ID: 1140830109

View in Genome Browser
Species Human (GRCh38)
Location 16:78743010-78743032
Sequence GTCCCAACCCTTACTGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140830105_1140830109 -6 Left 1140830105 16:78742993-78743015 CCAACTCCCCACATACAGTCCCA 0: 1
1: 0
2: 1
3: 32
4: 391
Right 1140830109 16:78743010-78743032 GTCCCAACCCTTACTGCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 97
1140830101_1140830109 9 Left 1140830101 16:78742978-78743000 CCCAAGCACAGTACCCCAACTCC 0: 1
1: 0
2: 3
3: 14
4: 136
Right 1140830109 16:78743010-78743032 GTCCCAACCCTTACTGCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 97
1140830103_1140830109 -4 Left 1140830103 16:78742991-78743013 CCCCAACTCCCCACATACAGTCC 0: 1
1: 0
2: 0
3: 26
4: 252
Right 1140830109 16:78743010-78743032 GTCCCAACCCTTACTGCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 97
1140830100_1140830109 23 Left 1140830100 16:78742964-78742986 CCTCGTTAATGTCTCCCAAGCAC 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1140830109 16:78743010-78743032 GTCCCAACCCTTACTGCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 97
1140830104_1140830109 -5 Left 1140830104 16:78742992-78743014 CCCAACTCCCCACATACAGTCCC 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1140830109 16:78743010-78743032 GTCCCAACCCTTACTGCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 97
1140830102_1140830109 8 Left 1140830102 16:78742979-78743001 CCAAGCACAGTACCCCAACTCCC 0: 1
1: 0
2: 1
3: 20
4: 234
Right 1140830109 16:78743010-78743032 GTCCCAACCCTTACTGCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140830109 Original CRISPR GTCCCAACCCTTACTGCAGC CGG Intronic
904178441 1:28648269-28648291 GACCCAGCACTTACTGCAACCGG + Intergenic
904917048 1:33977615-33977637 TCCCCATCCTTTACTGCAGCAGG + Intronic
906696313 1:47825700-47825722 CTCCCAACCCTTAGTTCAGGAGG + Intronic
907480865 1:54744833-54744855 GTCACAAGCCTCACTGAAGCTGG + Intergenic
907806808 1:57828424-57828446 GTCCCCAAGATTACTGCAGCAGG - Intronic
910688670 1:89943620-89943642 TTCCCAACCCATGCGGCAGCAGG + Intergenic
921157017 1:212446542-212446564 GTTCCCACCCTCACTCCAGCCGG - Intergenic
921273584 1:213494135-213494157 GTCCCAACCATTTCTGTAGCCGG - Intergenic
924880183 1:248152480-248152502 CCCCCATCCCTTACAGCAGCAGG - Intergenic
1065805749 10:29392181-29392203 ATCTCAACCCTTGCTGCTGCAGG + Intergenic
1067539882 10:47143747-47143769 CTCCCTATCCTTCCTGCAGCAGG - Intergenic
1069832782 10:71291301-71291323 TTCCCAAAGCTTCCTGCAGCTGG + Intronic
1070761194 10:79025362-79025384 GCACCAGCCCTTCCTGCAGCAGG - Intergenic
1080031152 11:27662511-27662533 GTCCCAACCTTTTTGGCAGCAGG + Intronic
1082215379 11:49561442-49561464 GTCCCCCCTCTTCCTGCAGCAGG - Intergenic
1083878677 11:65537790-65537812 GTCCCTTCCCACACTGCAGCAGG + Exonic
1084222854 11:67695256-67695278 GTCACAAGCCTCACTGCAGCTGG - Intergenic
1084656593 11:70523269-70523291 TTCCCAGCCCTCACAGCAGCAGG + Intronic
1086634194 11:89063036-89063058 GTCCCCCCTCTTCCTGCAGCAGG + Intronic
1086664002 11:89457252-89457274 GTCCAAACCCTTGCTGATGCAGG + Intronic
1086701192 11:89901841-89901863 GTTGCAGCCCTGACTGCAGCAGG + Intergenic
1086704975 11:89942686-89942708 GTTGCAGCCCTGACTGCAGCAGG - Intergenic
1096842652 12:54389099-54389121 GCCACTACCCTTACTGCACCAGG + Intronic
1099094191 12:78352749-78352771 TTCCCAACCCTCCTTGCAGCTGG - Intergenic
1100608361 12:96170135-96170157 GACCCACCCCTCCCTGCAGCCGG + Intergenic
1101566597 12:105911662-105911684 CAGCCAACACTTACTGCAGCTGG - Intergenic
1102547540 12:113667544-113667566 CTGCAAACCCCTACTGCAGCAGG + Intergenic
1104719482 12:131037169-131037191 GTCCCAGGCCTTACTGCATGGGG + Intronic
1107435927 13:40380850-40380872 ATCCCAGCCCTGACTGCTGCAGG + Intergenic
1122227664 14:100289159-100289181 GAACCAACCCTGCCTGCAGCTGG + Intergenic
1122976369 14:105172498-105172520 GTCCCCACCCTGACTGGGGCTGG - Intergenic
1125716602 15:41823121-41823143 GTCTCAACCCTGACAGCAGCTGG + Exonic
1127380160 15:58424131-58424153 GGCCCAAGCCTCCCTGCAGCAGG - Intronic
1128877831 15:71216500-71216522 CTCCAAACCCCTACTGCACCAGG - Intronic
1131532492 15:93205679-93205701 CTCCCAACCCTCTCTGCAGCTGG + Intergenic
1132937155 16:2486969-2486991 GTCCCAACCCTTCCTCCTCCAGG + Intronic
1133056038 16:3145899-3145921 GTCTTAACCCTCTCTGCAGCCGG + Exonic
1134133443 16:11665201-11665223 GTCCCAGCCCTTATAGCGGCTGG + Intergenic
1135415752 16:22266896-22266918 GTCCCACCCCCACCTGCAGCTGG - Intronic
1136621161 16:31429264-31429286 TTCCCATCCCCTCCTGCAGCTGG - Intergenic
1137300558 16:47144100-47144122 CTCCCAGCCCTAACGGCAGCCGG - Intergenic
1139916631 16:70432393-70432415 CTCCCACCCATTTCTGCAGCAGG + Intronic
1139934768 16:70561588-70561610 TTCCCAAACCTTATTGGAGCTGG + Intronic
1140830109 16:78743010-78743032 GTCCCAACCCTTACTGCAGCCGG + Intronic
1146634977 17:34497142-34497164 GTTCCAACCCTTATCACAGCAGG + Intergenic
1147187761 17:38722015-38722037 GGCCCAACCCGTTCTGCGGCTGG - Exonic
1151852293 17:76698182-76698204 GTCCCTCCCCTGCCTGCAGCAGG + Intronic
1152400676 17:80064693-80064715 GGCCAAGCCCTTACTGCAGGTGG + Intronic
1161964939 19:7542662-7542684 GTCCCAAGCCTTACCCGAGCGGG - Exonic
1163683811 19:18699510-18699532 ATCCAAACCCTCACTGCTGCAGG - Intronic
1167788065 19:51652012-51652034 GCCCCATCCCTCACTTCAGCGGG + Intergenic
926615284 2:14991186-14991208 GTCCCAGCCCTGACTAGAGCTGG - Intergenic
926701556 2:15807493-15807515 GTCCCAACCTTTTCAGCACCAGG - Intergenic
927765492 2:25803553-25803575 GTCCCCAACCTTTCTGCATCAGG + Intronic
927844272 2:26463400-26463422 GGCCCAACCCTTCCTGCGGGGGG - Intronic
932313849 2:70767187-70767209 CTCCCCTCCCTTTCTGCAGCCGG - Intronic
932530398 2:72524074-72524096 TTCACCACCCTGACTGCAGCTGG + Intronic
940918414 2:159283224-159283246 GTCCCCACCTTTTCGGCAGCAGG + Intronic
945194104 2:207222198-207222220 TTCCCACGCCTTCCTGCAGCTGG + Intergenic
1180248627 21:46564824-46564846 GTCCCAACCCTGAGTGTGGCTGG + Intronic
1185065412 22:48629457-48629479 GCCCCAACCCTCGCTGCTGCTGG + Intronic
950465937 3:13153665-13153687 GTCCCCACCCCTCCTGCAGCAGG + Intergenic
953482889 3:43267134-43267156 GTCCCAGCCCTCAGTGCATCAGG + Intergenic
955949188 3:64225068-64225090 GTCTGAACCCTTCCTGAAGCTGG + Exonic
956077639 3:65522873-65522895 CTTCCCACCCCTACTGCAGCAGG - Intronic
957990895 3:87626205-87626227 ATCCTTATCCTTACTGCAGCGGG + Intergenic
961639101 3:128353700-128353722 GGCCCAGCCCTTCCTGCAGCAGG + Intronic
967537607 3:190624969-190624991 CTCCCTACCCACACTGCAGCGGG + Intronic
968922928 4:3532021-3532043 GCCCCGACCCCTTCTGCAGCAGG - Intronic
969227955 4:5811491-5811513 GGCCCAACCCTCACTTCACCTGG + Exonic
977393131 4:96438919-96438941 GTTCAAACACTCACTGCAGCAGG - Intergenic
979929942 4:126617576-126617598 GTCCTAACCCTCAATGCAGTTGG + Intergenic
999128068 5:149261323-149261345 TTCCCAGCCTTTACTGCAGCAGG - Intergenic
1003914737 6:10776131-10776153 GGCCCAACCCTTGGTGTAGCAGG + Intronic
1008615312 6:53220538-53220560 GTGCCCAGCCTTTCTGCAGCTGG + Intergenic
1011432143 6:87298872-87298894 TTCCCAAGCCTTACTGCTTCAGG + Intronic
1015607180 6:134970245-134970267 GCCTCAGCCCTTACAGCAGCTGG + Intronic
1018916813 6:168137913-168137935 CTCCTAACCCTTCATGCAGCTGG + Intergenic
1019377306 7:699678-699700 CTCCCCACCCCTCCTGCAGCTGG - Intronic
1023494264 7:40777833-40777855 GCCCCTGCCCTTGCTGCAGCTGG - Intronic
1025752490 7:64305948-64305970 GTTCCATCCCTGACTGCAGAAGG + Intergenic
1025937711 7:66050548-66050570 GTCCCCACCTTTTCTGCAGGAGG + Intergenic
1028532437 7:91852288-91852310 GTCCACACCCACACTGCAGCAGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1032127667 7:129206442-129206464 GTCCCACCCCTTCCTGCTGCAGG + Exonic
1034929880 7:155153344-155153366 GCCCATATCCTTACTGCAGCAGG + Intergenic
1037527674 8:19742689-19742711 ATCCCAACCCTGTCTTCAGCAGG + Intronic
1038316121 8:26485755-26485777 GTACCCACCCATACTGCAGACGG - Intronic
1038698410 8:29826987-29827009 GTTTTAACCCTTACTGCAGAAGG + Intergenic
1039218682 8:35302514-35302536 AACCCAACCCTTATTACAGCTGG - Intronic
1039952335 8:42181923-42181945 GGCCCAGCCCTTACAGCAGGAGG + Exonic
1042535441 8:69854010-69854032 GTCCCATTCCTTACAGCAACTGG + Intergenic
1045664747 8:104472043-104472065 GTCCAAATCCTGGCTGCAGCTGG + Intergenic
1048269460 8:133017059-133017081 GTCCCAACCCTTTGTGCATGGGG + Intronic
1049775442 8:144401782-144401804 GCCCAAACCCTCTCTGCAGCAGG + Intronic
1053141363 9:35684795-35684817 GTCCCCACATTTACTGCAGGGGG + Intronic
1058548121 9:106082795-106082817 ATCCCAATCCTCACTCCAGCTGG - Intergenic
1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG + Intergenic
1061972449 9:134052259-134052281 GCCCCAATCCTTACTGCAAGCGG + Intronic
1186428931 X:9487934-9487956 GTCACAACCCTGACTGATGCAGG + Intronic
1187810635 X:23172837-23172859 GGGCCAAACCTTACTGAAGCAGG - Intergenic
1187822728 X:23305615-23305637 GTCCCAACCATAACAGAAGCTGG + Intergenic
1189567751 X:42260982-42261004 GTCACATCTCTTACTACAGCTGG - Intergenic
1196667514 X:118331959-118331981 ATCCCAACCCTTACTCCTGGGGG + Intergenic
1199770287 X:150970880-150970902 GGCCCATCCCCTACAGCAGCAGG + Intergenic
1200457238 Y:3408321-3408343 AACCAAACCCTCACTGCAGCTGG - Intergenic
1201554522 Y:15254694-15254716 GTCTCCTCCCTTACTGGAGCTGG - Intergenic