ID: 1140814508

View in Genome Browser
Species Human (GRCh38)
Location 16:78608745-78608767
Sequence GGACCCAGGACAACTAAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140814505_1140814508 1 Left 1140814505 16:78608721-78608743 CCAGCTGCTCATTTGGAGTACTG 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1140814508 16:78608745-78608767 GGACCCAGGACAACTAAAGCCGG 0: 1
1: 0
2: 1
3: 6
4: 90
1140814504_1140814508 2 Left 1140814504 16:78608720-78608742 CCCAGCTGCTCATTTGGAGTACT 0: 1
1: 0
2: 1
3: 3
4: 109
Right 1140814508 16:78608745-78608767 GGACCCAGGACAACTAAAGCCGG 0: 1
1: 0
2: 1
3: 6
4: 90
1140814502_1140814508 13 Left 1140814502 16:78608709-78608731 CCTTTACAGTTCCCAGCTGCTCA 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1140814508 16:78608745-78608767 GGACCCAGGACAACTAAAGCCGG 0: 1
1: 0
2: 1
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140814508 Original CRISPR GGACCCAGGACAACTAAAGC CGG Intronic
902629386 1:17695720-17695742 GGGCCCAGGACAACAAGGGCAGG + Intronic
903385549 1:22924034-22924056 GGCCCCAGGACACCTAAGGAAGG - Intergenic
910268192 1:85363412-85363434 GAAACCAGGACAACTTAAGCAGG - Intronic
915494336 1:156270664-156270686 GGACTCAGGACAAGTAAAGGGGG + Intronic
1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG + Intronic
1070298179 10:75183107-75183129 TGACCCAGGGCTCCTAAAGCTGG - Intergenic
1070401349 10:76056099-76056121 GCTCTCAGGACAACTAAAGTGGG + Intronic
1070653762 10:78256642-78256664 GGTCTCAGGAGAATTAAAGCAGG - Intergenic
1070768285 10:79068669-79068691 GGAGCCAGGAGAAGAAAAGCTGG + Intergenic
1070953808 10:80451776-80451798 GGACCCAGGGGAACCAAAGCAGG - Intergenic
1075014390 10:118899564-118899586 GGACCCAGGACATCTAATTAGGG - Intergenic
1076590835 10:131580941-131580963 GAGCCCAGGACATCTAAGGCTGG + Intergenic
1077380370 11:2233256-2233278 GGACTCAGGACCAGGAAAGCTGG - Intergenic
1100315846 12:93443614-93443636 GGACCCAGGATAATTCATGCTGG + Intergenic
1101273671 12:103175881-103175903 GCAGCCAGGATAACTACAGCTGG + Intergenic
1102513815 12:113433633-113433655 GGACCCAAGGCAACCACAGCAGG - Intronic
1114852818 14:26401226-26401248 GGACTGAAGACCACTAAAGCTGG - Intergenic
1116029851 14:39557989-39558011 GGCCTCAGGAAAACTAAACCTGG - Intergenic
1116127664 14:40808738-40808760 GGCTTCAGGAGAACTAAAGCAGG + Intergenic
1122104936 14:99445961-99445983 GGGCCCAGGACAAGTAAAGCTGG + Intronic
1125890363 15:43261013-43261035 AAACCCAGGGCAACTAAACCAGG - Intronic
1126185309 15:45825399-45825421 GGCCCCAGAACAACAATAGCTGG + Intergenic
1130343319 15:83018788-83018810 TGTCCCATCACAACTAAAGCCGG + Exonic
1132846323 16:2002517-2002539 GGGCCCAGGACTACTACAGGTGG - Exonic
1140040397 16:71403742-71403764 TGACCAAGGACAACTGCAGCAGG - Intergenic
1140814508 16:78608745-78608767 GGACCCAGGACAACTAAAGCCGG + Intronic
1141347245 16:83258327-83258349 GGAACCAGGACTGTTAAAGCAGG - Intronic
1141820483 16:86442202-86442224 GGACGCAGGAGAACCAAGGCAGG + Intergenic
1142021069 16:87782985-87783007 AGAGGCAGGACAACTCAAGCAGG + Intergenic
1142777329 17:2151061-2151083 GGACCGAGGCCAACATAAGCTGG + Intronic
1143739205 17:8940429-8940451 GGACCCAGGAAAACTCACGAAGG + Intronic
1145017257 17:19407570-19407592 GGACCCAGGACCACCACACCTGG + Intergenic
1145986910 17:29053170-29053192 GGACCCAGGACACCCAGAGCAGG - Intronic
1152468042 17:80476685-80476707 GGGCCGCGGACAATTAAAGCGGG - Intronic
1154042231 18:10867180-10867202 GGATCCAGGAAATTTAAAGCTGG + Intronic
1154082132 18:11267895-11267917 GGGCCCAGAACAACTGAAGATGG + Intergenic
1160079092 18:75705346-75705368 GGACGCAGGACAACTGAAGAAGG + Intergenic
1160138232 18:76293693-76293715 GGCCCCAGTACAATAAAAGCTGG - Intergenic
1160377074 18:78421435-78421457 GGACCCAGGACCACTAGCACAGG - Intergenic
1163342934 19:16721458-16721480 GGACCCAGGAAAACGAGAGAAGG + Intronic
932214867 2:69960258-69960280 GGACCCAGCCCAACTAAGACAGG + Exonic
933586545 2:84185672-84185694 GGACCCTGGAGAACCAAAGAAGG - Intergenic
935885075 2:107609109-107609131 GGACCCAGAAAAACTGAAGAGGG - Intergenic
936280593 2:111136346-111136368 AGGCCCAGGAAAACTGAAGCGGG - Intronic
937503936 2:122514931-122514953 GAACTCTGGGCAACTAAAGCAGG - Intergenic
937984885 2:127633975-127633997 GGCCCCAGGACAGCGAATGCTGG + Intronic
938147341 2:128847787-128847809 GGAGCCAGCACAACAAAAGAAGG + Intergenic
938182175 2:129193048-129193070 GGCCTCAGGAAAACAAAAGCAGG + Intergenic
948998338 2:241596137-241596159 GGACCCCAGACATCTAAAGGTGG + Intronic
1170779066 20:19407323-19407345 GGACACAGAAAAACTAAAGATGG - Intronic
1171409549 20:24936822-24936844 GGAGCCAGGACTTCTAAGGCTGG - Intergenic
1176273452 20:64248456-64248478 AGGCCCAGGACACCTAGAGCGGG + Intergenic
1179295402 21:40057709-40057731 CGAACCAGGACAACCAAGGCTGG + Intronic
1179983984 21:44911012-44911034 GCACCCAGGACAGCTGCAGCGGG + Intronic
1183034729 22:35132960-35132982 GGAACCAGGAAAACCAAACCAGG + Intergenic
949470856 3:4394771-4394793 GGACCCAGAGAAACTAAAGGAGG - Intronic
950402932 3:12784476-12784498 GGAGACATGACAACTAAAGGTGG + Intergenic
955815957 3:62843527-62843549 GTACACATGAAAACTAAAGCTGG + Intronic
961469888 3:127105068-127105090 GGACCCAGGACAGGAAAAGGTGG - Intergenic
967916093 3:194579388-194579410 TGACCCAGGACTAAGAAAGCTGG - Intergenic
970757505 4:19443774-19443796 GGCCCTAGGACAACAAATGCTGG - Intergenic
972542921 4:40055800-40055822 GAACCCAGAACAAATAAACCAGG + Intergenic
979170968 4:117600899-117600921 GGACCCAGGACATCTAATTAGGG + Intergenic
984727762 4:183037723-183037745 GGACCCAGGGGAGCCAAAGCCGG - Intergenic
989462137 5:41712996-41713018 GGAGACAGGACAACTAGAGTAGG + Intergenic
991247986 5:64528180-64528202 GGACCCAGAACAAATACTGCAGG - Intronic
994446561 5:99881386-99881408 GGCCCCAGTACAACAATAGCTGG + Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
997657798 5:135568278-135568300 GGTCCCAGGACAACAGAGGCTGG - Intergenic
999769878 5:154767390-154767412 GGACCCAGGACAACAGAGGAAGG - Intronic
1001255058 5:170177050-170177072 GGTCCCAGGACAGCTCAAACAGG + Intergenic
1008540073 6:52538520-52538542 GGACCCTGGCCAACTGAAGGAGG - Intronic
1008651058 6:53563199-53563221 AAAGACAGGACAACTAAAGCAGG - Intronic
1011526387 6:88269868-88269890 AGACCCAGGACAAGCAAAGGAGG + Intergenic
1012691479 6:102318753-102318775 GGTCCCAGAAGAACAAAAGCTGG - Intergenic
1013471860 6:110473312-110473334 TAACCCAGGACAACTAACTCAGG + Intronic
1022185258 7:27961064-27961086 GAAACCAGGACAATAAAAGCTGG + Intronic
1024557697 7:50617569-50617591 TGAATCAGGACAATTAAAGCAGG + Intronic
1025731792 7:64114366-64114388 GGACCCAGGAGCACAAACGCAGG - Intronic
1033705312 7:143880945-143880967 GGGCCCAGGAGAAAGAAAGCAGG - Intronic
1035078807 7:156199338-156199360 GCCCCCAGGGAAACTAAAGCTGG - Intergenic
1036478999 8:9121025-9121047 AGACCCAGGACAAACAATGCTGG + Intergenic
1036579003 8:10055055-10055077 GGACCCAGGGCACCTGCAGCGGG + Intronic
1039120380 8:34139683-34139705 GGTCCTGGGACACCTAAAGCAGG + Intergenic
1042103393 8:65298015-65298037 GCAGCCATGAGAACTAAAGCAGG - Intergenic
1042524591 8:69750800-69750822 GGAGCCAGGACAAATACAGATGG - Intronic
1045112572 8:98948532-98948554 GGTCCCAGGAAAACGAAAGGCGG - Intronic
1046872324 8:119217354-119217376 GTACCCAGTACACCTAAAGTTGG + Intronic
1049276527 8:141722843-141722865 GGACTCTGGACTCCTAAAGCAGG + Intergenic
1056458675 9:86788225-86788247 ATACCCAGGAAAAATAAAGCAGG - Intergenic
1060137145 9:121168429-121168451 GGAGGCAGGAGAAGTAAAGCAGG + Intronic
1185811482 X:3114496-3114518 TGACTCAGGAAAACTCAAGCTGG - Intergenic
1192246862 X:69379897-69379919 GCCCCCAGGACAAATAAAGAGGG - Intergenic
1193933547 X:87586158-87586180 GGACCCAGTACAATAATAGCAGG + Intronic
1195438913 X:104878889-104878911 GGACCCAGGATACCTGAAGTTGG + Intronic
1196188052 X:112765332-112765354 GGACCAAGGACAAGTACAGAAGG + Intergenic
1197080088 X:122402110-122402132 GAACCCAGTTCAACTAAACCAGG + Intergenic
1201269819 Y:12243816-12243838 TGACTCAGGAAAACTCAAGCTGG + Intergenic