ID: 1140832554

View in Genome Browser
Species Human (GRCh38)
Location 16:78765206-78765228
Sequence CTCGTGCTGGATCCTCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140832554_1140832557 -4 Left 1140832554 16:78765206-78765228 CCTGGCAGAGGATCCAGCACGAG 0: 1
1: 0
2: 5
3: 40
4: 350
Right 1140832557 16:78765225-78765247 CGAGCAAAGGCAGAAAGTCCAGG 0: 1
1: 0
2: 1
3: 16
4: 159
1140832554_1140832560 28 Left 1140832554 16:78765206-78765228 CCTGGCAGAGGATCCAGCACGAG 0: 1
1: 0
2: 5
3: 40
4: 350
Right 1140832560 16:78765257-78765279 GAATGAGAAGAGCCCAGTAGAGG 0: 1
1: 0
2: 1
3: 18
4: 225
1140832554_1140832558 6 Left 1140832554 16:78765206-78765228 CCTGGCAGAGGATCCAGCACGAG 0: 1
1: 0
2: 5
3: 40
4: 350
Right 1140832558 16:78765235-78765257 CAGAAAGTCCAGGAAGTGTCAGG 0: 1
1: 0
2: 1
3: 21
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140832554 Original CRISPR CTCGTGCTGGATCCTCTGCC AGG (reversed) Intronic
900590126 1:3455687-3455709 CTCTTGCTGGACCCCCAGCCAGG - Intronic
902302270 1:15510668-15510690 CTCATGCCGGGGCCTCTGCCTGG - Intronic
902695879 1:18140615-18140637 CTCCTGCTGTGCCCTCTGCCTGG + Intronic
902764225 1:18604200-18604222 TTCGTGCTGGAGCACCTGCCTGG + Intergenic
902792646 1:18779405-18779427 CTTCTGCTGTGTCCTCTGCCTGG - Intergenic
903453573 1:23471207-23471229 CTCATGCTGCTCCCTCTGCCTGG + Intronic
904374719 1:30073230-30073252 TACCTGCTGCATCCTCTGCCTGG - Intergenic
905184487 1:36186744-36186766 CGTGTGCTGTTTCCTCTGCCTGG - Intergenic
905294362 1:36944857-36944879 CTCTTCCTGTGTCCTCTGCCAGG - Intronic
905353345 1:37362855-37362877 CTGGTGCTGGTTCCCCTGCCTGG - Intergenic
905508523 1:38500044-38500066 CCCATGCTGTGTCCTCTGCCTGG + Intergenic
905582246 1:39091032-39091054 CCCTTGCTGGAATCTCTGCCTGG + Intronic
905804553 1:40866344-40866366 CTCTTGCTGTGCCCTCTGCCTGG + Intergenic
905867127 1:41382427-41382449 CTCCTGCTGGACGCTCTGCCGGG + Exonic
905878525 1:41448724-41448746 CGCTTGCTGGTTCCTCTGCCTGG - Intergenic
905911480 1:41657935-41657957 CTGGTGCTAGATGTTCTGCCTGG - Intronic
906188283 1:43878537-43878559 CTAGAGCTGTTTCCTCTGCCTGG - Intronic
906787777 1:48630861-48630883 CACATGCTGTTTCCTCTGCCTGG + Intronic
906816539 1:48885974-48885996 CTCATGCAGAAGCCTCTGCCAGG + Intronic
906931825 1:50177530-50177552 CATGTGCTGTTTCCTCTGCCTGG - Intronic
907114441 1:51956626-51956648 CTCATGCTGCACCCTCTGCCTGG + Intronic
907866609 1:58405165-58405187 CACTTGCTGTTTCCTCTGCCTGG + Intronic
907958915 1:59260090-59260112 CTTGTGCTAATTCCTCTGCCTGG - Intergenic
908967059 1:69778092-69778114 TTCATGCTGTTTCCTCTGCCTGG + Intronic
910662478 1:89688601-89688623 CTCTTGCTGTTCCCTCTGCCTGG - Intronic
910826873 1:91418508-91418530 TTCCTCCTGGATCCTCTGTCTGG - Intergenic
912468136 1:109888004-109888026 CGCATGCTGGTCCCTCTGCCTGG - Intergenic
912775321 1:112503022-112503044 TTTGTGCTGGGGCCTCTGCCAGG - Intronic
913470128 1:119178928-119178950 CTCTTGGTGCCTCCTCTGCCTGG + Intergenic
915270127 1:154747887-154747909 CTCATGCTGGCCCCTCTGCCCGG + Intronic
916778287 1:167993380-167993402 CTCGTGCTGTATCATCTTTCGGG - Exonic
916952060 1:169790554-169790576 CACTTGCTGGACCCTCTCCCTGG + Intronic
918296424 1:183161403-183161425 CCCTTGCTGGTGCCTCTGCCTGG - Intergenic
919925616 1:202190392-202190414 GTCGTGCTGGCTGCTCAGCCGGG + Intergenic
919954605 1:202400556-202400578 CACATGCTGTTTCCTCTGCCTGG - Intronic
920087035 1:203424996-203425018 CTCTTGCTGTTTCCCCTGCCTGG - Intergenic
920390202 1:205595309-205595331 CACGTGGTGAACCCTCTGCCTGG + Intronic
920975350 1:210780691-210780713 CTCATGCTGATCCCTCTGCCTGG - Intronic
921007502 1:211109206-211109228 CCCATGCTGGATCCTCTGCCTGG - Intronic
921130829 1:212218214-212218236 CCCGTGCTGTTTGCTCTGCCTGG + Intergenic
921383661 1:214549994-214550016 CACGAGCTGTTTCCTCTGCCTGG + Intronic
923367243 1:233274703-233274725 CTCATGCTGTTTCCTCTGCCTGG - Intronic
1064138307 10:12769158-12769180 CCCGTGCTCGCTCCCCTGCCAGG - Intronic
1065721092 10:28629395-28629417 CTCCAGCTGTTTCCTCTGCCTGG + Intergenic
1065974871 10:30833493-30833515 CTGCTGCTGGATTCCCTGCCTGG - Intronic
1067223346 10:44359699-44359721 CTGGTGCTGGACCCCCTGGCAGG + Intergenic
1068130894 10:52893970-52893992 CTCTTGCTGCTCCCTCTGCCTGG - Intergenic
1068385272 10:56317915-56317937 CTGCTGCTGGCACCTCTGCCTGG - Intergenic
1068598894 10:58934931-58934953 CACGTGCTGGTTTCTCTACCTGG + Intergenic
1069614615 10:69799043-69799065 CTCCTGCTAGACCCTCTGCCAGG - Intergenic
1069914734 10:71780470-71780492 CACTTGCTGTTTCCTCTGCCTGG - Intronic
1069959990 10:72073895-72073917 CTCCTGGTGGAAACTCTGCCAGG + Intronic
1070241847 10:74689934-74689956 CTGTTGCTGGACCCTCTCCCAGG + Intronic
1072622673 10:97090351-97090373 TGCCTGCTGGTTCCTCTGCCTGG - Intronic
1074112059 10:110429705-110429727 CTCATGCTGCATTCTCTGCCTGG + Intergenic
1074585847 10:114767764-114767786 CTCGCGCTGGCTGCCCTGCCGGG - Intergenic
1074787042 10:116850198-116850220 ATCCTACTGGCTCCTCTGCCGGG + Intronic
1075271605 10:121056768-121056790 TTCTTGCTGGGTCCTATGCCCGG - Intergenic
1076639641 10:131905535-131905557 TTCGTGCTGGGTCCTCTACAAGG - Intronic
1077081745 11:727427-727449 CTCCTGCTGGAGCCCCTCCCGGG - Exonic
1077196077 11:1280837-1280859 CTCGGGCTGCAGCCACTGCCAGG - Intronic
1077207126 11:1350044-1350066 CTGGACCTGGCTCCTCTGCCTGG + Intergenic
1078932433 11:15922564-15922586 CTCATGTTTGCTCCTCTGCCAGG + Intergenic
1079293433 11:19209794-19209816 CTCATGCTCCCTCCTCTGCCTGG + Intronic
1079763199 11:24356687-24356709 CTGGTGCTGTATCCACTGCTGGG - Intergenic
1080634335 11:34110319-34110341 CTCATGCTGTCTCCTCTGCTTGG + Intronic
1080727132 11:34909580-34909602 CACCTGCTGTTTCCTCTGCCTGG - Intronic
1081534382 11:43986584-43986606 CACCTGCTGTCTCCTCTGCCTGG + Intergenic
1081687076 11:45050322-45050344 CTCGGGCTGTAACCTCTCCCAGG + Intergenic
1081736067 11:45405170-45405192 CTGATGCTGTACCCTCTGCCTGG - Intergenic
1082821691 11:57548293-57548315 CACCTGCTGTTTCCTCTGCCTGG + Intronic
1083876872 11:65528908-65528930 CACGTGCTGTCGCCTCTGCCTGG - Intronic
1084240767 11:67818116-67818138 CTCTTGGTGCCTCCTCTGCCTGG - Intergenic
1085321411 11:75576374-75576396 CCCATGCTGTCTCCTCTGCCTGG + Intergenic
1085414480 11:76311064-76311086 CGAGGGCTGGTTCCTCTGCCAGG - Intergenic
1086343885 11:85875477-85875499 CTCATGCTGTTTCCTCTTCCTGG + Intronic
1086994440 11:93340302-93340324 CTTTTGCTGATTCCTCTGCCTGG - Intronic
1089312007 11:117564550-117564572 CTCTTGCTGGTCCCTCTGCTGGG + Intronic
1089440309 11:118510450-118510472 CACGTGCTTTCTCCTCTGCCTGG + Intronic
1089976393 11:122735737-122735759 CACATGCTGGGCCCTCTGCCTGG - Intronic
1091020279 11:132093290-132093312 CACATGCTGTTTCCTCTGCCTGG + Intronic
1091777152 12:3191996-3192018 CTCTTCCTGGACCCACTGCCTGG - Intronic
1093412930 12:18888111-18888133 ATCATGCTGGACCCCCTGCCTGG + Intergenic
1094849084 12:34374299-34374321 CTTGTGCGGGGACCTCTGCCTGG + Intergenic
1095593715 12:43935900-43935922 CTCATGCTGAACCCTCTGCCTGG - Intronic
1095969679 12:47892943-47892965 CATGTGCAGTATCCTCTGCCTGG - Intronic
1098158925 12:67629207-67629229 CTCCTGTTGGTTCCTTTGCCTGG - Intergenic
1099143372 12:79008227-79008249 CACATGCTGAATCCTCTGCTTGG - Intronic
1099257628 12:80333839-80333861 CACTTGCTGGTCCCTCTGCCTGG - Intronic
1100743300 12:97618882-97618904 CTCCTACTGTTTCCTCTGCCTGG + Intergenic
1101109702 12:101473643-101473665 CACCTGCTGCTTCCTCTGCCAGG + Intergenic
1101205792 12:102486107-102486129 CTCATGCTGTTCCCTCTGCCTGG - Intergenic
1101519182 12:105465878-105465900 CTCATGCTGTTTCCTCTACCAGG + Intergenic
1101838586 12:108311948-108311970 CTCTTGCAGGTCCCTCTGCCTGG + Intronic
1102177898 12:110889507-110889529 CTGTTGCTGTTTCCTCTGCCTGG - Intronic
1104734983 12:131131124-131131146 GTTGTGCTGAAGCCTCTGCCGGG + Intronic
1105282903 13:18979471-18979493 CACATGCTGTGTCCTCTGCCTGG + Intergenic
1105594833 13:21827645-21827667 CTCCTGGTGGATGCTCTTCCTGG + Intergenic
1108041808 13:46346298-46346320 CTCCTGCGGCATCCTCTGCCTGG + Intronic
1109826829 13:67732496-67732518 CTCTAGCTGGCCCCTCTGCCTGG + Intergenic
1109826848 13:67732623-67732645 CTCTAGCTGGCCCCTCTGCCTGG + Intergenic
1110564821 13:76947490-76947512 CTGATTCTTGATCCTCTGCCTGG - Intergenic
1113954405 13:114089458-114089480 CTTCTGCTTGGTCCTCTGCCTGG - Intronic
1115921491 14:38379239-38379261 CACTTGCTGTTTCCTCTGCCTGG - Intergenic
1117328954 14:54693986-54694008 CACTTGCTGCTTCCTCTGCCTGG - Intronic
1117896979 14:60497151-60497173 TACTTGCTGGCTCCTCTGCCTGG + Intronic
1118138958 14:63058810-63058832 GTCATGCTGCTTCCTCTGCCTGG - Intronic
1118819614 14:69336462-69336484 CCCTTGCCGGCTCCTCTGCCCGG + Intronic
1121089043 14:91168574-91168596 CACGTGCTGCTTCCTCTGCCTGG + Intronic
1122728528 14:103777427-103777449 TTGGTTCTGGATCCTCTGTCAGG - Intronic
1123976055 15:25555706-25555728 CTCATGGTGCACCCTCTGCCCGG - Intergenic
1124372113 15:29109900-29109922 CTCGTCCTGGCACCTGTGCCAGG - Intronic
1124388801 15:29234273-29234295 CTCGTGCTGTATCATCTTTCGGG + Intronic
1124434233 15:29634290-29634312 TTGGTGCTGGCTCCTGTGCCAGG + Intergenic
1125728121 15:41878482-41878504 CTCTTGCAGGAAGCTCTGCCGGG + Exonic
1125826145 15:42678187-42678209 GTCGTGCAGGTTCCTCTCCCTGG - Intronic
1126177089 15:45745810-45745832 CACCTGCTGTTTCCTCTGCCGGG - Intergenic
1127755250 15:62085801-62085823 CTTCAGCTGCATCCTCTGCCTGG - Intergenic
1128088995 15:64906190-64906212 CACGTGCTGGGTCCCCAGCCAGG - Intronic
1128713271 15:69887880-69887902 CTCCTGCTGGTCCCTCTGCCTGG - Intergenic
1129163620 15:73762262-73762284 CACATGCTGTTTCCTCTGCCTGG + Intergenic
1129394958 15:75238629-75238651 GTCCTGCTAGAGCCTCTGCCTGG + Intergenic
1129884823 15:79030780-79030802 CTCTTCCTGGAACCTCTTCCTGG + Intronic
1130681266 15:85998926-85998948 CACGTGCTCATTCCTCTGCCAGG - Intergenic
1131864140 15:96689077-96689099 CTTGTGCTGTTTCTTCTGCCTGG + Intergenic
1132051497 15:98611247-98611269 CTCTTGCTGGAGCTTGTGCCTGG - Intergenic
1133429197 16:5721857-5721879 CTTGTGCTTGGTCCTCTGTCTGG - Intergenic
1135111128 16:19691624-19691646 CTCCTGCTGTTTTCTCTGCCTGG + Intronic
1135423932 16:22323013-22323035 CTCCACCTGGAGCCTCTGCCGGG - Intronic
1135468109 16:22704534-22704556 CTCTTGCTGTTCCCTCTGCCTGG - Intergenic
1135932632 16:26751555-26751577 CACATGCTGTTTCCTCTGCCTGG + Intergenic
1137627839 16:49920857-49920879 CTGGTGCTGGTACCACTGCCTGG + Intergenic
1137960943 16:52881588-52881610 CACGTGCTGTTTCTTCTGCCTGG + Intergenic
1138443721 16:57050306-57050328 CTCATGTTGGAGCCTCTGCCAGG - Intronic
1138629723 16:58283712-58283734 TTTGTACTGGGTCCTCTGCCAGG - Exonic
1139206224 16:65031555-65031577 CTCCTGCTGTTCCCTCTGCCTGG - Intronic
1139689585 16:68631807-68631829 CTCCTGCTCTTTCCTCTGCCTGG - Intergenic
1140485516 16:75290169-75290191 CACCTGCTTGGTCCTCTGCCTGG + Intergenic
1140832554 16:78765206-78765228 CTCGTGCTGGATCCTCTGCCAGG - Intronic
1142743810 17:1945086-1945108 CACGTGCTGTTCCCTCTGCCTGG + Intronic
1143347791 17:6262568-6262590 CTGGTGCTGTCACCTCTGCCAGG - Intergenic
1143833266 17:9669772-9669794 CCTGTGCTGTGTCCTCTGCCTGG - Intronic
1143896076 17:10137218-10137240 CACTTGCTGTTTCCTCTGCCTGG + Intronic
1144958570 17:19032194-19032216 CTCATGCTGTTTCCTGTGCCTGG + Intronic
1145974953 17:28978546-28978568 CACATGCTGGTCCCTCTGCCTGG - Intronic
1146502398 17:33375299-33375321 CATGTGCTGTTTCCTCTGCCGGG - Intronic
1146930621 17:36775000-36775022 CTTGTGCTGTGTCTTCTGCCTGG - Intergenic
1146939610 17:36835443-36835465 CACTTGCTGTGTCCTCTGCCTGG - Intergenic
1148777686 17:50104852-50104874 CCCGTGCTGTCTCCTCTGCCGGG + Intronic
1150430275 17:65109925-65109947 CACGTGCTTGTTCCTCAGCCTGG + Intergenic
1151433880 17:74082203-74082225 TGAGCGCTGGATCCTCTGCCTGG - Intergenic
1152127032 17:78453367-78453389 CCCGTGCTGGACCCTCTACTGGG - Exonic
1152377904 17:79928152-79928174 CTGGGGCTGGCTCCTCTTCCAGG + Intergenic
1152997009 18:416920-416942 CCCATGCTAGACCCTCTGCCTGG - Intronic
1153354560 18:4121211-4121233 CTCTTGCTGTTTCCTCTGTCTGG - Intronic
1155042317 18:22075076-22075098 CTCTTGCTGCCTCCTCTGCCTGG + Intergenic
1155224092 18:23713286-23713308 CTCGTGCTGGTTCCTCTACCTGG + Intronic
1157922465 18:51727448-51727470 CTAGGGCTGTAACCTCTGCCTGG + Intergenic
1160409899 18:78668153-78668175 CTCTTGCTGGACCCTCTGAGGGG - Intergenic
1160819586 19:1051869-1051891 CCCGAGCTGGGGCCTCTGCCAGG - Intronic
1161168004 19:2798805-2798827 CTCCTGCTGGAAGCTCCGCCAGG - Intronic
1161684209 19:5695088-5695110 CTTGTGCTGCGTCCTCTGCTTGG + Intronic
1161807968 19:6456066-6456088 CTTCTGCTGGGTTCTCTGCCTGG - Intronic
1162371721 19:10283936-10283958 CTCCTGCGAGATCCTCTTCCAGG - Intronic
1162518824 19:11166912-11166934 CACGTGCTGTTTCCGCTGCCTGG - Intronic
1162550535 19:11355739-11355761 CCGGTGCTGGCTCCTCGGCCCGG - Intronic
1162802753 19:13120033-13120055 CTCGTTCTGGATTCCCTGGCGGG + Intronic
1163128521 19:15257601-15257623 CGTGTGCTGTGTCCTCTGCCTGG - Intronic
1163573987 19:18099728-18099750 CACGTGCTGTGGCCTCTGCCCGG - Intronic
1163777962 19:19228819-19228841 CCAGTGCTCGTTCCTCTGCCAGG - Intronic
1164505950 19:28861327-28861349 ATCTTGCTGGCTCCTATGCCAGG + Intergenic
1165036312 19:33036500-33036522 CTCTTGATGCCTCCTCTGCCTGG + Intronic
1165327318 19:35121703-35121725 CACCTGCTGGTTCCTCTGCCTGG + Intronic
1165900970 19:39169206-39169228 CACGGGCTGGCCCCTCTGCCAGG - Intronic
1166083801 19:40461861-40461883 CACGTGCTGTGCCCTCTGCCTGG + Intronic
1167338765 19:48902767-48902789 CTCATGCTGTTCCCTCTGCCTGG - Intronic
1167619979 19:50555347-50555369 CTTGTGATGGGTCCTCTCCCGGG - Intronic
1168237761 19:55074335-55074357 CACTTGCTGTTTCCTCTGCCTGG - Intronic
1168486626 19:56768079-56768101 CTCATGCTGTTTCCTCTGCCCGG + Intergenic
925177665 2:1796718-1796740 CTCCTGCTGTTTCCTGTGCCTGG + Intronic
926207465 2:10844254-10844276 CTCCTGCTGTATCCTCTGCCAGG - Intergenic
926683212 2:15679691-15679713 CTCATACTGTTTCCTCTGCCTGG + Intergenic
927172350 2:20380818-20380840 CTCATGCAGGACCCTCTCCCTGG + Intergenic
927254913 2:21032641-21032663 CTCATGGTGTGTCCTCTGCCAGG + Intronic
927425610 2:22978230-22978252 CTTGTGTTGTAGCCTCTGCCTGG + Intergenic
929825372 2:45305721-45305743 CTGCTGCTTCATCCTCTGCCAGG - Intergenic
931708617 2:64968865-64968887 CTCTTGGTGCCTCCTCTGCCTGG + Intergenic
931789537 2:65652336-65652358 CATGTGCTGTATCCTCTGCCTGG + Intergenic
932172521 2:69570253-69570275 CACATGCTGTTTCCTCTGCCTGG + Intronic
932623450 2:73280586-73280608 CTCATGCTGGTCCCTCTTCCTGG + Intronic
933648486 2:84830884-84830906 CAACTGCTGGATCCTCTGCCAGG + Intronic
934864891 2:97799064-97799086 ATCGTGGTGGATACTCTGACAGG - Intronic
938149397 2:128868970-128868992 CACTTGCTGGCTCCCCTGCCTGG + Intergenic
940031843 2:149271967-149271989 ATGGTGCTGTTTCCTCTGCCTGG + Intergenic
942525049 2:176844105-176844127 CTCTTGCTGTCTCCTCTCCCAGG + Intergenic
946153398 2:217791188-217791210 CTCGTGCTTACTCCTCTGCAAGG - Intergenic
946189271 2:217999200-217999222 CATCTGCTGCATCCTCTGCCAGG - Intronic
946766608 2:223046467-223046489 CTCCTGCTGCATCTTCTACCAGG + Intergenic
947550012 2:231038706-231038728 CTCGTCCTGGAAGCCCTGCCTGG + Intronic
948076398 2:235168293-235168315 CTCATGCTGTTTCCTCTGCTGGG - Intergenic
948880242 2:240853125-240853147 GTCATGCTGCACCCTCTGCCCGG + Intergenic
1168756433 20:321623-321645 CACTTGCTGTTTCCTCTGCCTGG + Intergenic
1168964789 20:1892805-1892827 CTTGTGCTGGGCCCTCTTCCTGG + Intergenic
1169477489 20:5945362-5945384 CACCTGCTGCTTCCTCTGCCTGG + Intronic
1169965808 20:11215985-11216007 CACCTGCTGTAGCCTCTGCCTGG + Intergenic
1170457193 20:16544248-16544270 CTCATGCTGGTCCTTCTGCCTGG + Intronic
1172038681 20:32028728-32028750 CACCTGCTGGTCCCTCTGCCTGG - Intronic
1172067844 20:32234211-32234233 CTTGTGCTGTTCCCTCTGCCTGG - Intronic
1172068320 20:32237460-32237482 CACGTGCTGTTTTCTCTGCCAGG - Exonic
1172133774 20:32673629-32673651 CACCTGCAGGCTCCTCTGCCCGG + Intergenic
1172187443 20:33039949-33039971 CACATGCTGGAACCTCTGCCTGG - Intronic
1172268167 20:33635369-33635391 CTTGTGTTGGATCCTCTTTCAGG - Intronic
1172281547 20:33711367-33711389 CACGTGCTGAGCCCTCTGCCTGG - Intronic
1172358349 20:34295136-34295158 CTCCTGATGGATGCTCTGGCAGG - Intronic
1172472724 20:35212241-35212263 GACATGCTGCATCCTCTGCCTGG - Intergenic
1172621596 20:36321241-36321263 CACGTGCTGTTCCCTCTGCCAGG - Intronic
1172816345 20:37690152-37690174 CTCATGCTGTTCCCTCTGCCTGG + Intergenic
1172845762 20:37929222-37929244 CACCTGCTGATTCCTCTGCCTGG - Intronic
1172847982 20:37941374-37941396 CGCGTGCTGGGCCCTCTGCCTGG - Intronic
1173131028 20:40393723-40393745 GTAGTTCTGGATCCTCTCCCTGG + Intergenic
1173185947 20:40840407-40840429 CACGTGCTGTTCCCTCTGCCAGG - Intergenic
1173563135 20:44020558-44020580 GTCTTGCTGGATCCCCTGCTGGG - Intronic
1173834209 20:46114504-46114526 CCCGTGCTGTCACCTCTGCCTGG - Intergenic
1173914987 20:46700680-46700702 CGCGTGCTGTTTCCTCTGCTTGG + Intergenic
1174328037 20:49795228-49795250 CATGTGCTGCTTCCTCTGCCTGG + Intergenic
1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG + Exonic
1174406578 20:50306838-50306860 CCCGTGCTGTTTCCTCTGCCAGG + Intergenic
1174503022 20:50999523-50999545 CACTTGCTGTACCCTCTGCCTGG - Intergenic
1174545568 20:51322579-51322601 CTCCTGCTGTGTCCTCTGCCGGG + Intergenic
1175023057 20:55872079-55872101 CACTTGCTGTTTCCTCTGCCGGG - Intergenic
1175601300 20:60275730-60275752 CTCCTGCTGGATCTTCCTCCTGG + Intergenic
1175874089 20:62221271-62221293 CTCTTGGTGGGTCCTCAGCCTGG - Intergenic
1177637533 21:23806878-23806900 CTCTTGGTGCCTCCTCTGCCTGG + Intergenic
1178829667 21:36045324-36045346 CTCGTGCTGCATCCTCTGTCCGG - Intronic
1181065040 22:20301642-20301664 CTGGTGCCGCATCTTCTGCCTGG + Intergenic
1181335764 22:22126424-22126446 CTCCTGCTGGCTCCTGAGCCAGG + Intergenic
1182280272 22:29214393-29214415 CTGGTGCTGGGCCCTCTGCCTGG - Intronic
1182450116 22:30415009-30415031 CACGTGCTGTTTCCTCTGCATGG + Intronic
1182813147 22:33134962-33134984 CTGGGGCTGGGTCATCTGCCTGG + Intergenic
1182997439 22:34826998-34827020 CTTGTGCAGGATTGTCTGCCAGG - Intergenic
1183315339 22:37133906-37133928 CACATGCTGTTTCCTCTGCCTGG + Intronic
1183345058 22:37302999-37303021 CTCCTGCTGGATCCCCTGCCAGG - Intronic
1184095836 22:42315792-42315814 CTCCTGCTGTTCCCTCTGCCTGG - Intronic
1184149755 22:42631175-42631197 CTCCTGCTGGTGCCACTGCCAGG + Intronic
1184262450 22:43326809-43326831 CTCATGCTGTTCCCTCTGCCTGG + Intronic
1184419149 22:44369477-44369499 CCCTTGCTGGTTCCCCTGCCTGG + Intergenic
1184763179 22:46557168-46557190 CACGTGCTGTTCCCTCTGCCTGG - Intergenic
1184935779 22:47719400-47719422 CTCATGCTGTAGCCTCTGCCAGG + Intergenic
1185189729 22:49427615-49427637 TTCATGCTGGATCTTCTGACTGG + Intronic
949529047 3:4935548-4935570 CTCCTGCTGGTCCCTCTGCTGGG + Intergenic
950107982 3:10400358-10400380 CCCCTGCTGTTTCCTCTGCCTGG + Intronic
950451129 3:13066526-13066548 CCCATGCTGGCTCCTCTGCCGGG - Intronic
950478299 3:13227896-13227918 CTGAGGCTGGATCCTCAGCCTGG + Intergenic
950549507 3:13657731-13657753 CTCCTGCAGGTCCCTCTGCCTGG - Intergenic
950563033 3:13746834-13746856 CTGGGCCTGGGTCCTCTGCCAGG - Intergenic
950666319 3:14497471-14497493 CACGTGCTGTTTCCTCTGCCAGG - Intronic
950905113 3:16530872-16530894 CACATGCTGGTCCCTCTGCCAGG - Intergenic
951075227 3:18383132-18383154 CCTGTGCTTCATCCTCTGCCTGG - Intronic
951517783 3:23580790-23580812 CTTATGTTGGTTCCTCTGCCTGG - Intronic
952198237 3:31098360-31098382 GTTGTGCTGGATCATGTGCCAGG - Intergenic
952850247 3:37722119-37722141 CACATGCTGGTTCTTCTGCCAGG + Intronic
953091617 3:39732673-39732695 TTCATGCTGTTTCCTCTGCCTGG - Intergenic
953126223 3:40094012-40094034 CACGTGCTATTTCCTCTGCCTGG + Intronic
953885029 3:46710223-46710245 CTTGAGCTGGATCCCCTGCCAGG - Exonic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956427211 3:69148711-69148733 CACTTGCTGGTTCCTCTCCCTGG - Intergenic
956471062 3:69567250-69567272 CTTATGCTGCTTCCTCTGCCTGG + Intergenic
956677839 3:71752834-71752856 CATGTGCTGGTACCTCTGCCTGG - Intronic
956726147 3:72158088-72158110 CACGAGCTGTGTCCTCTGCCTGG - Intergenic
957196305 3:77072493-77072515 CTTGTGCTGGACACTATGCCAGG + Intronic
958826975 3:99041969-99041991 CTAGTGGTGGATCCTCAGCACGG + Intergenic
959105011 3:102055820-102055842 CTTATGCTGGATCTGCTGCCTGG + Intergenic
959462533 3:106644197-106644219 CACCTGGTGGATCCTGTGCCAGG - Intergenic
961219399 3:125187768-125187790 CTCATGCTGATTCCCCTGCCTGG + Intronic
961444639 3:126973486-126973508 CCCCTGATGGATGCTCTGCCTGG + Intergenic
961625077 3:128255939-128255961 CTTGGGCTGGATCCTTCGCCTGG + Intronic
962201440 3:133403861-133403883 CTCCTCCTGGCTCCTCTTCCTGG - Intronic
964974093 3:162599560-162599582 CTCTTGGTGCCTCCTCTGCCTGG + Intergenic
965605601 3:170495385-170495407 CTCCTTCTGGAATCTCTGCCTGG + Intronic
966203614 3:177383110-177383132 CGCCTGCTGGGACCTCTGCCAGG - Intergenic
967135870 3:186512158-186512180 CTCTTGCTGTTCCCTCTGCCAGG - Intergenic
967198263 3:187048401-187048423 CACTTGCTGCATCCTCTGACTGG + Intronic
968648801 4:1752383-1752405 CAGGTGCTGGCTCCTCTGCCAGG + Intergenic
968799467 4:2732736-2732758 CTCCTGCTGCCTGCTCTGCCTGG - Intergenic
969277618 4:6147577-6147599 CTTGAGCTGGATCCTGAGCCTGG - Intronic
969300072 4:6292375-6292397 CTCATGCTGTTCCCTCTGCCCGG - Intronic
969342426 4:6550479-6550501 CACGTGCTGTTTCCTCTGCCGGG + Intronic
969736349 4:8993347-8993369 CTCTTGGTGCCTCCTCTGCCTGG - Intergenic
974129051 4:57730389-57730411 CTCTTGGTGCCTCCTCTGCCTGG - Intergenic
982065704 4:151652752-151652774 CTCCTGGTGTCTCCTCTGCCTGG - Intronic
983566493 4:169158330-169158352 CTGGTGCTGACCCCTCTGCCTGG - Intronic
986061861 5:4199251-4199273 CTCGCCCTGGCTCCTCTCCCTGG + Intergenic
988690204 5:33564273-33564295 TTCATGCTGGTTCCTCTCCCTGG - Intronic
989265997 5:39474876-39474898 CAGGTGCTGGTTCCTCTGCCTGG - Intergenic
990900653 5:60745002-60745024 CTCCTTCTGGAATCTCTGCCTGG - Intergenic
991350525 5:65716177-65716199 CTCTGGCTGGTTCCTCTGCCTGG - Intronic
992524350 5:77593049-77593071 CTCCTGGTGTTTCCTCTGCCTGG - Intronic
993705264 5:91162396-91162418 CTTATGCTGGCACCTCTGCCTGG - Intronic
995380993 5:111533049-111533071 CTCTTGCTGCTGCCTCTGCCTGG + Intergenic
995397514 5:111702957-111702979 CTCCTGGTAGACCCTCTGCCTGG - Intronic
996929556 5:128869659-128869681 CTCTTGCCAGTTCCTCTGCCTGG + Intronic
997702112 5:135909774-135909796 CTCCTGCTGGGTCCTGTGCTTGG - Intergenic
998495250 5:142582834-142582856 CCCGTGCTGTCTCCTCTGACTGG + Intergenic
999009493 5:148020103-148020125 CTCTTGCTAGTTCCTTTGCCTGG - Intergenic
999793555 5:154966222-154966244 CACTTGCTGTTTCCTCTGCCTGG + Intronic
1000302828 5:159971733-159971755 CCCGAGCCGGTTCCTCTGCCCGG - Intronic
1001054415 5:168437112-168437134 CACTTGCTGTGTCCTCTGCCTGG + Intronic
1001875190 5:175194271-175194293 CCCATGCTGTATCCTTTGCCTGG - Intergenic
1001883873 5:175270895-175270917 CACATGCTGTACCCTCTGCCTGG - Intergenic
1002132841 5:177092009-177092031 CTCGGGCTGCGCCCTCTGCCTGG - Intronic
1004187726 6:13435301-13435323 CACATGCTGTACCCTCTGCCGGG + Intronic
1005430954 6:25756284-25756306 AACTTGCTGGTTCCTCTGCCTGG + Intronic
1007152982 6:39713134-39713156 CTCTTGCTGTTCCCTCTGCCCGG - Intronic
1007305498 6:40900845-40900867 CTCGTGCTGTGCCCTCTGCCAGG - Intergenic
1009338652 6:62526325-62526347 TTGCTGCTGGATCCTCTTCCAGG + Intergenic
1010369689 6:75092970-75092992 TTCATGCTGTTTCCTCTGCCTGG + Intronic
1012417723 6:99027697-99027719 CTCTTGCTGTGCCCTCTGCCTGG - Intergenic
1012496967 6:99844285-99844307 CACTTGCTGAACCCTCTGCCAGG - Intergenic
1012985121 6:105867402-105867424 CATGTGCTGGCCCCTCTGCCGGG - Intergenic
1013071306 6:106731819-106731841 CACGTGCTGCTCCCTCTGCCTGG + Intergenic
1013174984 6:107669168-107669190 CTCCTGCTCGTTCCTGTGCCAGG - Intergenic
1014202328 6:118620596-118620618 CTCTTGCTGAATCATCTGGCTGG - Intronic
1015539406 6:134298730-134298752 CTCCTTCTGGAATCTCTGCCTGG - Intronic
1015686547 6:135869794-135869816 CTCTTGCTCTCTCCTCTGCCGGG - Intronic
1015812709 6:137177367-137177389 CTTGGGCAGGAGCCTCTGCCAGG - Intergenic
1016735712 6:147477691-147477713 CTCTTGCTGCTTCCACTGCCTGG - Intergenic
1016895397 6:149046394-149046416 CTTGTTCTGGATCATCTGCTAGG + Intronic
1017485785 6:154900812-154900834 CTAATGCTGCCTCCTCTGCCAGG - Intronic
1018317102 6:162568323-162568345 CTCCTTCTGGAATCTCTGCCTGG + Intronic
1019559995 7:1651160-1651182 CTCATGCTGGTGCCTCCGCCTGG - Intergenic
1019625816 7:2015129-2015151 CTCTTCCTGGGACCTCTGCCCGG + Intronic
1019893782 7:3967238-3967260 CCCGTGCAGGATACTCTGCCAGG + Intronic
1021567958 7:22032822-22032844 CTCTTGGTGCCTCCTCTGCCTGG - Intergenic
1022335399 7:29417098-29417120 CTCCTTCTGGCTCCCCTGCCAGG + Intronic
1022341169 7:29469565-29469587 CATGTGCTGTACCCTCTGCCTGG + Intronic
1022517612 7:30986058-30986080 CACGTGCTGTTTCCTCTACCTGG - Intronic
1022859205 7:34349070-34349092 CGGGTGCTGGAGCCTCTGCAGGG - Intergenic
1023859864 7:44212126-44212148 CTAGTGCTAGTTTCTCTGCCTGG + Intronic
1028273985 7:88828444-88828466 CTAGTGTTGTTTCCTCTGCCTGG + Intronic
1029439689 7:100580130-100580152 CACATGCTGGGTCCTCTGCCTGG + Intronic
1031915958 7:127563485-127563507 CTCTTGCTGTATCTTCTACCTGG - Intergenic
1032429156 7:131846934-131846956 CTCATGCTGTTCCCTCTGCCTGG - Intergenic
1032695481 7:134332420-134332442 TTTGTGCTGTTTCCTCTGCCTGG + Intergenic
1033236109 7:139639037-139639059 CTTGTCCTTGATCCTCAGCCTGG + Intronic
1034860007 7:154586731-154586753 CTCGTGCTGTTTCCTCCACCTGG + Intronic
1035268151 7:157703640-157703662 CTCCTGCAGGTGCCTCTGCCTGG - Intronic
1036690783 8:10943503-10943525 CTCCTGCTGTCCCCTCTGCCTGG + Intronic
1037450996 8:19014880-19014902 CTCATGCTGGCTCCTCTGGTGGG - Intronic
1038444873 8:27596356-27596378 CTCATGTTGGAACCTCTGTCAGG + Intergenic
1040954994 8:52970345-52970367 CTCTTGGTGCTTCCTCTGCCTGG - Intergenic
1041369273 8:57142564-57142586 CTCGTGCCGCATCCTCGGCAGGG + Intergenic
1042096839 8:65225407-65225429 CTCATGCTCTATCTTCTGCCTGG + Intergenic
1042124575 8:65525173-65525195 TGCTTGCTTGATCCTCTGCCTGG + Intergenic
1042951360 8:74203697-74203719 CTCATGCTATTTCCTCTGCCTGG + Intergenic
1044295766 8:90525466-90525488 CTCTTGCTGTTTCCCCTGCCTGG + Intergenic
1046859220 8:119071467-119071489 CTCTTGATGGCTCCTCTGCCTGG + Intronic
1047224384 8:122944034-122944056 CTCATGCTGTCTGCTCTGCCTGG + Intronic
1048304660 8:133275457-133275479 CTTGTGCTGTTACCTCTGCCTGG + Intronic
1049224206 8:141441878-141441900 CACGTTCTGGTTCCTATGCCTGG + Intergenic
1049864775 8:144927560-144927582 CTCAGACTGGATCCTCAGCCAGG + Intergenic
1051504426 9:17812078-17812100 CTCTTGCTGAATCCTCTGTCTGG - Intergenic
1053456777 9:38239087-38239109 TACGTGCTGTCTCCTCTGCCTGG + Intergenic
1054920413 9:70537434-70537456 CTCGGCCTGGTTCCTCTGCTGGG + Intronic
1056105618 9:83343586-83343608 CTCGTGCGGGAGCTGCTGCCAGG - Intronic
1056896105 9:90552173-90552195 CTGGTGTTGGATCCTCTCCTAGG + Intergenic
1057076235 9:92139567-92139589 GTCGTGCTGGCTGCTCAGCCGGG + Intergenic
1057297663 9:93859012-93859034 CACTTGCTGTTTCCTCTGCCTGG - Intergenic
1057745547 9:97748186-97748208 CTCATGCTGTTTCCTCTGCCTGG + Intergenic
1058295288 9:103298844-103298866 CTCCTACTGGTTCCTCTGTCTGG - Intergenic
1058795660 9:108496123-108496145 CTCGTGCTGGTGCCTGTGCATGG + Intergenic
1058952480 9:109916574-109916596 CCCATGCTGTCTCCTCTGCCTGG + Intronic
1059387864 9:113979056-113979078 CTTGTGCTTGGTCCTCTGGCAGG - Intronic
1059567494 9:115397721-115397743 CTCTTGCTTTGTCCTCTGCCTGG - Intronic
1059767173 9:117394660-117394682 CTCGAGCTGTGTCCTCTGTCAGG - Intronic
1059987493 9:119834888-119834910 CTCCAGCTGGCCCCTCTGCCTGG + Intergenic
1060229877 9:121818701-121818723 GTCTTGCTGGCCCCTCTGCCTGG - Intergenic
1060986862 9:127825076-127825098 CTCCTGCTGCGTCTTCTGCCTGG + Intronic
1061234342 9:129333928-129333950 CACTTGCTGCCTCCTCTGCCTGG + Intergenic
1061921893 9:133787175-133787197 CTGGTGCTGGCACTTCTGCCCGG - Intronic
1062043559 9:134415088-134415110 CCCTGGCTGGCTCCTCTGCCTGG + Intronic
1062400645 9:136371247-136371269 GTGGTGTTGGGTCCTCTGCCTGG - Intronic
1185892672 X:3835173-3835195 CTCACGCTGGGCCCTCTGCCTGG - Intronic
1185897780 X:3873593-3873615 CTCACGCTGGGCCCTCTGCCTGG - Intergenic
1185902899 X:3912024-3912046 CTCACGCTGGGCCCTCTGCCTGG - Intergenic
1187915359 X:24149215-24149237 CTCGAGCTGGAGCCTCGGCCAGG + Intronic
1188242488 X:27809000-27809022 CTCTTGGTGCCTCCTCTGCCTGG + Intronic
1193040270 X:76997141-76997163 CTCTTGGTGCCTCCTCTGCCTGG - Intergenic
1193565760 X:83075086-83075108 CACATGCTGTTTCCTCTGCCTGG - Intergenic
1194675128 X:96785378-96785400 CTCTTGCTGCATCCTCTGGAGGG + Intronic
1194703541 X:97145901-97145923 TTCATGCTGCATCCTCTGGCTGG + Intronic
1196775422 X:119333457-119333479 CTCTTGGTGCCTCCTCTGCCTGG + Intergenic
1196847211 X:119905689-119905711 CTCTTGCTGTTCCCTCTGCCTGG + Intronic
1198063808 X:133075586-133075608 CTTGTGCTGTTTTCTCTGCCTGG - Intronic
1199854446 X:151749087-151749109 CTCATGCTGTTCCCTCTGCCTGG + Intergenic
1199927085 X:152479521-152479543 CTCCTTCTGGAATCTCTGCCTGG + Intergenic
1201260422 Y:12153690-12153712 CTGGTGCTGTATCCTCAGCCTGG - Intergenic