ID: 1140819330

View in Genome Browser
Species Human (GRCh38)
Location 16:78648465-78648487
Sequence CCAAAGATACACATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140819326_1140819330 3 Left 1140819326 16:78648439-78648461 CCCTAGGATATCTTGCTAATGAG 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG 0: 1
1: 0
2: 1
3: 42
4: 325
1140819327_1140819330 2 Left 1140819327 16:78648440-78648462 CCTAGGATATCTTGCTAATGAGA 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG 0: 1
1: 0
2: 1
3: 42
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140819330 Original CRISPR CCAAAGATACACATGGACAA TGG Intronic
901452272 1:9342997-9343019 TCCAAGATCCACATGGACAGGGG - Intronic
902074485 1:13772557-13772579 CAAAAGATACACATTCACAATGG - Intronic
902146773 1:14408324-14408346 CCAAAGCTACAGATGCTCAAAGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903787579 1:25871645-25871667 CCAAGGATACACACTGTCAAAGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904421251 1:30395571-30395593 CCCAAGCCACACCTGGACAAGGG + Intergenic
907772910 1:57484004-57484026 ACAATGATACATATGCACAAGGG + Intronic
908171300 1:61507481-61507503 CCAAGAATACACATGGGGAATGG + Intergenic
908803546 1:67906051-67906073 ACAATGAGACACATGGACACAGG - Intergenic
910240880 1:85085047-85085069 ACAAAGAGACACAGGGAGAATGG + Intronic
910983092 1:92977997-92978019 TTAAAGATACACATAGACAAAGG - Intergenic
911787766 1:101972060-101972082 CCACAGATATATATGTACAAAGG - Intronic
912857648 1:113185250-113185272 AAAAAGAGACACATAGACAATGG + Intergenic
912867346 1:113269687-113269709 CAAATGAGACACAGGGACAATGG - Intergenic
915001425 1:152597443-152597465 CCACAGATACACATGGGCATGGG + Intronic
917369954 1:174281672-174281694 CCAAAGTTTCACATGGCCAGGGG - Intronic
917392768 1:174557344-174557366 CAAGAGATACACATGGCCATCGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918462236 1:184788708-184788730 CCGAAAAAACACATGGACACAGG - Intergenic
919015995 1:192037362-192037384 CCAAACTTACTCATGCACAATGG - Intergenic
919362915 1:196617408-196617430 ACAAAGATACAGATGAACAACGG - Intergenic
919363438 1:196624941-196624963 CCATAAAGACACATGTACAAAGG + Intergenic
919410437 1:197235524-197235546 CCACTGAGGCACATGGACAATGG - Intergenic
920097054 1:203493045-203493067 CCACAGATACAGAGGGCCAACGG - Intergenic
920435429 1:205943842-205943864 CCAAAGAGCCTCTTGGACAATGG + Intergenic
920716637 1:208346226-208346248 CCAAATATACACACTGTCAATGG - Intergenic
922215936 1:223520027-223520049 CTAAAGGTACACATGGAGGAAGG - Intergenic
922594808 1:226805406-226805428 CCAAAGGTACAGATGGAAATGGG + Intergenic
922853140 1:228751309-228751331 CCCAAGATAGACATGAGCAATGG - Intergenic
923307902 1:232705052-232705074 CAAAAGGGACACATTGACAAAGG - Intergenic
924006211 1:239614463-239614485 CCAAAGATCCAAATGGGCGATGG + Intronic
924290289 1:242529506-242529528 CCCAAGAGACACAAGGACCAAGG + Intergenic
1063165910 10:3462175-3462197 CCCAAGAGACCCATGGACAATGG + Intergenic
1063165942 10:3462378-3462400 CCCAAGAGACCCATGAACAATGG + Intergenic
1063165965 10:3462562-3462584 CCCAAGAGACCCATGAACAATGG + Intergenic
1063222946 10:3987899-3987921 CTTAAGATAGACATGGAAAAAGG - Intergenic
1063237745 10:4135972-4135994 CCAAAACTAGACAGGGACAAAGG + Intergenic
1067496552 10:46765818-46765840 ACAAACATACATATGGAAAAAGG + Intergenic
1067521709 10:47012713-47012735 CCAAGGAAACAAAGGGACAAAGG + Intergenic
1067598103 10:47574584-47574606 ACAAACATACATATGGAAAAAGG - Intergenic
1071074298 10:81732688-81732710 CAAAAGAAACACATGGAAGAAGG + Intergenic
1071808595 10:89152658-89152680 CCACAGATGCAGAGGGACAAAGG - Intergenic
1073038885 10:100585460-100585482 CAATAGATAGACATGGAGAATGG - Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1074715610 10:116215829-116215851 CCAATCATTCACATGGACAAAGG + Intronic
1074847253 10:117409160-117409182 CAACAGATACCCTTGGACAAAGG - Intergenic
1076549728 10:131270760-131270782 CCCACGACACACAGGGACAATGG - Intronic
1077644162 11:3908882-3908904 CCTAAAATACACCTGGAAAAAGG + Intronic
1077666731 11:4117004-4117026 CCAAATAGAAACATGGGCAAGGG + Intronic
1078481730 11:11682314-11682336 CCAAAGATAGACATTTACAGAGG + Intergenic
1078560935 11:12371882-12371904 ACAATGAGACACATGGACACAGG + Intergenic
1079337313 11:19581560-19581582 ACAATGAGACACATGGACACAGG - Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081443906 11:43110959-43110981 CAAAAGCTACACCTGGGCAAGGG - Intergenic
1081544273 11:44058806-44058828 CTAAAGATAGACATGGAAACAGG - Intronic
1081557100 11:44174849-44174871 TCAAAGATACAGAGGGACAGGGG + Intronic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082672111 11:56046832-56046854 CCAACAAAACACATGGACACAGG + Intergenic
1083094859 11:60240409-60240431 CCAAGGCTACAAATGGACACCGG - Intronic
1083098933 11:60282914-60282936 CCAAAGCCACAAATGGACACAGG + Intronic
1084782436 11:71419063-71419085 CCTGAGATACACATGCAGAAAGG + Intergenic
1085770767 11:79323961-79323983 CCAAGGATACTGAAGGACAATGG - Intronic
1085874923 11:80394920-80394942 CCAAGGATAAAAATGGAGAAAGG + Intergenic
1088755823 11:112884458-112884480 CCAAAGAGACACATGGTTAAGGG - Intergenic
1089292560 11:117446512-117446534 CCAAACAGAAACCTGGACAAAGG + Intronic
1090567338 11:128008855-128008877 ACAAAGATAAAAAAGGACAAAGG + Intergenic
1090685260 11:129110203-129110225 CCAAAAATATACATTGATAAAGG - Intronic
1091634576 12:2187369-2187391 CCAAAGATACAAATCAGCAACGG + Intronic
1092703005 12:11254042-11254064 CCAAATATCCACATGCACCAAGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094776700 12:33737856-33737878 ACAAACATACAAATGTACAATGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095049242 12:37542169-37542191 CCAAAGACACACTTGCACACGGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096252146 12:50040228-50040250 CCGAAGATACACTCAGACAAAGG + Intergenic
1098129445 12:67333674-67333696 CAACAGATACAAATGGCCAATGG - Intergenic
1098608055 12:72418936-72418958 CCAAGGAAGCACATGGATAATGG + Intronic
1099427508 12:82541733-82541755 CCAAGAATACACATACACAATGG - Intergenic
1101568198 12:105929425-105929447 ACATAGATAGACATGAACAAAGG + Intergenic
1101776375 12:107798171-107798193 CCAAAGCTAAAAATGGGCAAAGG + Intergenic
1102247698 12:111365709-111365731 ACAATGAGACACATGGACACAGG + Intronic
1103430484 12:120880881-120880903 CCAAAAAAAAAAATGGACAAAGG + Intronic
1104047990 12:125176779-125176801 CCAAGGAGTCACGTGGACAAAGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104155850 12:126131225-126131247 ACAAAGATAAAAATTGACAACGG - Intergenic
1106714129 13:32370059-32370081 CAAAAAATCTACATGGACAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1110060901 13:71036365-71036387 CCAAACATACTCTTGGACCACGG + Intergenic
1110523272 13:76505775-76505797 CCAAAACTCGACATGGACAAAGG + Intergenic
1111877921 13:93919722-93919744 GCAAAGTTAAACATGGACACAGG - Intronic
1111934444 13:94545254-94545276 CCAAAGATCCAAATGGGCCATGG + Intergenic
1113400661 13:109989730-109989752 CCAAAGACACCCATGGACTTTGG + Intergenic
1113529019 13:111006331-111006353 CGAAATGTACACATGGACAGTGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114650762 14:24283242-24283264 CAAGAGATACATATGTACAATGG - Intergenic
1115728060 14:36238735-36238757 CAAAAGATAAACGTGGAAAACGG + Intergenic
1115896691 14:38096379-38096401 ACAATGAGACACATGGACACAGG + Intergenic
1116038022 14:39652333-39652355 CCAAGAATACACATGGAGAAAGG + Intergenic
1116999253 14:51355631-51355653 CCAAAGAGAGACATGAAGAAAGG - Intergenic
1117056746 14:51919973-51919995 CAACAGATACAGAGGGACAACGG - Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1119921054 14:78446325-78446347 CCAAAGATACACATGCAAGATGG + Intronic
1120693332 14:87617731-87617753 GCAAAGATTCACATGCAGAAAGG + Intergenic
1122758629 14:104003103-104003125 CCAAATAAACACATTTACAATGG - Intronic
1123888639 15:24752297-24752319 CCTAAGATTCACAAGGACATTGG - Intergenic
1124801279 15:32835215-32835237 TCACAGATACTCATGAACAAGGG + Intronic
1125000831 15:34768538-34768560 CCAAAGGTTCACAGGGACAAGGG - Intergenic
1125733773 15:41909489-41909511 CAAAGGAAACACATGGCCAAAGG - Intronic
1126338378 15:47612199-47612221 CCAAACATGCAAAGGGACAATGG - Intronic
1129383395 15:75182260-75182282 CCACACAGACACATGGACAAAGG - Intergenic
1134796228 16:17039549-17039571 CCAAAGTTACAGATGGGAAAAGG + Intergenic
1137081421 16:36063075-36063097 CCAAATATCCACATGCACAAAGG - Intergenic
1138806424 16:60094825-60094847 ACAAACAGACACATGGCCAACGG - Intergenic
1138953154 16:61938687-61938709 CCAAAGATCAACATGTTCAAGGG + Intronic
1138968960 16:62121505-62121527 TCAAATATACACATGGTAAAAGG - Intergenic
1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG + Intronic
1140826965 16:78715830-78715852 CCAAATAGACACATGCAGAAGGG - Intronic
1141401521 16:83751305-83751327 ACAAAGATACACAGGCACAGTGG + Intronic
1144760843 17:17706454-17706476 CCAAGGATCCAGGTGGACAAGGG + Intronic
1145369853 17:22299251-22299273 CCAAACACACACACGCACAAGGG - Intergenic
1146427888 17:32761139-32761161 ACTAAGCCACACATGGACAAAGG + Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1150379217 17:64707633-64707655 CCTAAGAAACACCTGGGCAATGG - Intergenic
1154947986 18:21181131-21181153 CCACAGATACCCATGGAAATCGG + Intergenic
1155298521 18:24407689-24407711 CCAAAGAACAACATGGGCAAAGG - Intergenic
1155487673 18:26364041-26364063 CAAAAAATACTCAAGGACAAAGG - Intronic
1156760570 18:40583892-40583914 CCAGAGAAACACATCGACAGAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157156164 18:45268552-45268574 CCAAAGAGACACCAGGACAAAGG - Intronic
1157156299 18:45269724-45269746 CCAAAGAGACACCAGGATAAAGG + Intronic
1157188217 18:45558718-45558740 CCATAGATACCAAGGGACAAAGG + Intronic
1158015822 18:52782621-52782643 AGAAAGATGCACATGGAGAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159328219 18:66951401-66951423 ACAAACATAAACATGGAGAAAGG + Intergenic
1159340779 18:67129904-67129926 GCAAACATAAAAATGGACAATGG - Intergenic
1159950683 18:74480523-74480545 ACAGAGACACACAGGGACAAAGG + Intergenic
1160446171 18:78928457-78928479 CCAACTTTACACATGGGCAAAGG - Intergenic
1161066015 19:2237835-2237857 CCAAGGATACACAAGAACAACGG - Intronic
1165614503 19:37187881-37187903 CCATGGATAGACATGGAAAAAGG + Intronic
1166468598 19:43057501-43057523 CAAAAGGTACACATGAACACTGG + Intronic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
925548725 2:5045327-5045349 CAACAGGTACACATGGACATAGG - Intergenic
926414703 2:12637862-12637884 TCAAAGATACTCAAGGACAGAGG - Intergenic
926502066 2:13668052-13668074 ACGCAGATACAGATGGACAATGG + Intergenic
927355864 2:22172354-22172376 CCACAGATACAGAGGGCCAATGG + Intergenic
929254701 2:39797346-39797368 CCAAAGATACACACTGTTAAGGG + Intergenic
929383720 2:41381218-41381240 GCAAAGAGAGGCATGGACAAGGG - Intergenic
931820361 2:65945536-65945558 CAAAAGACACACATTGGCAAAGG - Intergenic
932094587 2:68836471-68836493 CCACAGTAACACAAGGACAAAGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
935872399 2:107465342-107465364 CCATAAACACATATGGACAATGG - Intergenic
936276534 2:111102546-111102568 CCAAAGACACTCACGGAGAAGGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938636229 2:133229670-133229692 CCAGAGCTACACCTGGACACAGG + Intronic
939906092 2:147917380-147917402 CCAAAGATCCACATCAACACTGG - Exonic
941479158 2:165984469-165984491 CAAAATATACACATGCATAATGG + Intergenic
941743821 2:169065168-169065190 CCATGGGTACACATGGACACAGG - Intronic
946866173 2:224043058-224043080 CCGAAGAGACCCATGGAAAAAGG - Intergenic
947458436 2:230280532-230280554 CGAAAGATACAAATAGAGAATGG - Intronic
947481551 2:230505105-230505127 CCAAACTTGCATATGGACAATGG + Intronic
947953512 2:234168311-234168333 GCAAATAAACACATGAACAAAGG + Intergenic
948084004 2:235231281-235231303 CTAAAGATTCAGATGGCCAAGGG - Intergenic
948168802 2:235884199-235884221 CCATAGATACTGAGGGACAATGG - Intronic
949043758 2:241860914-241860936 GCAAAGAGACACATGGACCCAGG + Intergenic
1170004951 20:11657269-11657291 CCAAGGAGACACAAGGAGAAAGG + Intergenic
1170021762 20:11844543-11844565 CCAAATATACACATGCTGAAGGG + Intergenic
1170531170 20:17293934-17293956 CCAAAGATACACTTTCAAAAAGG - Intronic
1171524821 20:25800409-25800431 CCAAAGACACACACGCACACGGG + Intronic
1171531743 20:25857771-25857793 CCAAAGACACACACGCACACGGG + Intronic
1171532058 20:25859410-25859432 CCAAAGACACACACGCACACGGG + Intronic
1171532367 20:25861050-25861072 CCAAAGACACACACGCACATGGG + Intronic
1171532693 20:25862726-25862748 CCAAAGACACACACGCACATGGG + Intronic
1171533145 20:25865269-25865291 CCAAAGACACACATGGACACGGG + Intronic
1171534007 20:25870055-25870077 CCAAAGACACACACGCACATGGG + Intergenic
1171552006 20:26055474-26055496 CCAAAGACACACACGCACACGGG - Intergenic
1171793119 20:29546777-29546799 CCAAAGATACACACGCACACGGG - Intergenic
1171837145 20:30167817-30167839 CCAAAGACACACATGCACACGGG + Intergenic
1171846796 20:30282311-30282333 CCAAAGACACACACGCACAAGGG - Intergenic
1171847511 20:30286018-30286040 CCAAAGACACACAAGCACACGGG + Intergenic
1171855333 20:30337612-30337634 CCAAAGATACACACACACACAGG + Intergenic
1173227894 20:41172588-41172610 CCACAGATCCACATGGGCAAAGG - Exonic
1175078339 20:56394670-56394692 CCAAACATACACATACATAAAGG + Intronic
1175593370 20:60211665-60211687 CAAAGGAAACACATGGAGAATGG + Intergenic
1175722792 20:61297517-61297539 CCCAAGACACAGATGGACCATGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176656433 21:9592282-9592304 CCAAAGACACACATGAACACGGG + Intergenic
1176679289 21:9810723-9810745 CCAAAGACACACATGCACACCGG + Intergenic
1177042145 21:16127549-16127571 GCATAGATATACATGGACCATGG + Intergenic
1177312853 21:19419782-19419804 TCAAACATACACATAAACAAAGG + Intergenic
1177650988 21:23961961-23961983 ACAATGAGACACATGGACACAGG + Intergenic
1178606552 21:34041652-34041674 CTAAGGATAGACATAGACAATGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179107305 21:38413893-38413915 CCAAAGATACATATGGAGAGAGG - Intronic
1179410734 21:41161023-41161045 TCACAGATACACATAGCCAAGGG + Intergenic
1180215197 21:46319066-46319088 CCATAGATACTGATGGACATGGG - Intronic
1180389707 22:12216602-12216624 CCAGATGTACACATGGAAAATGG + Intergenic
1180411449 22:12613456-12613478 CAAAGGATATACATGGGCAAAGG - Intergenic
1181828558 22:25539990-25540012 TCAAAGAAACACATGGGCCACGG - Intergenic
1182747072 22:32614355-32614377 CCAAAGAGAGAGATGGACAAGGG + Intronic
1184492265 22:44816436-44816458 ACAAAGGGACACAGGGACAAGGG - Intronic
949686356 3:6576000-6576022 CAAAAGGAAAACATGGACAATGG + Intergenic
950753734 3:15154652-15154674 ACAAAAATACAAATGAACAAGGG + Intergenic
951307283 3:21080890-21080912 ACACATATACACATGCACAAAGG - Intergenic
955082229 3:55668429-55668451 GTAGAGTTACACATGGACAAAGG + Intronic
955207444 3:56909228-56909250 TCAAAGATACACATGAACTCAGG + Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
957108365 3:75920786-75920808 ACAAAGATAAAAAAGGACAAAGG - Intronic
957382003 3:79443686-79443708 TCTAAAATCCACATGGACAAAGG + Intronic
957400997 3:79713428-79713450 CAAAAGGTAAACATGAACAAAGG + Intronic
957772671 3:84714850-84714872 GAAAAGAGACACATGGACCAAGG + Intergenic
959350415 3:105255142-105255164 GGAAAGATACACATGGAGAGAGG + Intergenic
961538943 3:127587638-127587660 CAAAAGTGACACATGTACAAAGG + Intronic
961699511 3:128731704-128731726 CGAAAGATACACTTTTACAAGGG - Intronic
961939720 3:130624615-130624637 CCAAGGATAGACATAGATAAAGG + Intronic
962024812 3:131536800-131536822 CCCAGTATACACATGGACCATGG - Intronic
962938248 3:140101504-140101526 CAAAAGACACAAATGAACAAAGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964919744 3:161882423-161882445 CAAATGATACACATGGATAATGG + Intergenic
965171435 3:165269910-165269932 ACAAAGATACTCCTGGACACAGG - Intergenic
966417449 3:179704229-179704251 ACAAAGATATTCAAGGACAAAGG + Intronic
966708222 3:182941244-182941266 GCAAAGATAAACCTGGAAAAGGG + Exonic
966802027 3:183773166-183773188 CCACAGATACAGAGGGCCAATGG + Intronic
967439064 3:189485913-189485935 ACAATGAGACACATGGACACAGG + Intergenic
968470515 4:780151-780173 CCAAAGGGACACAGCGACAAGGG - Intergenic
969078029 4:4595931-4595953 CCAAAGATAAAGCTGGAGAAGGG - Intergenic
969083923 4:4641346-4641368 CCAAAGATACAAAAGGGAAAAGG - Intergenic
970261653 4:14231120-14231142 GCAAACTTACACATGGGCAATGG + Intergenic
970318725 4:14854857-14854879 CCACAGATACAGAGGGCCAATGG + Intergenic
971595237 4:28518915-28518937 CCACAGATACACATGGCATATGG - Intergenic
972056471 4:34808756-34808778 CCACAGAAAAACATGGATAAAGG + Intergenic
972297276 4:37752158-37752180 GCAAAGATTCACATAGACAGTGG - Intergenic
975248752 4:72152246-72152268 CAAAAAATACACAGGGAAAATGG - Intergenic
975338191 4:73205948-73205970 GAAAACATACACATGGCCAATGG + Intronic
975749151 4:77505152-77505174 CCAGATATACAGATAGACAAAGG - Intergenic
976204004 4:82607292-82607314 ACAAAGAAACACAGGGAGAAAGG + Intergenic
976801842 4:89001441-89001463 CAAAAGATACACACTGAAAATGG + Intronic
977523267 4:98112281-98112303 ACAAAGATACAGATACACAATGG - Intronic
979563388 4:122125614-122125636 ACAAATATACAAATGGACATAGG - Intergenic
980138728 4:128889360-128889382 ACAGAGACACACATGTACAAAGG + Intronic
980319521 4:131251485-131251507 CCAGAGAAACACATGGACCTTGG + Intergenic
980516361 4:133867440-133867462 CCACAGTTACACTTGGGCAAAGG - Intergenic
980944626 4:139307247-139307269 ACAAACCTACACATGGCCAATGG - Intronic
981384236 4:144109053-144109075 CCAAAGAACAGCATGGACAAAGG - Intergenic
984321733 4:178206221-178206243 CTAAAGTTACACATGGACTGTGG + Intergenic
984590418 4:181611214-181611236 CCAAAGATAAACATAGATAACGG - Intergenic
984643002 4:182190777-182190799 ACAAAGAAACACATTGAAAATGG + Intronic
986862582 5:11944646-11944668 CCAATGATTCTCCTGGACAATGG + Intergenic
986888652 5:12272745-12272767 ACAAAGAAACACATGTACAAAGG - Intergenic
988131521 5:27112813-27112835 CAAAACAGACACATAGACAATGG + Intronic
989803526 5:45575377-45575399 ACAATGAAACACATGGACACAGG + Intronic
989978125 5:50609023-50609045 GCAGATAAACACATGGACAAAGG - Intergenic
993548860 5:89248813-89248835 CCAACTATACACCTGGCCAATGG + Intergenic
995396903 5:111696776-111696798 CCAGGGATGCACATGAACAAAGG - Intronic
996296125 5:121919274-121919296 CCAAAGGTACAAAGGTACAAAGG - Intergenic
996531730 5:124534213-124534235 CCAAAAATAAACATTTACAAGGG - Intergenic
997025428 5:130054992-130055014 CCATACATACACTTGGACCAGGG - Intronic
997147945 5:131457780-131457802 CCACAGATACTGAGGGACAATGG + Intronic
997689425 5:135815673-135815695 CTACAGATGCACATGGACACAGG + Intergenic
998894684 5:146787040-146787062 CTAAAGATCCACATGGCCATAGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999114550 5:149151225-149151247 ACAGAGAAACACATGGATAAAGG - Intronic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
1000406998 5:160898940-160898962 ACAATGAGACACATGGACACAGG + Intergenic
1000459858 5:161501028-161501050 TTAAAAATACACATGGACACAGG - Intronic
1000469193 5:161618986-161619008 TCCAATATAAACATGGACAAAGG + Intronic
1001014768 5:168130424-168130446 CCAAAGATACACATGAATTGTGG - Intronic
1001227781 5:169960261-169960283 ACAAAGATACCCATGTACAGAGG - Intronic
1001638841 5:173231433-173231455 CCATAAATTCACATGGTCAAGGG - Intergenic
1003347271 6:5282344-5282366 CAAAAGAAACACATGGTCCATGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005363651 6:25056054-25056076 CCAAAGACACACAAGAGCAAAGG + Intergenic
1006396698 6:33791971-33791993 TCAAAGATACTCAGGGACCACGG + Intergenic
1006464644 6:34185343-34185365 ACACACATACACATGCACAAGGG + Intergenic
1007456832 6:41984761-41984783 CAAAAGATAAACATTGACAAGGG - Intronic
1008383591 6:50861536-50861558 CCACAGCTACAGATGGACTAAGG - Intergenic
1008642188 6:53475390-53475412 ACACAGACACACAGGGACAAAGG - Intergenic
1008757338 6:54812015-54812037 CCAAGAATACACATGGGGAAAGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009903650 6:69841269-69841291 CCAAATTTACAAATGGGCAATGG - Intergenic
1010373513 6:75139331-75139353 CCAAAGACACACATAGACTCTGG + Intronic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1011357732 6:86489837-86489859 CCAATGGTACACAAGGAGAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1013682770 6:112543010-112543032 ACAAAGATACACCTCGAGAAAGG + Intergenic
1014502240 6:122205228-122205250 CCAAAGAGAAACAAGGAAAAGGG - Intergenic
1015629660 6:135219345-135219367 ACAAACAATCACATGGACAATGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018631480 6:165826440-165826462 ACAGAGAGACACAGGGACAAAGG - Intronic
1021207139 7:17796092-17796114 TCAAAGATACTCATTAACAAGGG + Intronic
1022561086 7:31350388-31350410 CCACAGATTCAAATGGAAAAAGG + Intergenic
1024620691 7:51154822-51154844 CAAAAGTTACACACGGAAAAAGG - Intronic
1025167289 7:56723526-56723548 AGAAAGATGCACATGGAGAAAGG - Intergenic
1025268273 7:57485532-57485554 CCAAAGACACACATGCACACGGG - Intergenic
1025284436 7:57650720-57650742 CCAAAGACACACACGCACAAGGG + Intergenic
1025295142 7:57770735-57770757 CCAAAGACACACTTGCACACGGG - Intergenic
1025300662 7:57817770-57817792 CCAAAGACACACACGCACACGGG - Intergenic
1025301082 7:57820187-57820209 CCAAAGACACACACGCACACGGG - Intergenic
1026438264 7:70418700-70418722 AAAAAGATACACATGCACAACGG - Intronic
1027048411 7:75006539-75006561 CAAAAGATGCAAATGGAAAAGGG - Intronic
1028631522 7:92939838-92939860 CCAGAGACACATATGGAGAAAGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029084081 7:97997737-97997759 CCGAAGATAAAAATGGACGATGG - Intergenic
1029498716 7:100914101-100914123 CCTAAGACACAAATGGACATAGG + Intergenic
1029918936 7:104241545-104241567 CCAGGGATACACTGGGACAAGGG - Intergenic
1031400524 7:121321797-121321819 ACAATGAGACACATGGACACAGG + Intergenic
1031652243 7:124304813-124304835 ACAAAGATAAAAAAGGACAAAGG - Intergenic
1032937616 7:136751247-136751269 ACAATGAAACACATGGACACAGG - Intergenic
1033009047 7:137599781-137599803 CCTAAAATACATATGGACCATGG + Intronic
1033442695 7:141394683-141394705 CCATAGATCCACATGAACACTGG - Intronic
1033571616 7:142634684-142634706 CCAAAAAGAAATATGGACAAAGG + Intergenic
1034890333 7:154833783-154833805 CCAAAGATTCTCATAGACAAAGG + Intronic
1036724519 8:11207957-11207979 ACAAAGATTTGCATGGACAAGGG + Intergenic
1040129076 8:43773255-43773277 CCAAATATACAGATAGACACGGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041478581 8:58293132-58293154 ACACAAATACACATGCACAATGG + Intergenic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1044438625 8:92196249-92196271 CCAGAAGTACCCATGGACAACGG - Intergenic
1044467939 8:92528433-92528455 ACAATGAAACACATGGACACAGG + Intergenic
1044634128 8:94305551-94305573 ACAAAGATACAAATGGAGAAGGG + Intergenic
1046703806 8:117427962-117427984 CCAGATAAACACATGAACAAAGG - Intergenic
1046862255 8:119106603-119106625 CCAAAGCCAGACATGTACAAGGG + Intergenic
1047150952 8:122262145-122262167 ACAATGAGACACATGGACACAGG - Intergenic
1047830156 8:128620811-128620833 CCACAGATACAGAGGGACAATGG - Intergenic
1048312029 8:133330971-133330993 ACAAAGGTACACTTGAACAAAGG - Intergenic
1048704591 8:137138642-137138664 TCAAAGATACACATGGGTGAAGG - Intergenic
1050851069 9:10287181-10287203 CCAAAGGTAAAAATTGACAAGGG + Intronic
1050863032 9:10460603-10460625 CCAAAAATACACATGAGGAAAGG + Intronic
1051339011 9:16093955-16093977 ACAAAGCCACACATGGCCAACGG - Intergenic
1052270430 9:26622850-26622872 ACAATGAGACACATGGACACAGG + Intergenic
1052884144 9:33626920-33626942 CCAAAAAGAAATATGGACAAAGG + Intergenic
1054159812 9:61665939-61665961 CCAAGGACACACACGCACAAGGG - Intergenic
1054172453 9:61854689-61854711 CCAAAGACACACACGCACACGGG - Intronic
1054447309 9:65383700-65383722 CCAAAGACACACACGCACACGGG - Intergenic
1054665087 9:67726112-67726134 CCAAAGACACACACGCACACGGG + Intergenic
1056418096 9:86397026-86397048 CTAAGGATACACACGTACAAAGG - Intergenic
1057485875 9:95483677-95483699 GTATAGATAGACATGGACAAAGG - Intronic
1057774645 9:97997061-97997083 CCTAAGATACACATGTTGAAAGG + Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060238852 9:121886187-121886209 CCAAAGTCACATATGGAGAAGGG - Intronic
1060659523 9:125396119-125396141 GAAAAGATACACATAGAAAAAGG + Intergenic
1060807221 9:126585489-126585511 CCCAAGATACACAGGTAGAATGG + Intergenic
1060927382 9:127464442-127464464 CCATAGATACATATGGCCAGCGG - Intronic
1062251300 9:135596516-135596538 AGAAACATACACATGGGCAATGG - Intergenic
1203634148 Un_KI270750v1:95764-95786 CCAAAGACACACACGCACACGGG + Intergenic
1203664461 Un_KI270754v1:13259-13281 CCAAAGACACACATGCACACGGG + Intergenic
1186539426 X:10385082-10385104 ACAATGAGACACATGGACACAGG - Intergenic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1188252556 X:27915567-27915589 AGAAACATACACATGGATAAAGG - Intergenic
1190256135 X:48763792-48763814 CAAAAGATCCACATGGACATAGG - Intronic
1191774304 X:64796043-64796065 CCAAATATACTCTTGGACCATGG + Intergenic
1191910966 X:66149075-66149097 CCAAAGATGCAGAGAGACAAAGG + Intergenic
1192738322 X:73870050-73870072 CCTAAGACACAAATGGACACAGG - Intergenic
1192850272 X:74948613-74948635 CCATAGGTATACATGTACAATGG + Intergenic
1193958804 X:87898079-87898101 CCAATGTTATGCATGGACAATGG - Intergenic
1194083944 X:89502906-89502928 TCAAAGATAAACATGGATATAGG - Intergenic
1196424145 X:115552570-115552592 CCATAGATTCACCTGAACAAGGG - Intergenic
1196598421 X:117571764-117571786 ATAAAGATACACATGGACTCTGG - Intergenic
1197366313 X:125568018-125568040 CCAAAGAAACACAGTGACACTGG - Intergenic
1197503641 X:127274427-127274449 TCAAAGAAACACATGCACATAGG + Intergenic
1198007592 X:132513572-132513594 CCAAAGATACTCATGAAGTAGGG + Intergenic
1198273295 X:135076083-135076105 CCAAAGAAGCACCTGGAAAATGG - Intergenic
1199009401 X:142740996-142741018 CCAAGGATACACTTGCACAGAGG - Intergenic
1200359250 X:155585235-155585257 GCAAGGATACATATAGACAAAGG + Intronic
1200436589 Y:3158786-3158808 TCAAAGATAAACATGGATATAGG - Intergenic
1201533123 Y:15014312-15014334 ACAAAGATACACCTCGAGAAGGG + Intergenic