ID: 1140832475

View in Genome Browser
Species Human (GRCh38)
Location 16:78764584-78764606
Sequence TGCCGTGCCCCGGGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140832467_1140832475 29 Left 1140832467 16:78764532-78764554 CCTCTTGTGTTGACATTTCTCCT 0: 1
1: 0
2: 2
3: 22
4: 268
Right 1140832475 16:78764584-78764606 TGCCGTGCCCCGGGTGGGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 97
1140832470_1140832475 2 Left 1140832470 16:78764559-78764581 CCTTCATCTGTTACTCGCTCACA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1140832475 16:78764584-78764606 TGCCGTGCCCCGGGTGGGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 97
1140832469_1140832475 9 Left 1140832469 16:78764552-78764574 CCTTTGGCCTTCATCTGTTACTC 0: 1
1: 1
2: 0
3: 18
4: 203
Right 1140832475 16:78764584-78764606 TGCCGTGCCCCGGGTGGGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140832475 Original CRISPR TGCCGTGCCCCGGGTGGGTT TGG Intronic
903671968 1:25041437-25041459 TGCATTGCCCCTGGTGGGCTGGG + Intergenic
905259961 1:36710131-36710153 TGCCCTGCCCTGAGTGGGTGGGG + Intergenic
906678235 1:47708620-47708642 TGCCGTGCCCAGGGAGGGGAAGG + Intergenic
916437779 1:164792743-164792765 TGCCGAGCCCCAGGTGGTTCTGG - Intronic
917119536 1:171633566-171633588 TGCTGTGCCCCTGCTGGGTCAGG - Intergenic
918040839 1:180913030-180913052 CCCCGGGCCCCGGGTGGGTCTGG - Intergenic
1064565368 10:16633821-16633843 TGTCCTGCCCTGGGTGGGTCAGG + Intronic
1067270729 10:44789317-44789339 TGCTGTGCTGAGGGTGGGTTGGG - Intergenic
1076422080 10:130338834-130338856 TGCGGTGCCCCAGCTGGGGTGGG + Intergenic
1077264980 11:1644107-1644129 TCCCTTGCCCCGGGGGAGTTTGG + Intergenic
1077333174 11:1992291-1992313 TCGCGTGCCCCGGGTGTGTACGG + Intergenic
1081672445 11:44949738-44949760 GGCCGGGCGCTGGGTGGGTTAGG - Intronic
1084276218 11:68052225-68052247 GGCCGGGCCCAGGGTGGTTTAGG + Intergenic
1084473111 11:69374644-69374666 TGTTGTGCCCGGGGTGGGTGGGG + Intergenic
1084554917 11:69869771-69869793 TGCCGTGCCCTGGCTGGCCTGGG + Intergenic
1084565073 11:69924027-69924049 TGCCATGCCCCAGGTTGGTGTGG + Intergenic
1089764255 11:120751555-120751577 TGCCAGGCTCTGGGTGGGTTTGG + Intronic
1202816156 11_KI270721v1_random:47470-47492 TCGCGTGCCCCGGGTGTGTATGG + Intergenic
1092131825 12:6118324-6118346 TGCAGTGCCCGGGGTGGGGGCGG - Intronic
1102014298 12:109637657-109637679 TGCCGAACCCTGGGTGGGCTTGG + Intergenic
1104192768 12:126499053-126499075 TGCAGTTCCCCTGGTTGGTTCGG + Intergenic
1104880821 12:132069228-132069250 AGCAGTGTCCCGGGTGGGGTGGG + Intronic
1108247449 13:48532504-48532526 TGCAGTGCAGCGAGTGGGTTAGG + Intronic
1114216648 14:20662213-20662235 TTCAGTGACCCGGGAGGGTTGGG - Intergenic
1122995570 14:105262036-105262058 GGCCTTGCCCTTGGTGGGTTGGG - Intronic
1125698505 15:41660009-41660031 TGCGGAGCCCCGTGTGGGTGGGG + Intronic
1129605001 15:77020571-77020593 TGCCATGCCCTGGATGGGTCAGG + Intronic
1130564227 15:84980976-84980998 CGCCGGGTCCCGGGTGGGTGGGG - Intronic
1131245334 15:90786985-90787007 TGCCGTCACCCAGGTGGGTGGGG + Intronic
1133018657 16:2956281-2956303 TGCCCTGCCCTGGCTGGGCTGGG - Intergenic
1134130006 16:11642773-11642795 TGCTGTGCCCTGTGAGGGTTTGG - Intergenic
1135586934 16:23678776-23678798 TGCCGCGCGGCGGGCGGGTTTGG + Intronic
1136181717 16:28557381-28557403 TGGCGTGCCCAGGGTGGGTATGG + Intronic
1140411562 16:74744046-74744068 TGGCGTGCCCCAGGTGGGAATGG - Intronic
1140832475 16:78764584-78764606 TGCCGTGCCCCGGGTGGGTTTGG + Intronic
1141184828 16:81779576-81779598 CGCCGTGCCCGGGGTCCGTTTGG + Intronic
1142549364 17:728514-728536 TGCTGTGCCCAGGCTGTGTTAGG + Intergenic
1146182801 17:30708563-30708585 TTGCGTGCCCCGGGTGCGTTTGG + Intergenic
1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG + Intronic
1152371929 17:79893556-79893578 TGCAGAGCCCAGGGTGGGGTTGG + Intergenic
1152583950 17:81180921-81180943 TGCCGTCCCCAGGGGGGGTTGGG - Intergenic
1152739414 17:82012485-82012507 TGCCTGGCCCCGGGTGGGAAAGG + Intronic
1159875279 18:73803919-73803941 TGCCCTGCCATGGGTGTGTTTGG - Intergenic
1160807774 19:1000268-1000290 TGCCCTGCCCAGGGCGGGATGGG - Intergenic
1161399082 19:4059642-4059664 GGCCTTGCCCTGGGTGGGTGGGG - Intronic
1161538037 19:4831759-4831781 TTCCGCGTCCCGGGTGGGTGTGG + Intergenic
1162054301 19:8053438-8053460 TGCCGAGCCAGGGGTGGGGTTGG + Intronic
1162976015 19:14207242-14207264 TTGCGTGCCCCGGGTGCATTTGG - Intergenic
1163418801 19:17202770-17202792 TGGGGTGCCAGGGGTGGGTTGGG + Intronic
1163540914 19:17909650-17909672 TGCTGTGCCCCAGGTGGGCCTGG - Intergenic
1164693065 19:30225460-30225482 CGCCCTGCCCCGGCTGGGCTGGG + Intergenic
933195400 2:79383655-79383677 TGCCGAGCCCTAGGTGGTTTTGG + Intronic
934765358 2:96877380-96877402 TCCAGTGCCCAGGGTGGGTGCGG - Intronic
939791760 2:146587233-146587255 TGCAGGGCCGCGGGTGGGGTCGG - Intergenic
944159057 2:196639786-196639808 TGCCGGGCCCCGGGCTGGTGAGG + Intronic
946414442 2:219532525-219532547 TGCCTTGCCCCGGGAGGCTCTGG - Intronic
947872701 2:233448382-233448404 TCCCGTGCCCTGGGTGGGAGGGG + Intronic
948863757 2:240765267-240765289 TGCAGCACCCCGGGTGGGGTTGG - Intronic
1174548683 20:51345416-51345438 TGCCATTCCCTGAGTGGGTTGGG - Intergenic
1175266027 20:57704022-57704044 TGCCCTGCTGTGGGTGGGTTAGG - Intronic
1175919275 20:62442468-62442490 TGCAGGCCCCCAGGTGGGTTAGG + Intergenic
1178971529 21:37182274-37182296 TACCGTTCCCCTGGAGGGTTTGG - Intronic
1179828957 21:43984010-43984032 TGCCGGGCCCCGGGTCTGTGGGG + Exonic
1179886436 21:44316125-44316147 TGCCCTGGCCCATGTGGGTTGGG + Intronic
1179922864 21:44516552-44516574 ACCCGCGCCCAGGGTGGGTTCGG + Intronic
1183041108 22:35178641-35178663 AGCAGTGCCCTGGGTGGGTGGGG - Intergenic
954390000 3:50263750-50263772 GGCAGTGCCAGGGGTGGGTTGGG + Intergenic
961552251 3:127676149-127676171 TGCGGTGGCCCTGGTGGGTGTGG + Intronic
964482825 3:157159697-157159719 CACCGTGCCCCGGGAGGGTGGGG - Intronic
968161564 3:196431810-196431832 CGCCGTGGCCCTGGCGGGTTCGG - Intronic
968808217 4:2788489-2788511 CGCCTTGCCCTGGGTGGGATGGG - Intergenic
969503877 4:7571463-7571485 GGCCATGCCCCGTGTGGGTGGGG + Intronic
973634036 4:52845505-52845527 TGCAGTGTCCCTGGTGTGTTTGG - Intergenic
979349643 4:119628905-119628927 TGCCGGACCCCGGGTGGGGGGGG - Exonic
980229509 4:130031201-130031223 CGCCCTGCCCCCGGTGTGTTTGG + Intergenic
985868960 5:2538762-2538784 CGCCGTGCCCAGGGCGGATTAGG - Intergenic
985896114 5:2750985-2751007 AGCCGGGCCCCGGGTGGGGAGGG - Intronic
1002896738 6:1384039-1384061 AGCCCTGCCCGGGCTGGGTTGGG + Intergenic
1003297582 6:4846259-4846281 TGCCGTGCACCCTGTGGGGTTGG - Intronic
1007094593 6:39205494-39205516 TGCCCTGCCCAGGGTGGCTATGG + Intronic
1011054943 6:83194030-83194052 GCCCGAGCCCCGGGTGGGATTGG + Intronic
1011629652 6:89311531-89311553 TGCCCTGCCATGGGTGGGTGGGG - Intronic
1013591496 6:111622710-111622732 TGCAGTGGCCCGTGTGGGGTGGG + Intergenic
1016962155 6:149684199-149684221 TGCCATGCCCCAGGTGGGACAGG + Exonic
1019421858 7:954386-954408 TGCGGCGCCCCGGGTAGGTGTGG - Intronic
1020250203 7:6461403-6461425 TGCCCAGCCCAGGGTGGGTGGGG - Exonic
1023890837 7:44390961-44390983 TGCCATGCCCCGGGTGGAAAAGG + Intronic
1025042732 7:55662314-55662336 GGCACTGCCCCTGGTGGGTTGGG - Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1034532941 7:151707947-151707969 TCCCCTGCCCCGTCTGGGTTGGG - Intronic
1035160758 7:156948909-156948931 GGCCCTGCCCAGGCTGGGTTTGG - Intergenic
1036645525 8:10609598-10609620 TGCAGCCCCCTGGGTGGGTTGGG + Exonic
1039621045 8:38997167-38997189 GTCCGCGCCCCGGGTCGGTTGGG + Intronic
1039671558 8:39606000-39606022 TGCAGTGACCTGGGTGAGTTTGG - Intronic
1049709380 8:144056803-144056825 TGCCGGGCGCTGGGTGGGGTGGG - Intronic
1057841115 9:98486188-98486210 GGCCTTGCCCCGGGTGGGTGTGG + Intronic
1060485747 9:124045375-124045397 AGCCGGGCCCCGGAGGGGTTGGG + Intergenic
1061235617 9:129341224-129341246 TGCCGTTCCCCGGGGAGGCTTGG - Intergenic
1062609868 9:137368980-137369002 TGCAGTGCCCGGGGCGGGGTGGG + Intronic
1187230262 X:17415024-17415046 TGCCCTGCCCCGGGAGGTTGTGG + Intronic
1192968857 X:76209271-76209293 TGCAGTGACCCGGGTGAGATTGG - Intergenic
1198489034 X:137119966-137119988 TCCCTTCCCCCAGGTGGGTTAGG - Intergenic