ID: 1140838658

View in Genome Browser
Species Human (GRCh38)
Location 16:78818721-78818743
Sequence GCAAGCTAGTTACATGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140838658_1140838663 2 Left 1140838658 16:78818721-78818743 CCTCTACCATGTAACTAGCTTGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1140838663 16:78818746-78818768 GTCAAGTCATTAACTATTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 55
1140838658_1140838661 0 Left 1140838658 16:78818721-78818743 CCTCTACCATGTAACTAGCTTGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1140838661 16:78818744-78818766 CAGTCAAGTCATTAACTATTCGG 0: 1
1: 0
2: 1
3: 14
4: 165
1140838658_1140838665 28 Left 1140838658 16:78818721-78818743 CCTCTACCATGTAACTAGCTTGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1140838665 16:78818772-78818794 TAGTTTCGTCTTTTCTGAATTGG 0: 1
1: 0
2: 0
3: 14
4: 279
1140838658_1140838662 1 Left 1140838658 16:78818721-78818743 CCTCTACCATGTAACTAGCTTGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1140838662 16:78818745-78818767 AGTCAAGTCATTAACTATTCGGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140838658 Original CRISPR GCAAGCTAGTTACATGGTAG AGG (reversed) Intronic
902191980 1:14770104-14770126 TCAAGCTAGAGACATGGTTGGGG + Intronic
912202607 1:107475435-107475457 GCAAGCAAATTACATAGCAGGGG + Intronic
913575137 1:120164667-120164689 TCAACCTAGGTACATGTTAGTGG - Intronic
917228794 1:172813873-172813895 GCAAGTTAGTTACTTGGTTTTGG + Intergenic
923320326 1:232826140-232826162 CCAAGCTGGTTTAATGGTAGTGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1069880931 10:71592716-71592738 GCATGCTACTTACATGGCAAAGG - Intronic
1071452273 10:85808427-85808449 GCAAGCTAGTTACGTGTCATAGG - Intronic
1077939473 11:6825246-6825268 AAAAGCTAGTGACATGGTACTGG - Intergenic
1082650464 11:55785470-55785492 GCAACCTAGTAAAATGATAGAGG - Intergenic
1084106746 11:66985423-66985445 GCAGGCTAGTTGCAGGGTGGAGG - Intergenic
1093689285 12:22091192-22091214 GCAAGATGCTTACATGCTAGAGG - Intronic
1099888715 12:88563426-88563448 GCAAACAAGTTGCATGATAGGGG - Intronic
1104218195 12:126755587-126755609 GAAAGCTACTTCCATGGCAGAGG - Intergenic
1108968449 13:56341723-56341745 GCAAGTTAGTTACATCCTACAGG + Intergenic
1114230383 14:20776304-20776326 CCAAGCCAGTTCCTTGGTAGGGG - Intergenic
1123848818 15:24332666-24332688 GCCAACTAGTTCCATGTTAGAGG - Intergenic
1123867878 15:24540171-24540193 GCCAACTAGTTCCATGTTAGAGG - Intergenic
1126512952 15:49501268-49501290 GGAAACTAGTTAAATGGTTGTGG + Intronic
1131913074 15:97230414-97230436 GCAAGTTAGTTACTTGGTTAAGG + Intergenic
1131997113 15:98143631-98143653 GGAAGCTAGTTCCATGCTAGCGG + Intergenic
1134002650 16:10794731-10794753 CCCAGCTAGGTACCTGGTAGGGG + Intronic
1134647550 16:15882133-15882155 GCAAGCACGTTACATGGTGAAGG - Intronic
1139139585 16:64244762-64244784 GCAAACTATTTACATGGCAAGGG + Intergenic
1139300475 16:65941450-65941472 GCAAGCTAGTTGCAGCGCAGTGG - Intergenic
1139649244 16:68353928-68353950 ACAGGTTATTTACATGGTAGGGG + Intronic
1140838658 16:78818721-78818743 GCAAGCTAGTTACATGGTAGAGG - Intronic
1141229440 16:82151237-82151259 GCAGTCTAGTTTTATGGTAGAGG - Intronic
1152817538 17:82417223-82417245 GCAAGCTAGTCTGATGGTAGTGG + Intronic
1154168641 18:12035091-12035113 CCCAGCTAGTTACATGGCTGAGG + Intergenic
1167537097 19:50060637-50060659 GCAAGCTGATTACTTGGAAGTGG + Intergenic
927411338 2:22829675-22829697 GCAAGGTAGTAACAGGGTGGTGG - Intergenic
933256530 2:80087401-80087423 CCAAGCTAGTTACAAGGAAACGG + Intronic
936722726 2:115273147-115273169 CCAAGCAAGTTACATTGAAGGGG - Intronic
937496633 2:122427176-122427198 GCATGTCAGTTCCATGGTAGTGG - Intergenic
940481657 2:154240730-154240752 ACAAGGTAGTGACAAGGTAGAGG - Intronic
945395990 2:209318330-209318352 GAAAGATAGTTACATATTAGCGG - Intergenic
1174516676 20:51097836-51097858 GCAAGCTAGTTGCATCGTGGTGG + Intergenic
950143010 3:10628135-10628157 GGAAGCTAGAGACATGGCAGAGG + Intronic
951310638 3:21121817-21121839 GACAGCCAGTTACATGGTAGGGG - Intergenic
951756932 3:26101384-26101406 GCAAGCTTGTAAAATGGAAGAGG + Intergenic
952204613 3:31168355-31168377 GCAAGGTGTTTACATGGCAGTGG - Intergenic
956513872 3:70024634-70024656 GAAAGATACTTACATGGAAGAGG + Intergenic
958953284 3:100439458-100439480 GCAAGCTTCTTCCATGGCAGTGG + Intronic
970457182 4:16236490-16236512 GCAAGCTAGGCACAGGGCAGAGG + Intergenic
974558197 4:63479645-63479667 GCAAGTTACTTACCTGGTAATGG + Intergenic
974890152 4:67871762-67871784 GCATGGTGGTAACATGGTAGGGG + Intronic
977449753 4:97179949-97179971 GCAATCTAGTAATATGGTAGTGG - Intergenic
977923113 4:102667904-102667926 GCAAACTCTTTACAAGGTAGGGG + Intronic
982637427 4:157914616-157914638 GCAAGGTATTTTCATTGTAGTGG + Intergenic
989804865 5:45590808-45590830 GATAGCTAGTTACATTGTATTGG + Intronic
995022450 5:107381729-107381751 GCAAGCAAGTGACATGTTGGTGG + Intronic
996431305 5:123381219-123381241 GTAAGCTAGATATATTGTAGTGG - Intronic
1001403938 5:171462510-171462532 GCAAGCTAATTGCATGGTTGGGG - Intergenic
1020508081 7:9018800-9018822 GCAAGCAAGTTACATGTCTGCGG - Intergenic
1028455164 7:91030630-91030652 GCAAGCCTGTCACCTGGTAGAGG + Intronic
1033616563 7:143022256-143022278 GCAGGCTTCTTACATGGCAGGGG + Intergenic
1038505172 8:28078056-28078078 CCCAGCTAGTTACATGCTAACGG - Intronic
1055317806 9:75051557-75051579 GCAAGCTACATGCATGATAGTGG + Intergenic
1060038491 9:120279729-120279751 GCAGGCAAGTTACATGATAAAGG + Intergenic
1062154502 9:135039146-135039168 GCAAGCGTGTTGCATGGCAGGGG - Intergenic
1197895407 X:131308015-131308037 TCAAGCTCCTTACATGTTAGGGG + Intronic