ID: 1140842797

View in Genome Browser
Species Human (GRCh38)
Location 16:78856516-78856538
Sequence CCTGAGTAGCTGCTATTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7344
Summary {0: 1, 1: 19, 2: 931, 3: 2404, 4: 3989}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140842797_1140842801 -10 Left 1140842797 16:78856516-78856538 CCCTGTAATAGCAGCTACTCAGG 0: 1
1: 19
2: 931
3: 2404
4: 3989
Right 1140842801 16:78856529-78856551 GCTACTCAGGAGTCTGAGGCAGG 0: 819
1: 83375
2: 182235
3: 213216
4: 143590
1140842797_1140842802 9 Left 1140842797 16:78856516-78856538 CCCTGTAATAGCAGCTACTCAGG 0: 1
1: 19
2: 931
3: 2404
4: 3989
Right 1140842802 16:78856548-78856570 CAGGAGAATCCCTTGAACCCAGG 0: 1871
1: 82236
2: 160444
3: 207287
4: 165273
1140842797_1140842803 12 Left 1140842797 16:78856516-78856538 CCCTGTAATAGCAGCTACTCAGG 0: 1
1: 19
2: 931
3: 2404
4: 3989
Right 1140842803 16:78856551-78856573 GAGAATCCCTTGAACCCAGGAGG 0: 1180
1: 49972
2: 109026
3: 169546
4: 181678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140842797 Original CRISPR CCTGAGTAGCTGCTATTACA GGG (reversed) Intronic
Too many off-targets to display for this crispr