ID: 1140834994

View in Genome Browser
Species Human (GRCh38)
Location 16:78785301-78785323
Sequence GGGTGCTCAAAGCTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140834994_1140835000 11 Left 1140834994 16:78785301-78785323 CCCAGCAGCAGCTTTGAGCACCC 0: 1
1: 0
2: 3
3: 19
4: 170
Right 1140835000 16:78785335-78785357 TTTCTTGGGCAGCAGCAGCTAGG 0: 1
1: 0
2: 1
3: 21
4: 320
1140834994_1140834996 -4 Left 1140834994 16:78785301-78785323 CCCAGCAGCAGCTTTGAGCACCC 0: 1
1: 0
2: 3
3: 19
4: 170
Right 1140834996 16:78785320-78785342 ACCCTGCTCTGAATGTTTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 278
1140834994_1140834998 -3 Left 1140834994 16:78785301-78785323 CCCAGCAGCAGCTTTGAGCACCC 0: 1
1: 0
2: 3
3: 19
4: 170
Right 1140834998 16:78785321-78785343 CCCTGCTCTGAATGTTTCTTGGG 0: 1
1: 1
2: 3
3: 19
4: 188
1140834994_1140835002 29 Left 1140834994 16:78785301-78785323 CCCAGCAGCAGCTTTGAGCACCC 0: 1
1: 0
2: 3
3: 19
4: 170
Right 1140835002 16:78785353-78785375 CTAGGGAAGAAACTCAGTTAAGG 0: 1
1: 0
2: 2
3: 16
4: 186
1140834994_1140835001 12 Left 1140834994 16:78785301-78785323 CCCAGCAGCAGCTTTGAGCACCC 0: 1
1: 0
2: 3
3: 19
4: 170
Right 1140835001 16:78785336-78785358 TTCTTGGGCAGCAGCAGCTAGGG 0: 1
1: 0
2: 0
3: 13
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140834994 Original CRISPR GGGTGCTCAAAGCTGCTGCT GGG (reversed) Intronic
900488601 1:2935313-2935335 GGGGGCTCAGACCTGCGGCTCGG - Intergenic
901794168 1:11671014-11671036 GGGTGCTCCAAGGTGCAGTTGGG + Intronic
902517078 1:16995317-16995339 GAGTGCACAAAGGAGCTGCTGGG - Intronic
902550243 1:17214960-17214982 TGGTTTTCAAAGCTCCTGCTGGG + Intronic
904983049 1:34522865-34522887 GGGAGGTGAAAGCAGCTGCTAGG - Intergenic
905617947 1:39413994-39414016 GGGTGGGCACTGCTGCTGCTGGG - Exonic
905617984 1:39414150-39414172 GGGTGGGCACTGCTGCTGCTGGG - Exonic
908409930 1:63853443-63853465 TGATGCTCAAAGGTGCTCCTTGG + Intronic
909712930 1:78673032-78673054 TGGTGCTAGCAGCTGCTGCTGGG - Intergenic
910234735 1:85023906-85023928 CAGTATTCAAAGCTGCTGCTAGG + Intronic
912499886 1:110114727-110114749 GGGGGCTCAAGCCTGCTCCTTGG + Intergenic
912728211 1:112077723-112077745 GGGTGCTCAAGGGTGGTGATGGG + Intergenic
914756258 1:150563048-150563070 AGGTGCTCACAGCTGCAGCATGG + Intergenic
917632542 1:176904331-176904353 AGCTGCACACAGCTGCTGCTCGG - Intronic
920965770 1:210699449-210699471 GGCTTCTCAAAGCTCCTCCTCGG - Intronic
921222353 1:212982085-212982107 GGGTGCTCAAAGCAGGAGGTAGG - Intronic
922731337 1:227950080-227950102 GGGACCACTAAGCTGCTGCTGGG - Intergenic
923739699 1:236644150-236644172 AGTTGCTGAAAGCTGTTGCTGGG + Intergenic
924797528 1:247302764-247302786 CGTTGCTCTAAGCTGCTGGTGGG + Intronic
1064778492 10:18806900-18806922 GGGAGCTCAAGGCTGCTGTGAGG - Intergenic
1065050811 10:21789029-21789051 GGGTGCTCAGAGCAGCTGTGGGG - Intronic
1069798365 10:71067503-71067525 GGGCGCTCAGAGCTGCAGCCAGG + Intergenic
1071278302 10:84076541-84076563 GGGCTCTCAAAGGTACTGCTTGG + Intergenic
1075068280 10:119304149-119304171 GGCTGCTCAAAGCTGCCTCTTGG - Intronic
1075331876 10:121579938-121579960 GGCTCCTAGAAGCTGCTGCTGGG + Intronic
1077179210 11:1204658-1204680 GGGAGCTCAGAGCTGCTGCTGGG - Intergenic
1077179244 11:1204795-1204817 GGGAGCTCAGAGCTGCTGCTGGG - Intergenic
1077179264 11:1204863-1204885 AGGAGCTCAGAGCTGCTGCCGGG - Intergenic
1077179282 11:1204931-1204953 CGGAGCTCAGAGCTGCTGCCAGG - Intergenic
1078188556 11:9073100-9073122 GATTGCTCAAAGCTGCTTCCTGG - Intronic
1081491092 11:43569595-43569617 AGATGCTCAAAGCTACAGCTGGG - Intronic
1083711520 11:64552615-64552637 AGGAGCTCTAAGCTGCTGCTGGG + Intergenic
1085056104 11:73404957-73404979 GGGTGCCGGAGGCTGCTGCTGGG + Intronic
1090836967 11:130461059-130461081 GGCTGCTCGAAGCTGCCTCTGGG + Intronic
1091567862 12:1661793-1661815 GGGAACTCGAGGCTGCTGCTGGG - Intergenic
1091853942 12:3723763-3723785 GGGATCCCAAAGCTGCTCCTTGG + Intronic
1097276316 12:57815790-57815812 GGGTGCTCAAAGCAGGTGGTTGG - Intronic
1098901450 12:76115777-76115799 GAGTGGTCAAAGCTGCTGAAGGG - Intergenic
1098957370 12:76701715-76701737 GGGTGCTCCAACCTGCTGATTGG - Intergenic
1100141941 12:91629961-91629983 GGGTGCTCAAAGCAGATTTTTGG - Intergenic
1103927626 12:124432667-124432689 GGGTCCTCACAGCTGGTCCTTGG - Intronic
1104302504 12:127577197-127577219 GGTTTCTCTAAGCTGCTGATGGG + Intergenic
1105296869 13:19095326-19095348 GGTTGGCCAAAGCTGGTGCTGGG + Intergenic
1105793303 13:23824554-23824576 GGGAAATCAGAGCTGCTGCTTGG - Intronic
1106032408 13:26015275-26015297 GGGTGGTCAGAGCTGGTCCTGGG + Intronic
1113542813 13:111122202-111122224 GAGTGCACACAGCTGCTGGTTGG + Intronic
1113646548 13:112001010-112001032 GGACGCTCAATGGTGCTGCTGGG + Intergenic
1115575336 14:34705477-34705499 GGGTAATCAAAGCTGCTTCCTGG + Intergenic
1121505717 14:94474997-94475019 GGGTCCTCAAAGATGCAGCTGGG - Intronic
1122444220 14:101757543-101757565 GGGTGACCAAAGCTGCAGCCTGG + Intergenic
1124558044 15:30746000-30746022 ATGAGCTCAAAGCTGCTGCCTGG - Intronic
1124673200 15:31659649-31659671 ATGAGCTCAAAGCTGCTGCCTGG + Intronic
1127919332 15:63481064-63481086 GGTTTCTCATAGCTGCTGCCTGG + Intergenic
1129294559 15:74592759-74592781 GGGTCCTCAAAGTTGGGGCTGGG + Intronic
1132908247 16:2295316-2295338 GGGTGCTCAGCGCTGATGCAGGG - Intronic
1133019807 16:2962473-2962495 GGGTGCTCAGTGCTGAGGCTGGG - Intergenic
1139747934 16:69089446-69089468 CTGAGGTCAAAGCTGCTGCTGGG - Intergenic
1139910420 16:70394225-70394247 GGGTGCTGAAAGGAGCTGTTCGG - Intronic
1140834994 16:78785301-78785323 GGGTGCTCAAAGCTGCTGCTGGG - Intronic
1143187533 17:5019719-5019741 TGGTTTTCTAAGCTGCTGCTGGG + Intronic
1143967535 17:10767530-10767552 TTATGCTCAAAGCAGCTGCTGGG + Intergenic
1144776754 17:17788679-17788701 GTGGCCTCAGAGCTGCTGCTGGG + Intronic
1145912621 17:28551420-28551442 GGCTGCTCATAGCTGCTGCCTGG - Intronic
1146234614 17:31146700-31146722 GGTTGGCCAAAGCTGGTGCTGGG - Intronic
1146236032 17:31163505-31163527 GGGAGGTCAAAGCTGCTGTGAGG - Intronic
1148048559 17:44758590-44758612 GGGCGCTCCAAGCTGGGGCTGGG + Intergenic
1149980690 17:61309006-61309028 AGGTCCTCAAAGCCTCTGCTGGG - Intronic
1150057644 17:62033485-62033507 GTGTACTCAGAGCTTCTGCTGGG - Intronic
1150809276 17:68344024-68344046 AGCTGCTCAAAGATGCTGCCGGG + Intronic
1150972928 17:70050478-70050500 AGGTGCTCAATGCTAATGCTGGG + Intergenic
1151835265 17:76578717-76578739 GGGTGCTCAAAACTGCCACAGGG + Intronic
1152644221 17:81461387-81461409 GGGTGCACATAGCTGGGGCTGGG - Exonic
1152700284 17:81815186-81815208 GGGTGCTCACAGCCCCTGCCTGG + Intergenic
1152729844 17:81964247-81964269 GGGTGCTCAAAACTCCGGGTGGG - Intergenic
1152840747 17:82566602-82566624 GGGTCTTCAAGGCTGCTGCTTGG - Intronic
1156698222 18:39793791-39793813 GGTTGCTGAAAGCTGATGCGGGG - Intergenic
1160520673 18:79506262-79506284 AGGTGCCCACAGCCGCTGCTCGG - Intronic
1160580201 18:79879320-79879342 GGGGGCGCTAAACTGCTGCTTGG - Intronic
1162345148 19:10114416-10114438 GGGTGCTCAACGTGGATGCTCGG + Exonic
1163734801 19:18973099-18973121 GGGTGCTCTTATCTGCTTCTGGG - Intergenic
1164528029 19:29026248-29026270 GGGTGCTCCAGGCTGCTCCACGG + Intergenic
1164690171 19:30204974-30204996 GGGTCCTCAGAGCAGCTGTTGGG + Intergenic
1166322720 19:42028596-42028618 AGGTGCTTACAGCTGGTGCTGGG - Intronic
925922870 2:8648764-8648786 GGGGCCTCAAGGCTGCTGCTGGG - Intergenic
926326920 2:11792937-11792959 GGGTCCTCAAAGCTCATGTTAGG + Intronic
926611266 2:14950704-14950726 GGGTGCACCAAGCTGAGGCTGGG + Intergenic
927972556 2:27314991-27315013 GGGTGCCCAGAGCTGCTCCATGG - Intronic
928942004 2:36735672-36735694 TGCTTCTCAAAGCAGCTGCTAGG + Intronic
932772065 2:74506009-74506031 GAGTGGTCAAAGCTGCTGAAGGG + Exonic
933785528 2:85838254-85838276 TGGTGCTCAAAGCTTCCACTTGG - Intergenic
933813537 2:86048233-86048255 GGGTTCTCCATCCTGCTGCTTGG - Intronic
934853115 2:97713644-97713666 TGGGCCTCAGAGCTGCTGCTGGG + Exonic
935057512 2:99580494-99580516 GGGTGCTCATAGCATCTACTGGG + Intronic
936261042 2:110959720-110959742 GGGTGCTGAATGCTGATCCTGGG - Intronic
939405058 2:141745641-141745663 GGGTACTCCAAGATCCTGCTTGG + Intronic
946363362 2:219233143-219233165 TGGTGCTCATGGCTGCAGCTGGG + Exonic
946420138 2:219560373-219560395 GGGTGCTAAATGCTGATTCTGGG + Intronic
947295246 2:228623820-228623842 GGGCTGTCAAAGCTGCTGCTAGG + Intergenic
948224483 2:236298533-236298555 GGGTGCTGACACCTGCTGATGGG + Intergenic
948584861 2:239012955-239012977 GGGTACTGAGAGGTGCTGCTGGG + Intergenic
949050495 2:241895185-241895207 GGGTGAACATAGCTGTTGCTCGG - Intronic
1169076550 20:2763386-2763408 GGCTGGTCAAAGCTGCTGCCTGG - Intergenic
1170269029 20:14503225-14503247 GTGTACTCTAAGCTTCTGCTAGG - Intronic
1172597665 20:36161231-36161253 GGATGCTCTAAGCTGCTGCTTGG + Intronic
1174112444 20:48205810-48205832 GGGCCCTCACAGCTGCTGCAGGG + Intergenic
1174168791 20:48603709-48603731 GAGTCCTCACAGCTGCTGCAGGG - Intergenic
1174277833 20:49416698-49416720 GGTTGCTCACAGCTTCTCCTGGG + Intronic
1175302908 20:57955622-57955644 GAGTGGTCAAGGCTGCTGCCTGG - Intergenic
1175846504 20:62062081-62062103 GGGTTCTCAAAGCTGCATGTGGG - Intronic
1176007008 20:62870933-62870955 GAGTGATCAAAGCTGGTTCTGGG + Intergenic
1178632377 21:34273758-34273780 GAGTTCTCAAATCTGCTGCATGG - Intergenic
1179556610 21:42182710-42182732 GGGGGCCCAGAGCTGCTCCTTGG - Intergenic
1180824802 22:18854940-18854962 CGGGGCTCACAGCTGCTGGTGGG + Intronic
1181125222 22:20698091-20698113 GGGGGCTCACAGCTGCTGGTGGG + Intergenic
1181187926 22:21119607-21119629 GGGGGCGCACAGCTGCTGGTGGG - Intergenic
1181211272 22:21290886-21290908 GGGGGCGCACAGCTGCTGGTGGG + Intergenic
1181398234 22:22636002-22636024 GGGGGCTCACAGCTGCTGGTGGG - Intergenic
1181500970 22:23315371-23315393 CGGGGCTCACAGCTGCTGGTGGG - Intronic
1181651178 22:24260058-24260080 CGGGGCTCACAGCTGCTGGTGGG + Intergenic
1181706201 22:24650681-24650703 GGGGGCTCACAGCTGCTGGTGGG - Intergenic
1183358855 22:37373066-37373088 GGGGGGTCACAGCTTCTGCTGGG + Exonic
1185017390 22:48352719-48352741 GGGTGCCCAAAGCTGGAGATGGG - Intergenic
1203215677 22_KI270731v1_random:4545-4567 GGGGGCTCACAGCTGCTGGTGGG - Intergenic
1203274949 22_KI270734v1_random:80846-80868 GGGGGCTCACAGCTGCTGGTGGG + Intergenic
950462755 3:13135181-13135203 GGGTGCTCAAACCTGTGCCTGGG + Intergenic
950878227 3:16298223-16298245 AGGTGCTAAAATATGCTGCTGGG + Intronic
952835302 3:37596993-37597015 AGGTGTTCTAAGCAGCTGCTGGG + Intronic
954495701 3:50958695-50958717 GGTTGCTCCACGTTGCTGCTGGG + Intronic
954517312 3:51190342-51190364 TGGTGCTGATAGCTGCTGGTGGG - Intronic
955033479 3:55243133-55243155 GGGTGATAAAAGCAGCTGCATGG + Intergenic
955058627 3:55477370-55477392 CAGAGCTGAAAGCTGCTGCTGGG - Intronic
955105732 3:55895966-55895988 GGGTTCTCCAGGCGGCTGCTGGG - Intronic
956736035 3:72239003-72239025 GGCTGCTTAAAACAGCTGCTGGG - Intergenic
960782105 3:121330934-121330956 TGGTGCTAATACCTGCTGCTGGG + Intronic
960994758 3:123333477-123333499 GGGGGCTCCACGCGGCTGCTGGG + Intronic
961420440 3:126798649-126798671 GGCTCCTCAAAGCAGCGGCTGGG + Intronic
961814606 3:129543077-129543099 GAGTGCTCCAAGCTGCTGACTGG - Intergenic
965960285 3:174421391-174421413 TGGTTCTCAAAACTCCTGCTTGG + Intergenic
966255103 3:177908525-177908547 GGATGCTCAAACTTGCTGCCAGG - Intergenic
968669171 4:1839470-1839492 GTGTGCTGAAAACTGCTGCTGGG + Intronic
969075129 4:4572233-4572255 GGGTCCTGACAGCTGGTGCTAGG + Intergenic
970106118 4:12586764-12586786 GGGTTCTGAAAGCTTCTGTTTGG + Intergenic
971048522 4:22832489-22832511 AGGTGCTCAGAGCAGCTGCAGGG - Intergenic
971322122 4:25614138-25614160 GGGTGCCCAAAGGTGCAGGTTGG + Intergenic
971505120 4:27358310-27358332 GGGTGCTCTAAGTTGCTAGTGGG + Intergenic
973940459 4:55904562-55904584 GGGTTCTCAAAACAGTTGCTTGG - Exonic
974107901 4:57491551-57491573 GTGTGCTCACATCTGCTGGTAGG - Intergenic
981923817 4:150116550-150116572 GGGTACTCCAGGCTGGTGCTAGG + Intronic
984707134 4:182855826-182855848 GGGAGCTCAATGTTGCAGCTAGG + Intergenic
987059877 5:14232404-14232426 GGGTGCTGTAAGCTGGTGCAGGG - Intronic
988967258 5:36432046-36432068 GGGTGTTCACAGCAGCTGCAGGG + Intergenic
992996753 5:82341454-82341476 GAGTTCTCAAAACTGCAGCTGGG - Intronic
997373151 5:133375158-133375180 GGGTGCTCAAGAGTGCTGCAGGG - Intronic
998286030 5:140861846-140861868 TGGTGCTCAAAGCAACTGATGGG + Intronic
1003135966 6:3435048-3435070 GGGTGCTGGAAGCGGCTGCTGGG + Intronic
1007173899 6:39883501-39883523 GGATCCTCAAAGCTGCAGCACGG - Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1015671241 6:135692615-135692637 GGGTTCTCACATCTGCTGCTAGG - Intergenic
1016994020 6:149948187-149948209 GGGGGGTCTGAGCTGCTGCTGGG + Intronic
1018400954 6:163418942-163418964 GTGGGCTTAAAGCTGCTGATAGG + Intronic
1018985828 6:168636637-168636659 TAGCGGTCAAAGCTGCTGCTGGG + Intronic
1019625567 7:2014118-2014140 GGGTGCTCAGAGTTGTTGCCAGG - Intronic
1019884093 7:3889095-3889117 GAGTGCTAAGAGCTGCTACTGGG - Intronic
1023331031 7:39117213-39117235 GGTTGCTGAAAGCTTCAGCTTGG + Intronic
1025812161 7:64882261-64882283 GGGCGCTGAAAGCTGCTCTTGGG - Intronic
1026054204 7:66970654-66970676 GGGGGCTCGAAACTGCAGCTGGG - Intergenic
1027776484 7:82471808-82471830 GAGTGCTCAGAGCTGCAGCAAGG - Intergenic
1029672351 7:102042175-102042197 TGGCTCCCAAAGCTGCTGCTGGG + Intronic
1031954720 7:127930461-127930483 TGGAGCTCACTGCTGCTGCTTGG + Intronic
1032497015 7:132370102-132370124 GGGAGCTCAAACCTGCTGTCAGG - Intronic
1033952340 7:146800557-146800579 GGTTGTTCAAAGCTGCTCCCTGG + Intronic
1035680341 8:1483134-1483156 CGGTGCACCGAGCTGCTGCTGGG + Intergenic
1036603760 8:10287998-10288020 GAGTGCTCAGAGCTCATGCTAGG + Intronic
1042519361 8:69694829-69694851 GAGTGCTGGAAGCTGCTGCAAGG - Intronic
1045941186 8:107740010-107740032 GGTTCCTCCAAGCTGCTGCATGG + Intergenic
1046199040 8:110897916-110897938 TGATACTCAAAGCAGCTGCTTGG - Intergenic
1048979366 8:139694828-139694850 GGCTGCTCGAAGGTGGTGCTAGG - Intronic
1049307016 8:141909389-141909411 GGGTGAACAGAGCTGCTGGTGGG - Intergenic
1051144527 9:14012487-14012509 ATGGACTCAAAGCTGCTGCTGGG - Intergenic
1051598451 9:18848616-18848638 GGGTGCTCCAAGAGGCTGCATGG - Intronic
1051629935 9:19131583-19131605 GGGTGGTCAAGGCTGCAGTTGGG + Intronic
1057198672 9:93129083-93129105 GGGTGCTGAGAGCTGAGGCTTGG - Intronic
1057211725 9:93204271-93204293 GGGTGCTCAACATTTCTGCTGGG + Intronic
1057283307 9:93727801-93727823 GGGAGCTCAAGGATGCTGCCAGG + Intergenic
1059075736 9:111192049-111192071 GGGACATCAGAGCTGCTGCTTGG - Intergenic
1059149725 9:111938562-111938584 GGGTGCCCACAGCTGCTTCCGGG - Intergenic
1189086506 X:38030783-38030805 GGCTGCTCTAAGCTCCTTCTGGG - Intronic
1189231337 X:39454567-39454589 GGGTGCTGTTAGCAGCTGCTTGG - Intergenic
1190693336 X:52930865-52930887 GTGTGGTCAAAGCTCCTACTGGG - Intronic
1192905538 X:75546739-75546761 TGGTGCTGATACCTGCTGCTGGG - Intergenic
1196752943 X:119133593-119133615 GGGTGCTCACACCTGCTCCTAGG - Intronic
1199768523 X:150958391-150958413 GGCTGCTCAAGGCTGCTGGGAGG - Intergenic
1200208597 X:154335189-154335211 GGGTGCTCAGGGCACCTGCTGGG + Intergenic