAAGAGGCCGGGCGCGG + Intergenic
1005642795 6:27812860-27812882 TATGGACAACAGGCCGGGCGCGG + Intergenic
1006044605 6:31283931-31283953 TCCCAAGGAGAGGCCGGGTGCGG - Intronic
1006279158 6:33033504-33033526 ATTAGAAAAGAGGCCGGGTGCGG - Intergenic
1007511390 6:42376829-42376851 TAGCTAGAGGAGGCCAGGTGCGG - Intronic
1007770953 6:44192027-44192049 GAGCAAGAAGAGGCCGGGTGCGG - Intergenic
1008635836 6:53410054-53410076 AAAAGAGTAGAGGCCGGGTGCGG + Intergenic
1008697355 6:54055174-54055196 GATAGTGATGAGGCCGGGTGCGG - Intronic
1008933528 6:56964784-56964806 GACTGAGAAGAGGCCAGGTGAGG - Intronic
1010149862 6:72718737-72718759 GATGGAGCAGAGGCTGGGTGCGG - Intronic
1010159690 6:72838658-72838680 TATGGAGCTGAGGCCGGGCGCGG + Intronic
1011091920 6:83612583-83612605 AAAAGAGAAGAGGCCAGGTGCGG + Intronic
1011145443 6:84209663-84209685 TAGCTATAATAGGCCGGGTGTGG - Intronic
1011272323 6:85592697-85592719 TATAGGGATGTGGCCGGGTGCGG + Intronic
1011664382 6:89620773-89620795 AATAAAGACGAGGCCGGGTGCGG + Intronic
1011672281 6:89694841-89694863 AATCAAGTAGAGGCTGGGTGTGG - Intronic
1012514359 6:100041518-100041540 ACTAGAGAAGCGGCCGGGTGTGG + Intergenic
1012892532 6:104912884-104912906 TAAAAAGAAGAGGCCAGGTGTGG + Intergenic
1012907961 6:105089812-105089834 AAAAAAGAAGAGGCCGGGTGCGG - Intergenic
1013508982 6:110827472-110827494 TAACTACAAGAGGCCGGGTGTGG + Intronic
1013802859 6:113967417-113967439 TATCAAGATTAGGCCAGGTGTGG - Intronic
1014436437 6:121426008-121426030 TAGTGAGAACAGGCCGGGCGCGG + Intergenic
1016189717 6:141249075-141249097 TACAGACTAGAGGCCGGGTGCGG - Intergenic
1016265180 6:142224190-142224212 TACAGAGAAGAGGCCATGTGAGG + Exonic
1017338949 6:153297728-153297750 TACAGAGAAAAGGCTGGGTGAGG - Intergenic
1017833637 6:158155852-158155874 AATAGAGATTAGGCCGGGTGCGG + Intronic
1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG + Intronic
1018701633 6:166431916-166431938 TAGCCCGAACAGGCCGGGTGCGG - Intronic
1019395308 7:815129-815151 TACCAAAAAAAGGCCGGGTGCGG + Intergenic
1019490420 7:1310752-1310774 TATAGATGAGAGGCCGGGCGTGG - Intergenic
1020036849 7:4969021-4969043 TAACTAAAAGAGGCCGGGCGTGG - Intergenic
1020054343 7:5106893-5106915 TACAGAGGAGAGGCCGGGTGTGG - Intergenic
1020123899 7:5521840-5521862 TAGCCAGGTGAGGCCGGGTGCGG + Intergenic
1020174026 7:5868026-5868048 AATGGAAAAGATGCCGGGTGCGG - Intergenic
1020371162 7:7433343-7433365 TACCTACAAGTGGCCGGGTGCGG + Intronic
1020404469 7:7816449-7816471 TGTAGAGATGAGGCCGGGAGAGG + Intronic
1020447752 7:8286713-8286735 TAAAGAAAAGAGGCCGGGTGCGG - Intergenic
1020803651 7:12761790-12761812 GACTGAGAACAGGCCGGGTGCGG - Intergenic
1021421825 7:20454128-20454150 TTTAGGAAAGAGGCCGGGTGCGG - Intergenic
1021816019 7:24448496-24448518 AAAAAAGAAGAGGCCGGGTGTGG + Intergenic
1022021950 7:26408518-26408540 TATAGAGAAGAGGCCGGGTGCGG + Intergenic
1022614239 7:31912393-31912415 CATAGATAAAAGGCCGGGTGTGG + Intronic
1023952056 7:44854109-44854131 TAGCCAAAAGAGGCCGGGCGCGG - Intergenic
1024285161 7:47750791-47750813 TATCCTAAAGAGGCTGGGTGTGG - Intronic
1024327199 7:48118150-48118172 AATAAAGAACAGGCCGGGTGTGG - Intergenic
1025603283 7:63019381-63019403 TAGAGAGTAGAGGCTGGGTGTGG - Intergenic
1026030760 7:66791821-66791843 TATAGAAAAGATGCCAGGTGCGG + Intronic
1026069834 7:67108981-67109003 TATACTGATGAGGCCGGGTGCGG + Intronic
1026181546 7:68045473-68045495 AATAGAAAAGAGGCCAGGTGAGG + Intergenic
1026339240 7:69421190-69421212 TTTAGAAAAGAGGCGGGGTGTGG - Intergenic
1026380663 7:69796225-69796247 AATAGGGAAGAGGCTGGGTGTGG + Intronic
1026456616 7:70578118-70578140 TATGGACAAAAGGCCAGGTGCGG - Intronic
1026623926 7:71975718-71975740 AATAAAAAAGAGGCCGGGTGTGG - Intronic
1027342366 7:77222900-77222922 TAACCAGAAGAGGCAGGGAGTGG - Intronic
1027528953 7:79306008-79306030 TTTGGAGACGAGGCAGGGTGGGG + Intronic
1027877042 7:83784186-83784208 TATCTAATACAGGCCGGGTGCGG + Intergenic
1027979828 7:85203195-85203217 TATCCAGAAGAGTGTGGGTGTGG + Intergenic
1029112895 7:98222653-98222675 CACCGAGATCAGGCCGGGTGGGG - Intronic
1029431957 7:100537088-100537110 AAACAAAAAGAGGCCGGGTGCGG + Intergenic
1029858724 7:103545924-103545946 TAGACAGAAGGGGCCGGGTGCGG - Intronic
1029983700 7:104902494-104902516 TAGTGAGATTAGGCCGGGTGCGG + Intronic
1030421885 7:109317431-109317453 TTCTGAGATGAGGCCGGGTGTGG + Intergenic
1030814842 7:114023225-114023247 ATTCCAGAAGAGGCTGGGTGTGG - Intronic
1031028858 7:116713103-116713125 TAAGGAAAAGAGGCCGGGCGCGG + Intronic
1031544699 7:123036410-123036432 GAGTGAGAAGAGGCCGGGCGTGG - Intergenic
1032584132 7:133130834-133130856 TAGGGAGGAGAGGCTGGGTGCGG + Intergenic
1032592248 7:133202475-133202497 TATAGAGAAGAGACAGGATGGGG - Intergenic
1033549539 7:142434140-142434162 TATAGAGAAAAGGCAGAGTGTGG + Intergenic
1033714198 7:143982590-143982612 AATAAAGAAGAGGCCAGGTGGGG + Intergenic
1034079536 7:148263446-148263468 TATATAAAAGTGGCCGGGTGCGG + Intronic
1034224486 7:149472107-149472129 ATGCAAGAAGAGGCCGGGTGTGG + Intergenic
1034251517 7:149695230-149695252 AAACAAGAAGAGGCCGGGCGTGG + Intergenic
1036248504 8:7141429-7141451 TAAAAAGAAGAGGCTGGGTGTGG + Intergenic
1036403789 8:8435152-8435174 GATGCAGTAGAGGCCGGGTGCGG - Intergenic
1036781960 8:11655465-11655487 TAGAGAGTAGAGGCTGGGTGTGG + Intergenic
1036894170 8:12618628-12618650 TACTGCAAAGAGGCCGGGTGAGG + Intergenic
1036929774 8:12944389-12944411 TATATAGAAGAGGCCAGGTGTGG + Intergenic
1037578094 8:20226705-20226727 TATCCAGAACAGGCCGGGCGCGG - Intronic
1037830905 8:22188458-22188480 AATTGAGATGGGGCCGGGTGCGG - Intronic
1037869001 8:22473754-22473776 AATGGATAAGGGGCCGGGTGTGG - Intronic
1038126382 8:24677886-24677908 AATAGAGAAGAGGCTGGGTGTGG + Intergenic
1041045848 8:53885321-53885343 TATACAGCAGAGGCCGGGCGCGG + Intronic
1041778865 8:61555581-61555603 TAAAGACAATAGGCCGGGTGTGG - Intronic
1042445224 8:68876400-68876422 TTTCAAAAAGAGACCGGGTGCGG - Intergenic
1042688255 8:71465330-71465352 AAGGAAGAAGAGGCCGGGTGTGG + Intronic
1042768038 8:72347987-72348009 TAACAAAAAGAGGCCAGGTGTGG - Intergenic
1043018850 8:74975370-74975392 TAGCAAGAAGAGGGAGGGTGTGG + Intergenic
1043202498 8:77387888-77387910 TAGCTAGAAAAGGCTGGGTGTGG + Intergenic
1043884753 8:85586191-85586213 TATCTATAAAAGGCCGGGCGCGG - Intergenic
1044357389 8:91239078-91239100 TATATAGATGAGGCCGGGTGTGG + Intronic
1044866585 8:96576707-96576729 TAAAGAGAATAGGCCGGGCGCGG - Intronic
1044981511 8:97720942-97720964 TATCAAACAGAGGCCGGGCGTGG - Intronic
1045015756 8:98000306-98000328 TATGGATAACAGGCCAGGTGCGG + Intronic
1045044250 8:98259363-98259385 TATTTAAAGGAGGCCGGGTGCGG - Intronic
1045286033 8:100792419-100792441 TATGGTTAAGTGGCCGGGTGTGG + Intergenic
1045526410 8:102944363-102944385 AATGGAGAACAGGCCGGGTGTGG + Intronic
1045534366 8:103013226-103013248 ATTCTAGAAGAGGCCGGGCGCGG + Intergenic
1045924262 8:107567808-107567830 TATCCAGAAGAGGCTGGGCATGG + Intergenic
1046644954 8:116776077-116776099 TATGGGGAAGGGGCCAGGTGGGG - Intronic
1046996656 8:120531402-120531424 GAGGAAGAAGAGGCCGGGTGTGG + Intronic
1047749855 8:127872122-127872144 AAACTAAAAGAGGCCGGGTGTGG + Intergenic
1048580002 8:135722900-135722922 GCAAGAGAAGAGGCCGGGTGCGG + Intergenic
1048880417 8:138868051-138868073 TAAAGACAATAGGCCGGGTGCGG - Intronic
1049721568 8:144118330-144118352 TATCTAGTTTAGGCCGGGTGTGG + Intergenic
1049754176 8:144301574-144301596 GCTCCAGAAGAGGCCGGGCGCGG + Intronic
1050347038 9:4700436-4700458 AATTTAGAAGAGACCGGGTGTGG - Intronic
1050609405 9:7336071-7336093 TATCCAGATGAGGCTTGGTGCGG + Intergenic
1051894512 9:21974180-21974202 TATTCAGAAGCGGCCGGGCGCGG - Intronic
1052723958 9:32206920-32206942 AACCAAGCAGAGGCCGGGTGTGG - Intergenic
1053044993 9:34908129-34908151 TACTGTGAAGAGGCCGGGTGTGG - Intergenic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1055240792 9:74183423-74183445 TTTCAAGAAGAGTCCGGTTGGGG - Intergenic
1057077138 9:92143813-92143835 CATGGAGAAGAGCCAGGGTGGGG + Intergenic
1057183788 9:93044564-93044586 CATCAAGAACAGGCCAGGTGCGG + Intergenic
1057508822 9:95660659-95660681 TATCGGGGAGAGGCTGGGGGAGG + Intergenic
1057811076 9:98256893-98256915 TATTGACAAGAAGCAGGGTGGGG + Intergenic
1059475108 9:114540312-114540334 TATGCAAAGGAGGCCGGGTGCGG + Intergenic
1060576659 9:124702013-124702035 TATCTGGTAAAGGCCGGGTGCGG - Intronic
1060925125 9:127450887-127450909 TTTCGAGAAGAGGCAGAGGGTGG - Intronic
1061240294 9:129366518-129366540 TATGTAAAAGAGGCTGGGTGCGG - Intergenic
1062594444 9:137292322-137292344 TCTTGAAAAGAGGCCGGGTGCGG - Intergenic
1203708886 Un_KI270742v1:77817-77839 AATTGAAGAGAGGCCGGGTGCGG - Intergenic
1185710783 X:2301924-2301946 GAGCTAGATGAGGCCGGGTGAGG - Intronic
1185771114 X:2766427-2766449 GGCCAAGAAGAGGCCGGGTGCGG - Intronic
1185876161 X:3703960-3703982 TAGCCATTAGAGGCCGGGTGTGG - Intronic
1186004117 X:5049239-5049261 GAAAGAAAAGAGGCCGGGTGCGG - Intergenic
1186360533 X:8836623-8836645 AAGCGAGTAGAGGCTGGGTGTGG - Intergenic
1186801469 X:13096577-13096599 TATACAGAGGAGGCCGGGCGTGG - Intergenic
1187027019 X:15446117-15446139 TATCTTGAATAGGCCGGGTGTGG - Intronic
1187137683 X:16563976-16563998 TATGTATAACAGGCCGGGTGTGG - Intergenic
1188320397 X:28729705-28729727 GATAGGGATGAGGCCGGGTGTGG + Intronic
1189401216 X:40670469-40670491 TATAAAGGAGAGGCCGGGCGCGG + Intronic
1189441800 X:41043276-41043298 TAGAAAGAAGAGGCCAGGTGCGG + Intergenic
1189645535 X:43125513-43125535 TATTGAGAAAAGGCCATGTGAGG + Intergenic
1189813347 X:44800883-44800905 TTTTCAGTAGAGGCCGGGTGCGG - Intergenic
1190306805 X:49088111-49088133 AACCAAGAAAAGGCCGGGTGTGG + Intronic
1192175292 X:68881241-68881263 TATGGAGAACAGGCTGGGGGAGG + Intergenic
1192458371 X:71296503-71296525 TGTAGAGAAGAAGCCTGGTGGGG + Intronic
1192791630 X:74387866-74387888 AATGAAGAAGAGGCTGGGTGCGG + Intergenic
1195130954 X:101851640-101851662 TAAAAAGAAGAGGCCGGGCGCGG + Intronic
1195778292 X:108432543-108432565 AAACAAGAGGAGGCCGGGTGCGG + Intronic
1196371284 X:114982405-114982427 AAGCGAGTAAAGGCCGGGTGCGG - Intergenic
1196780433 X:119378680-119378702 TACCTAGAAGAGGCCGGGCGCGG + Intergenic
1197686085 X:129441145-129441167 TTAGGAAAAGAGGCCGGGTGCGG + Intergenic
1197743408 X:129913688-129913710 AAACGAGATGGGGCCGGGTGTGG + Intronic
1198051894 X:132958395-132958417 TGTCCAGGAGCGGCCGGGTGTGG + Exonic
1198756103 X:139984325-139984347 TATAAAGTATAGGCCGGGTGTGG + Intergenic
1200206243 X:154318407-154318429 GTTCGAGACCAGGCCGGGTGCGG + Intronic
1200583703 Y:4980833-4980855 ACTAGAGAAGAGGCCGGGCGCGG - Intergenic