ID: 1140841868

View in Genome Browser
Species Human (GRCh38)
Location 16:78847178-78847200
Sequence CATATTTAGAACTAAGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140841867_1140841868 9 Left 1140841867 16:78847146-78847168 CCATGGAGGCTTGGTTCGTTTTA 0: 1
1: 0
2: 5
3: 32
4: 284
Right 1140841868 16:78847178-78847200 CATATTTAGAACTAAGATCTAGG 0: 1
1: 0
2: 2
3: 20
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140841868 Original CRISPR CATATTTAGAACTAAGATCT AGG Intronic
901588372 1:10317490-10317512 CATACTTAGCACCTAGATCTTGG - Intronic
903109670 1:21120695-21120717 CATATTTATAACTGGTATCTTGG - Intronic
903432967 1:23322670-23322692 CATAATAAAAACTAAAATCTGGG + Intronic
906957989 1:50392701-50392723 AATATTTAGGACCAAGTTCTGGG + Intergenic
909844256 1:80371189-80371211 CTTATTTAGAACTTAGAGATGGG + Intergenic
911091003 1:94016814-94016836 CATATCTAGCACTCAGACCTTGG + Intronic
911490419 1:98558668-98558690 CATATCTAGAACTTCAATCTGGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
913582658 1:120242072-120242094 TATTTTTAGAACCTAGATCTGGG + Intergenic
913625515 1:120656288-120656310 TATTTTTAGAACCTAGATCTGGG - Intergenic
913714981 1:121524383-121524405 TATATTTAGCACCCAGATCTTGG + Intergenic
914564587 1:148853565-148853587 TATTTTTAGAACCTAGATCTGGG + Intronic
914608239 1:149276677-149276699 TATTTTTAGAACCTAGATCTGGG - Intergenic
915679491 1:157566855-157566877 CAAGTTTAGAACTAACATTTGGG + Intergenic
915683116 1:157601857-157601879 CATACTCAGCACTCAGATCTTGG - Intergenic
916388390 1:164303464-164303486 CGTATTCAAAACTAAGTTCTTGG - Intergenic
916481784 1:165220841-165220863 CAAAATTAGAACTAGGATCCAGG - Intronic
917884544 1:179370445-179370467 CATCTTTAGAAGAAAGAACTAGG + Intronic
918803456 1:189004857-189004879 CATATTTTCAACTAATATGTAGG + Intergenic
919296953 1:195714236-195714258 TATATTAAGAACCAACATCTAGG + Intergenic
923480758 1:234381108-234381130 GATATTAAGATCAAAGATCTTGG - Intronic
923796394 1:237160509-237160531 TAGATTTAGAACTAATGTCTGGG + Intronic
924485760 1:244481959-244481981 CACATTAAGACCTAAGAGCTAGG + Intronic
924570219 1:245231212-245231234 AATATTTAAAACTACAATCTAGG + Intronic
1066401739 10:35083448-35083470 CACACATAGAACTTAGATCTTGG + Intronic
1068824625 10:61421461-61421483 CTTATTTAGAAATAGGGTCTTGG + Intronic
1068893861 10:62178459-62178481 AGTATTTAGAACCAAGATCTGGG + Intergenic
1069078989 10:64067927-64067949 CATTTTTAGGACTGAGATCCAGG - Intergenic
1072934212 10:99696370-99696392 CATATTCAGACCTAACATCATGG + Intronic
1074643289 10:115413816-115413838 CATACCTAGCACCAAGATCTTGG - Intronic
1076095992 10:127735816-127735838 AAAATTTGGAACTACGATCTGGG + Intergenic
1076490342 10:130857168-130857190 ATTATTTAGAATTAAGATTTGGG + Intergenic
1079820906 11:25126997-25127019 CACAATTAGAACTAAGAGCATGG + Intergenic
1081112046 11:39148333-39148355 CATATTTATAACTAAGTTGAAGG - Intergenic
1081916295 11:46732922-46732944 GGAATTTAGAACTGAGATCTGGG + Intronic
1082208299 11:49466100-49466122 CATTTTTAGAAATATGTTCTAGG + Intergenic
1082623225 11:55450389-55450411 CTAATTAAGAACTAAGATTTTGG + Intergenic
1082914774 11:58421040-58421062 CATGTATAAAACTAAAATCTTGG - Intergenic
1085429070 11:76430917-76430939 AATATTTAAAACTAATATCATGG - Intergenic
1086222586 11:84467066-84467088 CGTATCTAGCACAAAGATCTTGG + Intronic
1086641231 11:89158558-89158580 CATTTTTAGAAATATGTTCTAGG - Intergenic
1087366713 11:97229170-97229192 CATATGCTGAACTATGATCTTGG + Intergenic
1087372121 11:97298237-97298259 CATATTTAGAAATGTGATGTCGG + Intergenic
1089105281 11:115997944-115997966 AATATTCAGAACAAAGAGCTTGG - Intergenic
1089212956 11:116818949-116818971 CATATTAAGAACCAAGTTCTGGG + Intergenic
1089380962 11:118031295-118031317 CACATCTACCACTAAGATCTTGG + Intergenic
1089461447 11:118656556-118656578 CCTATTTAGGACTAAGCTCCAGG + Intronic
1091159196 11:133404294-133404316 CTTATTTGGAAATAAAATCTTGG - Intronic
1093727101 12:22526765-22526787 AATGTTTAGAGATAAGATCTGGG - Intronic
1093859291 12:24143509-24143531 CATATCTAGAAGTTAGATTTGGG - Intergenic
1095166032 12:38973104-38973126 CACACTTAGCACTCAGATCTTGG - Intergenic
1096989762 12:55790515-55790537 GCTATATAGAATTAAGATCTGGG + Intronic
1098169478 12:67732085-67732107 CTTATTTGGAAATAGGATCTTGG - Intergenic
1098257635 12:68633568-68633590 CACAGTTAAAACTAATATCTCGG + Intronic
1099501856 12:83423029-83423051 CTTATTTAGAAATAGGATATTGG + Intergenic
1099832830 12:87867143-87867165 CATATTAAAAACCAAGATTTGGG - Intergenic
1100298030 12:93280842-93280864 CATTTTTAGAATTAATATGTGGG - Intergenic
1100350703 12:93779267-93779289 GATAGTTAGAACTAAGTTCAGGG - Intronic
1101268451 12:103116970-103116992 CATATATAGTAATCAGATCTGGG + Intergenic
1104620101 12:130304981-130305003 CATATTTTGTACAAAGATCTTGG + Intergenic
1105359119 13:19690673-19690695 AAAATTTAGAACTAAAATCACGG - Intronic
1105644788 13:22304982-22305004 GATATTAAAAACCAAGATCTGGG + Intergenic
1107004024 13:35586461-35586483 CATTTTTAAAAGTAAGATTTGGG - Intronic
1107563259 13:41576665-41576687 CATATTTAGACATAATATATGGG - Intronic
1107826121 13:44330469-44330491 CATATTTAGCACTTACATATAGG + Intergenic
1109121989 13:58469308-58469330 CATATTTCGAATTGAGATTTGGG + Intergenic
1109159474 13:58954613-58954635 CATATTTTTAACAAAGACCTTGG + Intergenic
1110029344 13:70586578-70586600 CAGACTCAGAACTAAGATTTTGG - Intergenic
1110507824 13:76309417-76309439 CATAATTACAACTTATATCTTGG + Intergenic
1110940812 13:81345344-81345366 TATATTTAGAGACAAGATCTTGG + Intergenic
1111675698 13:91385723-91385745 CAGATCTAGAACACAGATCTGGG - Intergenic
1112583373 13:100695409-100695431 CATATTTAGGCCAAATATCTTGG + Intergenic
1115984278 14:39088036-39088058 CATATTTAGTACTAATAACCTGG + Intronic
1120107106 14:80508387-80508409 GATATTTATAAGTAAGACCTGGG - Intronic
1120968102 14:90185130-90185152 CATCTTTAGAAATCTGATCTCGG + Exonic
1123196791 14:106624731-106624753 CATTTTTAAAAACAAGATCTTGG - Intergenic
1127158806 15:56158217-56158239 CAAATCTGGAACTCAGATCTGGG - Intronic
1129696349 15:77742525-77742547 CATAATTTGAACCCAGATCTGGG + Intronic
1131699094 15:94913562-94913584 TATATTTAGAAAAATGATCTAGG - Intergenic
1131753301 15:95533340-95533362 GATATTAAAAACCAAGATCTGGG - Intergenic
1132267766 15:100491173-100491195 CATATTTATAGATAAGATTTAGG + Intronic
1135069021 16:19336081-19336103 ATTATTTAGAATTAAGTTCTCGG - Intergenic
1140538263 16:75730850-75730872 CATACTTAGAACTGGGATCTGGG - Intronic
1140841868 16:78847178-78847200 CATATTTAGAACTAAGATCTAGG + Intronic
1141385265 16:83616779-83616801 CAATTTTAGAAGTAAGATCATGG + Intronic
1142923075 17:3208083-3208105 CAAAATTAGAACTCAAATCTTGG + Intergenic
1144487250 17:15677130-15677152 CATCTTTAGAAATAAGAGTTAGG - Intronic
1144913784 17:18705188-18705210 CATCTTTAGAAATAAGAGTTAGG + Intronic
1144956807 17:19022807-19022829 CAGATTCAGAGCTGAGATCTTGG - Intronic
1146592570 17:34140458-34140480 CATACCTACAACTCAGATCTTGG + Intronic
1147481264 17:40765825-40765847 CAAATTTAGAACTAAAGCCTAGG - Intergenic
1153017249 18:595246-595268 CATTTTTGGAACTACGATTTTGG + Intergenic
1154509792 18:15085517-15085539 CATTTTAATAAATAAGATCTGGG + Intergenic
1155343562 18:24836999-24837021 CTTATTAACAACTAAGGTCTTGG + Intergenic
1155670116 18:28360119-28360141 CATATTTAAAACTATAGTCTAGG - Intergenic
1156832852 18:41515722-41515744 AATATTTAGAACAATGATTTTGG + Intergenic
1157245672 18:46052177-46052199 CAAATATAGAACTAGGAGCTAGG + Intronic
1158628985 18:59095786-59095808 CATATTTAGAAATAGGGTCATGG + Intergenic
1164866937 19:31612386-31612408 GATATTAAGAACTAAGAACGGGG + Intergenic
1164965157 19:32476831-32476853 CATATTAAGTAATAAGATATTGG + Intronic
1167069900 19:47215200-47215222 CATGTTTAGAAAAAACATCTAGG + Intergenic
925364383 2:3301877-3301899 CAAATTTAGAACTCACATCTGGG + Intronic
925666945 2:6267932-6267954 GATATTAAAAACCAAGATCTGGG - Intergenic
926686779 2:15704284-15704306 GATATTTACAACAAAGATCCAGG - Intronic
928051475 2:28001032-28001054 CACATCTGGCACTAAGATCTTGG - Intronic
928155970 2:28877111-28877133 CCTATTTATAACTAAGTTTTTGG - Intergenic
928628832 2:33169993-33170015 AATATTTAGAAATAAAATCCAGG + Intronic
929337824 2:40772188-40772210 AATATTTAGAACACAGATTTTGG + Intergenic
932361662 2:71113377-71113399 CACACTTAGAACCTAGATCTTGG + Intronic
933357261 2:81227751-81227773 CATATCTAGTACTCTGATCTTGG + Intergenic
933985307 2:87586047-87586069 CATATTTAAAAATAAGTTCTGGG - Intergenic
935049426 2:99511706-99511728 CTTATTTGGAAATAGGATCTTGG - Intergenic
936308537 2:111364760-111364782 CATATTTAAAAATAAGTTCTGGG + Intergenic
937678030 2:124613436-124613458 CATCTGTAAAATTAAGATCTGGG + Intronic
940899877 2:159116868-159116890 CAAAGTTATAACTAAGCTCTTGG - Intronic
940958272 2:159753615-159753637 CATATTTAAATCCAAGATTTGGG - Intronic
941064075 2:160880975-160880997 CATATTAAAAGCCAAGATCTGGG + Intergenic
942367477 2:175242556-175242578 AATGTTTATAACTAAGATATTGG - Intergenic
943003825 2:182364094-182364116 GATATTTAGGGCTAAGACCTGGG - Intronic
944200484 2:197102110-197102132 CATCTTTAGAAGTGAGTTCTAGG - Intronic
945337093 2:208605337-208605359 GGTATTTAGAACCAAGAGCTGGG - Intronic
945449339 2:209975861-209975883 CATCTTAAGAACTACTATCTTGG - Intronic
945653030 2:212588617-212588639 CATATATAGCACTAAGAACATGG + Intergenic
945670119 2:212792526-212792548 CAGACTTAGAACTAAAATTTGGG - Intergenic
945794392 2:214343919-214343941 CATATTTAGAATGCAGTTCTGGG + Intronic
946723041 2:222631775-222631797 CATATTAAAAACTAACACCTTGG + Intronic
947116356 2:226775650-226775672 TATATTGGAAACTAAGATCTGGG - Intronic
947174165 2:227345332-227345354 AATATTTAGAATTATAATCTTGG - Intronic
948243072 2:236454832-236454854 CAGATTGAGAACTACAATCTGGG - Intronic
948659494 2:239498371-239498393 CACATGTGGAACTATGATCTGGG - Intergenic
1169352086 20:4876349-4876371 CAGATTTGGGCCTAAGATCTGGG - Intronic
1170140117 20:13117532-13117554 CTTCTTTAGAGCTATGATCTGGG - Exonic
1170245095 20:14212244-14212266 TATTTTTAGAACTGAGATGTTGG - Intronic
1173541311 20:43853648-43853670 GATATTTACAACCAAGATCTGGG + Intergenic
1173798924 20:45882536-45882558 CATCTTTGGAAAAAAGATCTGGG + Exonic
1174894956 20:54438560-54438582 CTTATTTAGAAATAAAGTCTAGG - Intergenic
1175012323 20:55751119-55751141 CGCATTTACAACTAAGAACTGGG + Intergenic
1178002059 21:28172961-28172983 CATATTAAGAAGTAAGATTAAGG + Intergenic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1178728140 21:35073492-35073514 CATTTGTAAAACAAAGATCTGGG - Intronic
1179072581 21:38085635-38085657 CAAATTTAGAACCAAGATCTGGG + Intronic
1179506035 21:41841645-41841667 AATACTTAGAACTAAAATATGGG + Intronic
1179821018 21:43936940-43936962 CATATTTAGAAGTAGGCTGTGGG + Intronic
1181732769 22:24859610-24859632 CATAATCAGAACTAAGAGGTTGG - Intronic
1184961077 22:47929131-47929153 CATGTGTAGAAGTAAGAACTGGG + Intergenic
949100809 3:142798-142820 CACATTTAGCACACAGATCTTGG - Intergenic
950770472 3:15306971-15306993 CATGTTTAGAAATAAAATGTCGG - Intronic
951346969 3:21558675-21558697 GATATTCAGAACTCAGCTCTGGG - Intronic
951526355 3:23656797-23656819 CAGATTTGGAATTAAAATCTAGG + Intergenic
951635403 3:24769374-24769396 CCTATGTAGAACCCAGATCTTGG + Intergenic
951919080 3:27833640-27833662 CTTCTTTATAACCAAGATCTTGG - Intergenic
951926964 3:27918012-27918034 CATACTTAACACTCAGATCTTGG - Intergenic
952827344 3:37535492-37535514 CATAATTAGAATGAAGGTCTAGG + Intronic
958089869 3:88862983-88863005 CATATTAAGCACTATGATCAAGG + Intergenic
958800459 3:98749334-98749356 CATATTTGTAACTTAGCTCTAGG + Intronic
959027055 3:101251802-101251824 AATTTTTAAAAATAAGATCTGGG + Intronic
959426844 3:106200621-106200643 CAAATTAAGAAGTAAGATCTGGG - Intergenic
960146441 3:114209059-114209081 CTTATTTTGAACTCAGATCAGGG + Intergenic
960534010 3:118796493-118796515 AAGATTTAGAACTATGATCTAGG - Intergenic
962657392 3:137561838-137561860 CATATCTAGTGCTGAGATCTTGG + Intergenic
963297572 3:143562780-143562802 CCAATTTAAATCTAAGATCTTGG - Intronic
964198837 3:154094526-154094548 AATATTTAGAAACAAGATCTCGG - Intergenic
964213602 3:154255019-154255041 AATATTTAGAGATAAGAACTGGG - Intronic
964465825 3:156990894-156990916 CAGATTCAGAACCCAGATCTGGG - Intronic
965051850 3:163661123-163661145 TAGATTTAGAACCTAGATCTTGG - Intergenic
965787787 3:172354422-172354444 AATGTTTATAACTAAGATATTGG + Intronic
966029988 3:175334152-175334174 GATATTTAGAATCAATATCTGGG + Intronic
966626572 3:182023265-182023287 CATATTGAAAACTAAGACTTAGG + Intergenic
971406349 4:26323873-26323895 CATTTTTAGAAATAAGACCCAGG + Intronic
971554244 4:27992858-27992880 CATATTAAGTATTAAGATTTAGG + Intergenic
973749797 4:54003436-54003458 CATATTCAAAACTAAAATATGGG - Intronic
973749869 4:54004222-54004244 CTTATGTAGAACTAAGAGCAGGG - Intronic
974263387 4:59554144-59554166 CATATTTAGTATAAAGATTTGGG + Intergenic
974343175 4:60640359-60640381 CTTATTTGGAAATAAGATCTTGG - Intergenic
974523846 4:63021590-63021612 CATATTTGGAACATAGATTTTGG - Intergenic
975588280 4:75973079-75973101 TAACTTTAGAACTAAGATCAAGG + Intronic
976126095 4:81835204-81835226 CTTATTTAGAAATAGGATCTTGG + Intronic
977439085 4:97038669-97038691 CATATTTAAGACTAAGAAGTAGG - Intergenic
977664067 4:99624693-99624715 CACATTTGGAAATAAGATATTGG + Intergenic
979080545 4:116333971-116333993 CATATTTAGAAACAAGAAATTGG - Intergenic
979577610 4:122313487-122313509 AAGATTAAGAACTAAAATCTAGG + Intronic
980097244 4:128504234-128504256 GGTATTTACAGCTAAGATCTGGG + Intergenic
981706607 4:147665675-147665697 CATACCTAGAACCCAGATCTTGG - Intronic
981917177 4:150047180-150047202 CCAATTTAGAGCTAAGCTCTGGG - Intergenic
982145867 4:152391249-152391271 CATATTTAGAACTTAATTCTTGG + Intronic
982887802 4:160804711-160804733 CATTTTTACAAATAAGATCATGG - Intergenic
983380703 4:166989231-166989253 TATATTTATGACTAAAATCTAGG + Intronic
984481386 4:180307378-180307400 CTTTTTTAGACATAAGATCTTGG - Intergenic
985111357 4:186549216-186549238 CATATTTAGGAATATGTTCTTGG - Intronic
986785132 5:11107134-11107156 CATAGTTACAACTTACATCTGGG - Intronic
986903075 5:12461054-12461076 CATGTCTAGAACAAATATCTTGG - Intergenic
987467230 5:18286241-18286263 CATACCTAGAGCTCAGATCTTGG + Intergenic
987984304 5:25126050-25126072 GTTATTGAGAACCAAGATCTGGG + Intergenic
988487354 5:31677944-31677966 CATCTTTACAACTAAGATAACGG - Intronic
988686579 5:33530921-33530943 CTGATTTGGAAATAAGATCTTGG + Intronic
988954723 5:36303913-36303935 TAGATTTAAAACTAAAATCTGGG + Intergenic
989467511 5:41774380-41774402 CATATAGAAAACCAAGATCTGGG - Intronic
989696694 5:44209973-44209995 AATATTTATAACTAAAATATAGG - Intergenic
991111763 5:62908184-62908206 AATATTTTAAACCAAGATCTGGG + Intergenic
991185480 5:63801446-63801468 CATATTTTGAACTCAAAACTTGG + Intergenic
991198940 5:63968067-63968089 CTTATTTAGAAATAGGGTCTTGG + Intergenic
992813879 5:80416819-80416841 CATACTTAGCACCCAGATCTTGG - Intronic
993328935 5:86572272-86572294 GATATTTTGGGCTAAGATCTTGG + Intergenic
993432573 5:87849855-87849877 CATATTTAAAACTTAAAACTTGG + Intergenic
994979413 5:106854552-106854574 CATTTTTACAACTTAAATCTTGG + Intergenic
995261464 5:110108862-110108884 AATATTTAGAACATAGAACTTGG + Intergenic
995328125 5:110915270-110915292 AATATTTAGAAGTAAGTTCCAGG + Intergenic
995381532 5:111540076-111540098 CAGTTATAGAACTGAGATCTGGG + Intergenic
995665534 5:114537558-114537580 CATATGTAGAAACTAGATCTGGG + Intergenic
996592958 5:125168667-125168689 CACACTTAGAACCCAGATCTTGG + Intergenic
996602757 5:125285286-125285308 CATAATTAGAATTCTGATCTGGG + Intergenic
998782945 5:145678518-145678540 CATATTTAGCATTATGATTTAGG - Intronic
999088278 5:148912442-148912464 CATAATTACAACTAATTTCTTGG + Intergenic
999788216 5:154911523-154911545 CATACCTAGCACTCAGATCTTGG - Intronic
1001216089 5:169857352-169857374 AATATTCAGGACAAAGATCTTGG + Intronic
1001975981 5:175998909-175998931 CATCTTTAGAAGTATGATTTGGG - Intronic
1002241445 5:177844863-177844885 CATCTTTAGAAGTATGATTTGGG + Intergenic
1004038889 6:11954768-11954790 CATATTTAGAACCAATATCTTGG - Intergenic
1004148007 6:13088147-13088169 CAAACTTAGAACTAATATGTAGG + Intronic
1004174192 6:13324729-13324751 CAAATTTAGAGCTAAAAACTAGG + Intronic
1004485027 6:16058402-16058424 CAAATATAGAACTAAGGTCTTGG - Intergenic
1005204802 6:23390339-23390361 CATATGCAGAACTAGGCTCTAGG - Intergenic
1008284549 6:49631691-49631713 CACAAATAGAACTAAGACCTTGG - Intronic
1009417658 6:63433469-63433491 CATATTTAGAGCACAGATTTTGG - Intergenic
1012150674 6:95747026-95747048 CTTATTTAAAAGTAAAATCTTGG + Intergenic
1014070240 6:117173425-117173447 CAGTTTTAGAAACAAGATCTGGG - Intergenic
1015331533 6:131985359-131985381 CATATTTAGAGCCAAGATGGTGG - Intergenic
1015667062 6:135643666-135643688 CATATGTAGAAGTAAAATGTGGG + Intergenic
1017678689 6:156841509-156841531 CATATTTACAAATAAGAAATTGG - Intronic
1017902432 6:158730051-158730073 CATATTCAGCACAAATATCTTGG - Intronic
1020517933 7:9148564-9148586 CATATTTAAAATTAAGATGAAGG + Intergenic
1022337408 7:29434669-29434691 CTTATTTGGAAATAGGATCTTGG - Intronic
1023068028 7:36398825-36398847 GATATTTAGAGCTAAGCTGTGGG - Intronic
1023859644 7:44210511-44210533 CATATTTAGAAATAGGGTCTTGG - Intronic
1027541115 7:79466701-79466723 TATATTTAGAAAGAAGATCTGGG + Intergenic
1027808926 7:82867318-82867340 CAAATTTAGGAATAAGATATAGG - Intronic
1028443733 7:90894489-90894511 CATCTCTAGAAATGAGATCTGGG - Intronic
1028854255 7:95572558-95572580 CATGTTAGTAACTAAGATCTGGG + Intergenic
1029020297 7:97357965-97357987 CATATTTAAAGCTAATATCTGGG - Intergenic
1030916019 7:115314429-115314451 CATATGTAAAATTAGGATCTTGG + Intergenic
1031096853 7:117430399-117430421 CTTATTTAGAAATAAGGTCATGG - Intergenic
1031576907 7:123425777-123425799 CATTCTTAGCACTCAGATCTTGG + Intergenic
1032671388 7:134085825-134085847 AATATTTAAAAGGAAGATCTTGG + Intergenic
1033233390 7:139619316-139619338 GATATTAAGAACAAAAATCTGGG + Intronic
1034235882 7:149568939-149568961 CATGTTTAGCACAAATATCTTGG - Intergenic
1036729738 8:11251698-11251720 AATATTTAGGAATAAAATCTAGG + Intergenic
1039209727 8:35200100-35200122 GTTACTTAGAACTAAGATTTGGG + Intergenic
1040847405 8:51858271-51858293 CATATTTAGTAGTAAACTCTGGG - Intronic
1041958286 8:63582025-63582047 CATATTTAAAAGTAAGATACAGG + Intergenic
1042146322 8:65733875-65733897 CTTAGCCAGAACTAAGATCTAGG + Intronic
1043238827 8:77904704-77904726 CATTTTAACAACTAAGATATTGG + Intergenic
1043681088 8:83025035-83025057 CATATTATGAACTAAGAAGTAGG + Intergenic
1044957601 8:97497883-97497905 AATATTTGCAACTAAGTTCTTGG - Intergenic
1046074212 8:109297936-109297958 CATATATAGATCTAAGTTCTAGG - Intronic
1046575104 8:116018285-116018307 CATATTTGGAAATAGGGTCTTGG + Intergenic
1047610257 8:126514066-126514088 CATATATATAACTTTGATCTAGG + Intergenic
1047846443 8:128810909-128810931 CACACTTAGCACTCAGATCTTGG + Intergenic
1048765131 8:137835499-137835521 GATATTCAGAACTGAGCTCTGGG + Intergenic
1050840824 9:10146947-10146969 CATGTCTGGATCTAAGATCTTGG - Intronic
1050922359 9:11220296-11220318 GATATTTAGAAGTGAGATTTTGG - Intergenic
1051031769 9:12689245-12689267 AACATTTAGAAATAAGGTCTTGG - Intronic
1051130496 9:13854782-13854804 TATTTTTAGAATTAATATCTAGG + Intergenic
1056812263 9:89774071-89774093 CATATTTGGATCTTAGTTCTGGG + Intergenic
1057123751 9:92600341-92600363 CATTTTTAAAACGAAGAGCTGGG - Intronic
1057986590 9:99722734-99722756 CATTTTTAGAAATTATATCTAGG - Intergenic
1058165100 9:101610232-101610254 CATAGTGAGAACTACGCTCTGGG + Intronic
1059369864 9:113820110-113820132 CATATGTAGAAATAAAATGTAGG + Intergenic
1059855141 9:118388145-118388167 CATATTTAGATGTAAAATTTTGG + Intergenic
1060832695 9:126727400-126727422 CATATATAGAAATAAATTCTAGG - Intergenic
1186600865 X:11035729-11035751 CATTTTTCAAAGTAAGATCTGGG - Intergenic
1186604274 X:11073431-11073453 GATATTAAAAACCAAGATCTGGG - Intergenic
1187073815 X:15914535-15914557 CATCCTGAGAACTAAGCTCTGGG - Intergenic
1188705840 X:33328815-33328837 CATCTTTCAAACTAAGATATGGG + Intronic
1188912875 X:35871446-35871468 CATATATAAAACTATGATATGGG - Intergenic
1189314436 X:40044247-40044269 CACATCTAGCACTAAGTTCTTGG - Intergenic
1189673050 X:43432445-43432467 CACACTTAGAACAAAGATCTTGG - Intergenic
1190534780 X:51415097-51415119 CATATTTAGTTTTATGATCTAGG + Intergenic
1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG + Intergenic
1191621413 X:63219392-63219414 CACATCTAGCACAAAGATCTTGG - Intergenic
1194089835 X:89571699-89571721 CAAAATTAGAAAAAAGATCTAGG - Intergenic
1194670226 X:96722757-96722779 CAAAGTTTGAACTAAGACCTTGG + Intronic
1195726413 X:107921962-107921984 CATATCTAGCACTCAGGTCTTGG - Intronic
1198248306 X:134853415-134853437 CATTTTTAGAAGTGAGATTTTGG + Intronic
1198806123 X:140496684-140496706 GATATTAGAAACTAAGATCTGGG + Intergenic
1199440929 X:147867014-147867036 CATATCTAGAAATATCATCTGGG - Intergenic
1200442485 Y:3227749-3227771 CAAAATTAGAAAAAAGATCTAGG - Intergenic