ID: 1140833002

View in Genome Browser
Species Human (GRCh38)
Location 16:78768901-78768923
Sequence CTGACGCTGCGCCATGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140832998_1140833002 4 Left 1140832998 16:78768874-78768896 CCAATGCCGTTGTTTGTAAGCAG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1140833002 16:78768901-78768923 CTGACGCTGCGCCATGGTGTAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1140832997_1140833002 7 Left 1140832997 16:78768871-78768893 CCGCCAATGCCGTTGTTTGTAAG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1140833002 16:78768901-78768923 CTGACGCTGCGCCATGGTGTAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1140833000_1140833002 -2 Left 1140833000 16:78768880-78768902 CCGTTGTTTGTAAGCAGGAAGCT 0: 1
1: 0
2: 2
3: 11
4: 214
Right 1140833002 16:78768901-78768923 CTGACGCTGCGCCATGGTGTAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1140832996_1140833002 8 Left 1140832996 16:78768870-78768892 CCCGCCAATGCCGTTGTTTGTAA 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1140833002 16:78768901-78768923 CTGACGCTGCGCCATGGTGTAGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140833002 Original CRISPR CTGACGCTGCGCCATGGTGT AGG Intronic