ID: 1140833121

View in Genome Browser
Species Human (GRCh38)
Location 16:78769761-78769783
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140833113_1140833121 15 Left 1140833113 16:78769723-78769745 CCGAGCACAGTGACTCATGCCTG 0: 23
1: 784
2: 10502
3: 37751
4: 89843
Right 1140833121 16:78769761-78769783 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1140833114_1140833121 -4 Left 1140833114 16:78769742-78769764 CCTGTCTGTAATCCCAGCACTTT 0: 128
1: 2077
2: 2971
3: 2293
4: 2270
Right 1140833121 16:78769761-78769783 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140833121 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr