ID: 1140845709

View in Genome Browser
Species Human (GRCh38)
Location 16:78885266-78885288
Sequence AAGAAAATACAGATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1415
Summary {0: 1, 1: 1, 2: 14, 3: 147, 4: 1252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140845709_1140845712 19 Left 1140845709 16:78885266-78885288 CCTTCTTCCATCTGTATTTTCTT 0: 1
1: 1
2: 14
3: 147
4: 1252
Right 1140845712 16:78885308-78885330 ATAAATATTTGAATAACATTTGG 0: 1
1: 0
2: 6
3: 96
4: 987

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140845709 Original CRISPR AAGAAAATACAGATGGAAGA AGG (reversed) Intronic
900077848 1:832535-832557 AAGAAAAAAAAGAGGGAGGAAGG - Intergenic
900994929 1:6115937-6115959 AAGAAAATATACATGGAAGCTGG + Intronic
901194918 1:7435062-7435084 AAGAAAAAAAAGAAGGCAGAGGG + Intronic
901497810 1:9631992-9632014 AAAAAAAGAAAGATAGAAGAAGG - Intergenic
901881539 1:12196931-12196953 AAGAAAAAAAAAATGGAAAAGGG - Intronic
902522017 1:17024178-17024200 AAGAAAATTCACATGCAAGTAGG - Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
903000835 1:20264497-20264519 AAGAACAGAGAGAGGGAAGAGGG - Intergenic
904484692 1:30816920-30816942 AAGATCACACAGCTGGAAGATGG - Intergenic
904570081 1:31457075-31457097 AAGAAAATTCAGAAGGAAAATGG - Intergenic
904725676 1:32545895-32545917 AAGAAAATACTCATAGTAGAAGG - Intronic
904786406 1:32986394-32986416 AAGAATTTGAAGATGGAAGAGGG + Intergenic
904846557 1:33423038-33423060 GAGAGAGTACAGATGGAAGGCGG + Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905110793 1:35593009-35593031 AAGAAAAGACAGAGAGAGGAGGG + Intronic
905400422 1:37698374-37698396 AGGAAACTATTGATGGAAGATGG + Intronic
906259745 1:44377986-44378008 TAGAGAGAACAGATGGAAGATGG + Intergenic
906409272 1:45566090-45566112 AAAAAAAAAAAGATGGAAGATGG - Intronic
906508797 1:46399201-46399223 AAAACAAAACAGATGGAGGAGGG + Intronic
906624333 1:47312885-47312907 AAGATAATTTATATGGAAGAAGG - Intronic
906767892 1:48452216-48452238 AAGAAAAGAAAGACGGAAAAAGG + Intronic
907079431 1:51607862-51607884 AAGGAAGTACACTTGGAAGAGGG + Intronic
907760607 1:57355166-57355188 AGGAAAAAAGAGAAGGAAGAGGG - Intronic
908410090 1:63855495-63855517 AATAAGATACAGAGGGAAAAAGG - Intronic
908413695 1:63891691-63891713 TAGAACAGAAAGATGGAAGATGG + Intronic
908414286 1:63897919-63897941 AAGAAGACACAGGTTGAAGATGG - Intronic
908704698 1:66939092-66939114 TAGAAAATACAGATGGTGGGAGG - Intronic
909099789 1:71336302-71336324 AATAAAGTACAGTTGAAAGAGGG + Intergenic
909201433 1:72694293-72694315 AATAAAGTACACTTGGAAGAGGG + Intergenic
909493285 1:76248788-76248810 AGGAAAAGAAAGAGGGAAGAAGG - Intronic
909917559 1:81338557-81338579 AAGAAAATACGGATCCAAGAAGG + Intronic
910158840 1:84252162-84252184 AAGACGTAACAGATGGAAGAGGG + Intergenic
910171330 1:84380477-84380499 AAGAAAGAAAAGAAGGAAGAAGG + Intronic
910281226 1:85503745-85503767 AAGAAAATAAAGCAGGAAGATGG + Intronic
910309251 1:85804824-85804846 AAGGAAATACAGATTTCAGATGG + Intronic
910313103 1:85850026-85850048 AAGGAAATACAGAGAGAAAAAGG + Intronic
910663261 1:89696453-89696475 AAGAACAGACAGAGGGGAGAGGG + Intronic
911360177 1:96866063-96866085 AAACATATACAGAAGGAAGATGG - Intergenic
911418406 1:97606763-97606785 CAGAAAATAAGAATGGAAGAAGG + Intronic
911746343 1:101445621-101445643 AAGAAAGTACACTTGGAAAAGGG - Intergenic
911748791 1:101471675-101471697 AAGAAAAATCACCTGGAAGAGGG + Intergenic
911793282 1:102046007-102046029 AACAAAGTACACTTGGAAGAGGG - Intergenic
911797100 1:102089257-102089279 AAGAAAACCCAGAAGGAAAATGG - Intergenic
911995592 1:104761590-104761612 AAGAAAACATAGATAAAAGAAGG - Intergenic
912083085 1:105962626-105962648 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912357375 1:109065928-109065950 AAAAAAAAACAAAAGGAAGAAGG + Intronic
912688994 1:111789555-111789577 AAGAGACTAGAGATGGAAAACGG + Intronic
913054727 1:115147806-115147828 GAGAAATTACTTATGGAAGATGG + Intergenic
913180400 1:116315456-116315478 AAGAAAAAACAGATTGCAGTGGG + Intergenic
913367061 1:118050287-118050309 AATAAAGTACAATTGGAAGAAGG - Intronic
913571855 1:120128414-120128436 AGGAAAATAAGGAAGGAAGAAGG + Intergenic
913691176 1:121281332-121281354 AAGAGAATGAAGAAGGAAGAAGG - Intronic
914266970 1:146046367-146046389 AAGAAAATAGAAATAGAGGATGG - Intergenic
914292774 1:146290036-146290058 AGGAAAATAAGGAAGGAAGAAGG + Intergenic
914553818 1:148740819-148740841 AGGAAAATAAGGAAGGAAGAAGG + Intergenic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
914952767 1:152131886-152131908 AAGAAAAGACACATTGGAGAGGG + Intergenic
915713382 1:157922294-157922316 AAGAAAGGAAAGAAGGAAGAAGG + Intergenic
915947746 1:160166487-160166509 GAGAGAATACACATGGGAGATGG - Intronic
916058231 1:161082473-161082495 AAAAAAATAGGGATGGAAGGAGG + Intronic
916063576 1:161118603-161118625 AAGACCATACAGTGGGAAGATGG - Intronic
916562129 1:165942054-165942076 AGGAAAATGCAGACGGAGGAAGG - Intergenic
916610666 1:166388369-166388391 AAAAAAAAAAAGAAGGAAGAAGG + Intergenic
916697643 1:167255869-167255891 AAGATAATGCAGATGGGAGGAGG + Intronic
916808481 1:168283563-168283585 GAGAAAAGAGAGAAGGAAGAAGG - Intronic
916896443 1:169168213-169168235 AGGAAAGTACACTTGGAAGAGGG - Intronic
916923656 1:169494996-169495018 AAAAAAAAAAAGATGGAAGAGGG + Intergenic
917095952 1:171398988-171399010 AAGAAAATACACAAGTAAGCAGG + Intergenic
917113235 1:171574406-171574428 AAGAAAATACAGCTGAAACCAGG + Intronic
917216042 1:172679177-172679199 AGCAAAATACACTTGGAAGAGGG + Intergenic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
917537646 1:175886013-175886035 GAGAAGGTACAGATGGGAGATGG + Intergenic
917714206 1:177717599-177717621 AAAAAAATAGAGATGGAGGTGGG + Intergenic
917766947 1:178230731-178230753 AGTAAAATACACTTGGAAGAGGG + Intronic
917867853 1:179214689-179214711 AAGAAAAAACACAGGAAAGATGG + Intronic
918077573 1:181182133-181182155 AAGTAAATACACTTGGAAGGGGG - Intergenic
918270458 1:182893409-182893431 AGGAAAGTACACTTGGAAGAGGG + Intergenic
918333483 1:183483426-183483448 AGGAAAATGCAACTGGAAGATGG + Intronic
918492604 1:185098085-185098107 AAGAAACAACAGATTGAAAATGG + Exonic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918635964 1:186774519-186774541 AGGAAAATACAGAGGAAAGCGGG - Intergenic
918818037 1:189215915-189215937 AACAAAATACAAATGCAAAATGG + Intergenic
918833176 1:189425037-189425059 AAGAAAAAACAAACAGAAGAAGG - Intergenic
919181355 1:194086521-194086543 AAGAAAAAACAGATGCCAAAGGG + Intergenic
919239509 1:194893864-194893886 AAGAAAATATATTTGGAATATGG + Intergenic
920077015 1:203344589-203344611 AGGGAGATACTGATGGAAGAGGG + Intronic
920147249 1:203872614-203872636 AAGAAAATAGAGACGCGAGATGG - Intergenic
920259539 1:204679527-204679549 AGGGAAAAACATATGGAAGAAGG - Intronic
920327900 1:205181210-205181232 AAGAAGATACTGTTGGAGGAAGG - Intronic
920478500 1:206299808-206299830 AAGAGAATGAAGAAGGAAGAAGG - Intronic
920714680 1:208328472-208328494 AAGAAAAGAAGAATGGAAGAAGG - Intergenic
920770727 1:208882416-208882438 AAAAAAAGACAGAAAGAAGAGGG + Intergenic
921122571 1:212149677-212149699 AAGGAAGTACACTTGGAAGAGGG + Intergenic
922286164 1:224172551-224172573 AGGAAAGTAGAGAGGGAAGAAGG + Intergenic
922663502 1:227449851-227449873 AGGAAAGTACACTTGGAAGAGGG + Intergenic
922873985 1:228925588-228925610 AGTAAAATACACTTGGAAGAGGG - Intergenic
922883543 1:229000832-229000854 AAGTAAGTACACTTGGAAGAGGG - Intergenic
922912328 1:229228203-229228225 AACAAAAGGCAGGTGGAAGAGGG + Intergenic
923027138 1:230214019-230214041 AATGAAATACAGAAGGAATATGG - Intronic
923247568 1:232147399-232147421 AAGAAAGAAAAGAGGGAAGAAGG + Intergenic
923327019 1:232888938-232888960 AAGAAAATAAAGAAGAAGGAAGG - Intergenic
924170694 1:241337051-241337073 AAGATCACACAGATGGAAAATGG - Intronic
924191028 1:241552787-241552809 AAGAAAAAACAGCTGAAGGAGGG - Intronic
924301890 1:242648121-242648143 AAGAAGATTCAGTTGGAATAAGG - Intergenic
1062870916 10:903445-903467 AAGAAAATACATATTCAAAATGG - Intronic
1063403834 10:5774183-5774205 AAGAAAGTACACTTGGAGGAGGG - Intronic
1063540585 10:6929961-6929983 AAGAGAAAAAAGATGAAAGAAGG + Intergenic
1063776485 10:9271302-9271324 GAGAAAATACTGCTGTAAGAAGG - Intergenic
1063839839 10:10058289-10058311 AAGAAAAAAAAGATGAAAGGAGG + Intergenic
1064516249 10:16152162-16152184 GAGAAAAGAGACATGGAAGATGG + Intergenic
1064759716 10:18605373-18605395 AAGTAAATAAAAAGGGAAGAAGG + Intronic
1064823155 10:19362597-19362619 GAGAAACTAAAGCTGGAAGAAGG + Intronic
1065011972 10:21428999-21429021 AAAAAAATACAGTTGGGATATGG - Intergenic
1065111722 10:22446416-22446438 AAAAAGAGAGAGATGGAAGATGG + Intronic
1065247904 10:23777695-23777717 AAAAAAATAAAGATGCATGAAGG + Intronic
1065646378 10:27838619-27838641 AACGAAATATAGATGAAAGATGG + Intronic
1065940450 10:30559526-30559548 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1066084430 10:31962576-31962598 AAGGAAATACACTTGAAAGAGGG + Intergenic
1066320517 10:34298781-34298803 AATAAAATACAGATTAAGGATGG + Intronic
1066406514 10:35124436-35124458 AAAAAAAAAGAGACGGAAGAGGG + Intergenic
1066527638 10:36298243-36298265 AAGAAAAGACACATCGAAGAGGG - Intergenic
1066621741 10:37362032-37362054 AAGAAACTGCAGATGAAAGAGGG - Intronic
1067304061 10:45042787-45042809 AAGGAGATAAAAATGGAAGAAGG - Intergenic
1067731564 10:48815825-48815847 AAGAAAATACAAACAGAATAAGG - Intronic
1067801826 10:49364640-49364662 AGCAAAATACAGCAGGAAGAAGG + Exonic
1068110986 10:52680805-52680827 AAGAAAAAAAAGATGGAGGGTGG + Intergenic
1068191995 10:53664721-53664743 AGTAAAATACACTTGGAAGAGGG + Intergenic
1068309674 10:55262123-55262145 AAGAAAAGAAAGATGAAGGAAGG + Intronic
1068340204 10:55691906-55691928 AAGAGAGAACAGGTGGAAGAAGG - Intergenic
1068543385 10:58320896-58320918 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1069048026 10:63763466-63763488 ATGAAAATAAAGATTGAAGCAGG + Intergenic
1069243974 10:66178721-66178743 AAAAAAATCCAGTTGGAAAATGG + Intronic
1069770561 10:70896630-70896652 AAGAAAAAAGAAAAGGAAGAGGG - Intergenic
1070362831 10:75707507-75707529 TAGAAAATGCAGATGAAAGCCGG + Intronic
1070375534 10:75827423-75827445 AAGAAAATACAAACAGAGGATGG - Intronic
1071161400 10:82749794-82749816 AAAAAAAAAAAGATGGAAAATGG + Intronic
1071186841 10:83056234-83056256 AAGACAAAACAGGAGGAAGAAGG - Intergenic
1071577604 10:86740871-86740893 AAGTAGATACAGATTGGAGAAGG + Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1071675646 10:87653573-87653595 AAGAAAGGAAAGAAGGAAGAAGG - Intergenic
1072204798 10:93193752-93193774 AAGAACACACAGAAGGAACAAGG + Intergenic
1072222315 10:93336842-93336864 AAGAAAAGAAGGAAGGAAGAAGG + Intronic
1072274154 10:93805994-93806016 AAGAAGTTACAGGTAGAAGACGG + Intergenic
1072297620 10:94026454-94026476 AAGAAGAAAAAGATGGAAAAAGG - Intronic
1072391853 10:94995190-94995212 AAAAAAATTCAGAAGGAAAAAGG - Intergenic
1072529520 10:96305872-96305894 AAGAGAAATCAGGTGGAAGAAGG - Intronic
1072694192 10:97590851-97590873 AAGAGAAGACAGATGGGAGCAGG + Exonic
1072885912 10:99273713-99273735 AAGGACAGACAGATGGATGATGG + Intergenic
1073304218 10:102490245-102490267 AAAAAAAAAAAGATGGTAGATGG + Intronic
1073748727 10:106499669-106499691 AGCAAAATACACTTGGAAGAGGG - Intergenic
1073857790 10:107697435-107697457 AAGAAAATAAGGAAGGAAGGAGG - Intergenic
1074033887 10:109718346-109718368 CAGGAAAAACACATGGAAGATGG + Intergenic
1074075210 10:110116930-110116952 ATTAAAATAAAGATGGAAGGTGG - Intronic
1074148281 10:110736476-110736498 AAGAAAATTCAGATGAAAACAGG - Intronic
1074180260 10:111055952-111055974 AAGAAAATACAGGTAGGACATGG - Intergenic
1074640529 10:115374507-115374529 AAAAAAAGAAAGAAGGAAGAAGG - Intronic
1074797906 10:116967573-116967595 AAGTAAATAAAGAGGGCAGAAGG - Intronic
1074841419 10:117356143-117356165 AAGAAAAAAAGGATTGAAGATGG - Intronic
1074931199 10:118127939-118127961 AAGAAGTGACAGATGGAGGAAGG - Intergenic
1075148507 10:119904682-119904704 AAGAAATTATAGATTTAAGATGG - Intronic
1075240248 10:120771878-120771900 AGGAAAATACACTTGCAAGAGGG - Intergenic
1076059352 10:127401419-127401441 AAGAAAGTACACTTGGAAGAGGG + Intronic
1076068176 10:127465121-127465143 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1076330974 10:129666100-129666122 AAGAAAAAACAGTGGCAAGATGG + Intronic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1077280561 11:1743180-1743202 AAGAATGGACAAATGGAAGATGG + Intronic
1077280566 11:1743218-1743240 AAGAATGGACAAATGGAAGATGG + Intronic
1077840106 11:5964936-5964958 AAGAAAAGACACATTGAAGAAGG - Intergenic
1077882260 11:6360415-6360437 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1077915633 11:6609907-6609929 AAGAGAAAACAGATAGAAGGAGG - Intronic
1078097252 11:8307656-8307678 AAGAGAATACAGCTGGAAAGGGG - Intergenic
1078444744 11:11395693-11395715 AAGAAAAGAGAGAAGGAAGGAGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079050404 11:17151633-17151655 AAGAAAAAACAGAAGCAACAAGG - Intronic
1079056703 11:17212345-17212367 GAGAAAAGATAGAGGGAAGATGG + Intronic
1079149269 11:17883223-17883245 TAGAAAATACAGCTGGACCAGGG + Intronic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1079968528 11:27007596-27007618 ATGGAAATACACAGGGAAGATGG + Intergenic
1080140891 11:28918687-28918709 AAAAAAATATATATGGAAGAAGG + Intergenic
1080680390 11:34470268-34470290 AGGAATAGACAAATGGAAGAGGG + Intronic
1080784633 11:35463566-35463588 AGGAAACTTCAGAGGGAAGAAGG + Intronic
1080939445 11:36898831-36898853 AAGAAGATACAGAGAGAAAAGGG + Intergenic
1081842197 11:46210687-46210709 AAGAAAAAACAGATGCTAGAGGG - Intergenic
1082030406 11:47599459-47599481 AGGAAGAGACAGATGGGAGAGGG + Intergenic
1082142247 11:48622711-48622733 AAGAAAATATATTTGGAAGAAGG - Intergenic
1082280288 11:50264178-50264200 AAATAAATAAATATGGAAGATGG + Intergenic
1082569411 11:54719551-54719573 AAGAAAATATATTTGGAAGAAGG - Intergenic
1083041165 11:59688754-59688776 AGGAAATTACACTTGGAAGAGGG + Intergenic
1083152333 11:60799655-60799677 AAGAGAATCCAGGTGGAGGAAGG - Intronic
1083544328 11:63537784-63537806 AAGGAAATAGACAAGGAAGAGGG - Intronic
1084222315 11:67690459-67690481 AAAAAAATTCAAAAGGAAGATGG - Intergenic
1084375501 11:68774141-68774163 AGGAAAGTACATTTGGAAGAGGG - Intronic
1085175275 11:74481041-74481063 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1085384819 11:76151397-76151419 AAGAAAAAATACATAGAAGAAGG + Intergenic
1085622696 11:78049491-78049513 AAGAAAGTACACTTGGAAGAGGG + Intronic
1085821924 11:79803029-79803051 AAGAAAAAAGAAATGGAAGAAGG + Intergenic
1085831550 11:79906371-79906393 AACAAAGTACACTTGGAAGAGGG - Intergenic
1086085245 11:82946386-82946408 AAGAACATACAATTGGAAAAGGG + Intronic
1086155598 11:83662298-83662320 AAGTCAATACAGATTGAAAATGG + Intronic
1086221619 11:84452113-84452135 AAAAAAAAAAAGAAGGAAGAAGG + Intronic
1086305811 11:85481426-85481448 AAGAAAACATGCATGGAAGAGGG + Intronic
1086473933 11:87149586-87149608 AAGAAATTACAGATACAAGAAGG - Intronic
1086623442 11:88916241-88916263 AAGGAAATAGATATGAAAGAAGG + Intronic
1086641789 11:89167873-89167895 AAGAAAATAGAGAGGAAAAAAGG - Intergenic
1086779478 11:90884192-90884214 AAGAAAATGCAGATAAATGAAGG - Intergenic
1086987396 11:93265556-93265578 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1087080622 11:94167842-94167864 GAAAAAATAAACATGGAAGAAGG + Intronic
1087416750 11:97866433-97866455 AAAAAAATACAGAATGAAAAAGG - Intergenic
1087796543 11:102460462-102460484 AATAAAGTACACTTGGAAGACGG + Intronic
1087797762 11:102472551-102472573 AATAAAGTACACTTGGAAGAGGG + Intronic
1087934405 11:104015800-104015822 ATGAAAATAGAAATGGAAAATGG - Intronic
1087949313 11:104200642-104200664 AAGGCAATATAGATGGTAGACGG + Intergenic
1087970140 11:104470429-104470451 AAGAGGATCGAGATGGAAGAAGG + Intergenic
1088004704 11:104926460-104926482 AAGAAAATGCTTATTGAAGATGG - Intergenic
1088074939 11:105836481-105836503 AAGAATATACAGAGGGCAGATGG - Intronic
1088107956 11:106227049-106227071 AAGAAAACACATAAGGAAAATGG + Intergenic
1088203748 11:107368040-107368062 AAGAAACTAGAGAAGCAAGAAGG + Intronic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1088967611 11:114739415-114739437 AAGAAAAGAACGAGGGAAGAAGG - Intergenic
1089125556 11:116174199-116174221 AAGGAAACACAAATGGCAGAGGG - Intergenic
1089334688 11:117715032-117715054 AGGCAAATACAAATTGAAGATGG + Intronic
1089718984 11:120394557-120394579 AAAAAAATAGAGATGAAAGCAGG + Intronic
1090004005 11:122984355-122984377 AAGAAAAGAGAGATGGAGGGAGG + Intergenic
1090380290 11:126321924-126321946 AAGACAAAAGAGATGGAAGATGG + Intronic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090634986 11:128685511-128685533 AAGAAAACAGAGAGGAAAGAAGG - Intergenic
1090703796 11:129318405-129318427 AAGAAAGTTTAGATGGAAGCTGG - Intergenic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091147598 11:133293245-133293267 AAGAAAATAAAGGTTGAAAATGG - Intronic
1091229677 11:133980135-133980157 AAGAAAATTCTGCTGGCAGATGG - Intergenic
1091575387 12:1728871-1728893 AAGAGAGTCAAGATGGAAGATGG - Intronic
1091618865 12:2070854-2070876 AAGAAAATAAAGAAAGAAAAAGG - Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091876576 12:3939469-3939491 TAAAAAATACATATGTAAGAGGG - Intergenic
1092669056 12:10841776-10841798 AAAACAATACAAATGGAAGCAGG - Intronic
1092857137 12:12684782-12684804 AAGAAAATAGAGAAGGAAGGAGG - Intronic
1092976117 12:13746480-13746502 AAGAAGATACAGACGGAATATGG - Intronic
1093180283 12:15959443-15959465 AAGAAAGGACAGTTTGAAGAAGG - Intronic
1093308377 12:17546790-17546812 AAGAAAAGATAGAGAGAAGAGGG - Intergenic
1093324924 12:17761348-17761370 AACAAAAGACACATCGAAGAAGG - Intergenic
1093391319 12:18627056-18627078 AAGAAAAAAAAAATGGAAGAAGG - Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093508611 12:19899802-19899824 AAGATAATACAGAAGAAAAATGG - Intergenic
1093568415 12:20636027-20636049 AAGAAAAGAAAGATGAAGGAAGG + Intronic
1093735919 12:22620162-22620184 AACAGAATAAAGATGGAAAATGG - Intergenic
1093957737 12:25240732-25240754 AAAAACATACAAATGGAAGTTGG - Intronic
1094037869 12:26090048-26090070 AAGAGGTAACAGATGGAAGAAGG + Intergenic
1094090664 12:26645441-26645463 AAGGAACCACATATGGAAGATGG + Intronic
1094192091 12:27708290-27708312 AAGGAAATACACTGGGAAGAGGG - Intergenic
1094373197 12:29761496-29761518 AAGAAGATTGAAATGGAAGAGGG + Intronic
1094481638 12:30887051-30887073 AAGAAAATAAAAAAGTAAGATGG + Intergenic
1094585928 12:31777262-31777284 TTGAAAATACAGATGGGAGCCGG - Intergenic
1095165788 12:38970011-38970033 AAAAAAAGACAGATGGAATGGGG + Intergenic
1095207838 12:39458904-39458926 AATAAAGTACACTTGGAAGAGGG + Intergenic
1095318947 12:40801961-40801983 AAAAAAAAGTAGATGGAAGATGG + Intronic
1095531144 12:43188322-43188344 AACAAAATACAGAGTGAAAATGG - Intergenic
1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG + Intronic
1096026469 12:48368541-48368563 AAGAAAAGACATATTGAAGAGGG + Intergenic
1096360503 12:50981806-50981828 AAGGAAAAAAAGATGGAAGAGGG + Intronic
1096871361 12:54594460-54594482 AAAAAAAAAAAGAGGGAAGAAGG - Intergenic
1096987546 12:55770925-55770947 AAAAAAAAAAAGATTGAAGAAGG - Intronic
1097133365 12:56830867-56830889 AGTAAAATACATTTGGAAGAGGG + Intergenic
1097391308 12:59017945-59017967 AAGAAATTTCAGATGGGAGATGG + Intergenic
1097677334 12:62616849-62616871 AAAAAAAAAAAGAGGGAAGAAGG - Intergenic
1097731733 12:63135902-63135924 AAGAAGTTGCAGGTGGAAGACGG + Intergenic
1097996291 12:65891333-65891355 AAGGAAATGCAGATGTAAGTAGG + Intronic
1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG + Intronic
1098855865 12:75652735-75652757 AAGAAAGAACAGAAGGGAGATGG + Intergenic
1099334943 12:81343749-81343771 AAGAGAATAAATATGGAATATGG - Intronic
1099417400 12:82408415-82408437 AAAAAAACACAGATGCAAGAGGG + Intronic
1099437436 12:82660672-82660694 AAGGAAGTACACTTGGAAGAGGG + Intergenic
1099493076 12:83309587-83309609 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1099513027 12:83561360-83561382 AAGAAAACTCAGATTGTAGAAGG - Intergenic
1099536211 12:83848208-83848230 AAGGAAACACAGAGAGAAGAAGG - Intergenic
1099810534 12:87576757-87576779 AAGAAAAGAAAAAAGGAAGAAGG + Intergenic
1099821702 12:87719611-87719633 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1099889709 12:88576153-88576175 TAGAAAATAGAAATGGAAAATGG - Intronic
1100119939 12:91358006-91358028 AACAAAATACAGATGTATTAAGG + Intergenic
1100291937 12:93223994-93224016 AGGAAAATACACTTGGAAGAAGG + Intergenic
1100515451 12:95323144-95323166 AAGAAAGGAAAGAAGGAAGAAGG + Intergenic
1100643717 12:96507364-96507386 AAGTAAATATAGATGGAGAAGGG + Intronic
1100699782 12:97134919-97134941 GGGAAAACAGAGATGGAAGAGGG + Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101036131 12:100708476-100708498 AAGAAAGTAAGGAGGGAAGAAGG - Intergenic
1101167313 12:102052166-102052188 AAGAAAAAACACACTGAAGAGGG + Intronic
1101280138 12:103245185-103245207 AAGAAAATTCAGTTGGAAACAGG + Intronic
1101407246 12:104439355-104439377 AGGAAAATACATTTGGAAGAGGG - Intergenic
1101709492 12:107251609-107251631 TAGAAAAAGCAGACGGAAGAAGG - Intergenic
1101792471 12:107940323-107940345 AAAAAAAAACAGAAGGAATAAGG - Intergenic
1102464546 12:113120763-113120785 AAGAAAAATCAGATGGAAGATGG - Intronic
1102521879 12:113482696-113482718 AAGAAAATAGACAGGGAGGAGGG - Intergenic
1102819254 12:115894094-115894116 AAGAAAATGGATATGAAAGAGGG + Intergenic
1102899321 12:116624097-116624119 AAGAGAATGAAGAAGGAAGAAGG + Intergenic
1102906992 12:116684297-116684319 AAGAAAAAAAAGAATGAAGAAGG + Intergenic
1103093648 12:118115837-118115859 AATAAAGTACACGTGGAAGAGGG + Intronic
1103438160 12:120942877-120942899 AAGAAAAGAAAGAAGAAAGAGGG + Intergenic
1103496426 12:121366092-121366114 AAGAAAATCCAGCTGAAAGGGGG + Intronic
1104071765 12:125352015-125352037 CAGAAAATATAGATGGCAGCAGG - Intronic
1104349845 12:128035697-128035719 AAGAAAATGCAGAAAGGAGATGG + Intergenic
1104456351 12:128916007-128916029 CAGAAATTAAATATGGAAGAGGG - Intronic
1104532111 12:129581652-129581674 AGGATAAAGCAGATGGAAGAAGG - Intronic
1104583811 12:130030936-130030958 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1105579163 13:21677312-21677334 AAGAAAAGAAGGAAGGAAGAGGG - Intronic
1106221948 13:27753624-27753646 TAGAAAAAAAAGGTGGAAGAAGG - Intergenic
1106441848 13:29781331-29781353 AAGAAACTAAAGATGAAATAAGG - Intronic
1106662434 13:31814217-31814239 AAGAAAAGACACATTGAAGAGGG + Intergenic
1106810321 13:33352627-33352649 AAGAGAAGCCAGATGAAAGACGG + Intergenic
1106844528 13:33723866-33723888 AAGAAAAGATAAATAGAAGAAGG - Intergenic
1106953245 13:34907715-34907737 AGGGGAATACAGAGGGAAGAAGG - Intergenic
1107028602 13:35828602-35828624 AGGAAAGTACACTTGGAAGAGGG - Intronic
1107598957 13:41993014-41993036 AAGCAGATAAAGATGCAAGAAGG - Intergenic
1108045894 13:46384278-46384300 AAGTAAATACAGAGAGAATAGGG + Intronic
1108353068 13:49604863-49604885 AAAAAAGTACACTTGGAAGAGGG - Intergenic
1108421895 13:50259220-50259242 AAGAAAAACCAGATGGAGAATGG - Intronic
1108581200 13:51829854-51829876 AAAAAATAGCAGATGGAAGAAGG + Intergenic
1108702148 13:52952915-52952937 AGGAAAGTACACTTGGAAGAAGG + Intergenic
1108867908 13:54943289-54943311 TAGAAAATACACAGGGAACAGGG - Intergenic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1109333841 13:60966878-60966900 ATAAAAATACACTTGGAAGAGGG - Intergenic
1109343215 13:61088275-61088297 AAGGAAGTACAGTTGGAAGAGGG - Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109515377 13:63437288-63437310 AAGAAAGTACACTTGGAAGAGGG + Intergenic
1109628071 13:65004787-65004809 AAGAAAATACTGAATGCAGAGGG + Intergenic
1110168248 13:72469494-72469516 AAAACAAAGCAGATGGAAGAAGG + Intergenic
1110298211 13:73894949-73894971 GAGAAAACAGAGATAGAAGAAGG - Intronic
1110348583 13:74478788-74478810 TAGAAGAAAAAGATGGAAGAAGG - Intergenic
1110700208 13:78538190-78538212 AATAGAATTCAGATGAAAGAAGG + Intergenic
1110894916 13:80737446-80737468 CAGAAAAGACACATTGAAGAGGG + Intergenic
1110957911 13:81579404-81579426 AAGAAAATACAAATGTAAGAGGG - Intergenic
1110983386 13:81932782-81932804 AAGAAAATAAAGAAAGAAAAAGG + Intergenic
1111127419 13:83929433-83929455 AAGGAAGTACATTTGGAAGAGGG - Intergenic
1111127911 13:83935871-83935893 AAAAAAGTACACTTGGAAGAGGG - Intergenic
1111220324 13:85196809-85196831 ACAAATACACAGATGGAAGATGG + Intergenic
1111476837 13:88761072-88761094 AGTAAAGTACAGTTGGAAGAGGG + Intergenic
1111480661 13:88821339-88821361 AGGAAAATAAAGATGGTAAAAGG + Intergenic
1111521705 13:89413289-89413311 AGTAAAATACATTTGGAAGAGGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111856231 13:93640871-93640893 AAAAAGATAAAGAGGGAAGAAGG - Intronic
1112137880 13:96602949-96602971 AAGAAAAGACACATTGAAGAGGG - Intronic
1112615989 13:101006043-101006065 AAGAAAATGCAGATAGAAACTGG - Intergenic
1112698527 13:101977556-101977578 AAGAAAGCAAAGAAGGAAGAAGG - Intronic
1112974980 13:105306138-105306160 AAGAAAATACAGTGTCAAGAAGG + Intergenic
1113102252 13:106733354-106733376 AAGAAAAGAAAGAAAGAAGAAGG - Intergenic
1113115810 13:106873803-106873825 AATAAAATAGAAAGGGAAGATGG + Intergenic
1113525345 13:110970405-110970427 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1113704313 13:112416091-112416113 AGGAAAAGACACATTGAAGAAGG - Intronic
1114145949 14:19978773-19978795 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114712828 14:24795444-24795466 AAGAAAAAACAGCTGGAAGAGGG + Intergenic
1114790925 14:25657461-25657483 AGGAAAGTACACTTGGAAGAAGG - Intergenic
1114827939 14:26104364-26104386 AAGAAAAAAGAGATGTTAGAAGG - Intergenic
1114874405 14:26697911-26697933 AAGAAAATATACTTGAAAGAGGG + Intergenic
1114977249 14:28117182-28117204 AAGAAAATACACATTAAAGAGGG - Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115170207 14:30496368-30496390 AAGCATATATAGATGGATGATGG + Intergenic
1115186417 14:30693314-30693336 AAGAAAATACCTATAGAAGCAGG + Intronic
1115716716 14:36113699-36113721 AAGAAAAAACAGCCGGCAGAAGG - Intergenic
1116124385 14:40764028-40764050 AAGCAAATAAAGGAGGAAGAAGG - Intergenic
1116392578 14:44411174-44411196 AAGGAAAGAAAGATGGGAGAAGG + Intergenic
1116527523 14:45925490-45925512 AGGAAAATACAAAAGGAAGGGGG - Intergenic
1116561107 14:46379640-46379662 AAAAAAAAACTGATGGAAGTAGG - Intergenic
1116630807 14:47329335-47329357 AAAAAAAGACAAAAGGAAGAAGG + Intronic
1116649157 14:47566898-47566920 AAGAAAAAAAAAAAGGAAGATGG - Intronic
1116697397 14:48194222-48194244 AGGAAACTACACCTGGAAGAGGG - Intergenic
1116708576 14:48335472-48335494 AATAAAGTACACTTGGAAGAGGG - Intergenic
1116775319 14:49173738-49173760 AAGAAAGAACACATTGAAGAGGG + Intergenic
1117105143 14:52390612-52390634 AAGAAAAGAAGGAAGGAAGAAGG + Intergenic
1117178429 14:53168795-53168817 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1117224979 14:53647282-53647304 AGAAAAATACAGAGGGAGGAAGG - Intergenic
1117976158 14:61298921-61298943 AAGGAAGTACACTTGGAAGAAGG + Intronic
1118582149 14:67312254-67312276 AAGAAATTGTAGTTGGAAGAAGG - Intronic
1118739135 14:68725973-68725995 AAGAGAATACACAATGAAGATGG - Intronic
1119225299 14:72940556-72940578 AAGAAAACGGGGATGGAAGAAGG - Intronic
1119243437 14:73082254-73082276 AAAAAAAGACAGAAGGAGGAGGG - Intronic
1119574725 14:75709176-75709198 TAGAAAATGCAATTGGAAGATGG + Intronic
1119597121 14:75945141-75945163 AGGAAAGTACACTTGGAAGAGGG - Intronic
1119627862 14:76197296-76197318 AAGAACAAAAAGATGAAAGAGGG - Intronic
1119654242 14:76405600-76405622 AGGAAAAGACAGAAGGAAAATGG + Intronic
1119914771 14:78387677-78387699 AAAGGAATACGGATGGAAGATGG - Intronic
1120027302 14:79600863-79600885 AAGAAAATGCAGAAAGAAAAAGG + Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120208643 14:81612745-81612767 AAGGAAGTACACTTGGAAGAGGG - Intergenic
1120237090 14:81904186-81904208 AAGAAAAGACACATTGAAGACGG - Intergenic
1120267882 14:82274650-82274672 AGGAAACTACACTTGGAAGAGGG + Intergenic
1120500752 14:85294554-85294576 AAGAAAAAAATGAGGGAAGATGG + Intergenic
1120652889 14:87155570-87155592 AATAAAGTACACTTGGAAGAGGG - Intergenic
1120913329 14:89687802-89687824 AAGTAGATACAGATGGAGGGGGG + Intergenic
1121261827 14:92572051-92572073 AGGAAAGTACACTTGGAAGAGGG + Intronic
1121575343 14:94980428-94980450 AAGAAAATAAAGCAGGAAGAGGG - Intergenic
1121828396 14:97029177-97029199 AAGAGAAGAAAGAGGGAAGAAGG - Intergenic
1122002170 14:98667335-98667357 AAGAAAAAAGGGAGGGAAGAAGG - Intergenic
1122105337 14:99449110-99449132 AAGTAAATAAATGTGGAAGAAGG + Intronic
1122361560 14:101169978-101170000 AAGAAACTAGAGAGGGAGGAGGG + Intergenic
1122382641 14:101320415-101320437 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1122481043 14:102047746-102047768 AAGAAATCACAGAGGGAAAAGGG - Intronic
1202872192 14_GL000225v1_random:175327-175349 AAGAAAAAACGGCTGGAAGGAGG - Intergenic
1123426311 15:20173291-20173313 AAAAAAAAAAAGATGAAAGAAGG - Intergenic
1123535544 15:21179818-21179840 AAAAAAAAAAAGATGAAAGAAGG - Intergenic
1123961225 15:25402770-25402792 AAGAAAAGACACATTGAAAAGGG - Intronic
1123999937 15:25748299-25748321 AAGATAATACATTAGGAAGATGG + Intronic
1124047040 15:26160065-26160087 ATGAAAACACAGATGCGAGAAGG + Intergenic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1125009411 15:34854688-34854710 AAGCAAATTTAGGTGGAAGATGG - Exonic
1125072154 15:35567826-35567848 AATATAACACAGATGGAATACGG - Intergenic
1125980563 15:43996457-43996479 AAGAAAAGATACATTGAAGAGGG - Intronic
1126005318 15:44250989-44251011 AGGAAAGTACAGATGGTAGATGG + Intergenic
1126059507 15:44766604-44766626 AAGAAAATACAAATGCCAAAGGG - Intronic
1126260478 15:46683592-46683614 AGTAACATACACATGGAAGAGGG - Intergenic
1126300265 15:47186379-47186401 AAGAAAATAAAAATGGAAACTGG + Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127294491 15:57597575-57597597 GAGAAAACACAGGTGGATGAAGG - Intronic
1127477206 15:59346162-59346184 AAGAAAGCACAAGTGGAAGAAGG - Intronic
1127720691 15:61695811-61695833 TAGAAACTTCAGAGGGAAGATGG + Intergenic
1127913328 15:63436119-63436141 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1127961643 15:63894903-63894925 AAGCAATCACAGCTGGAAGATGG - Intergenic
1128095596 15:64952009-64952031 AAGAAAAAGAAGATAGAAGATGG - Intronic
1128281110 15:66395497-66395519 AAGACCAGACAGATGTAAGAAGG - Intronic
1128413683 15:67423866-67423888 AAGAAAAGAAAAAAGGAAGAAGG + Intronic
1128431626 15:67601182-67601204 AAGAAAATACAACAGGAAGAAGG - Intronic
1128777507 15:70334183-70334205 ATCAAACTACAGATGCAAGAAGG - Intergenic
1128955286 15:71935248-71935270 AAAAAAATGAAGAAGGAAGATGG - Intronic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1129610370 15:77049834-77049856 GATAAAATACAGAGGTAAGATGG - Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130240169 15:82180716-82180738 AAGAAGATACACATGGTATACGG + Intronic
1130263367 15:82377064-82377086 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1130277936 15:82492602-82492624 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130470266 15:84219787-84219809 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130477754 15:84334354-84334376 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130494011 15:84453776-84453798 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1130592555 15:85224415-85224437 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1131348556 15:91674929-91674951 AAGAAAATATGGATGTAATAAGG + Intergenic
1131539055 15:93260832-93260854 AAAAAAAAACCGAAGGAAGAAGG - Intergenic
1131696220 15:94880762-94880784 AAGAAAAGACAGAAGAAAAAAGG - Intergenic
1131833303 15:96367832-96367854 GAGAAAATTCAGAAGGAAGGGGG + Intergenic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132899993 16:2248406-2248428 AAAAAAATAAAGATAGAAAATGG - Intronic
1133707433 16:8368380-8368402 AAAAAAATACAGAAGAAAGAGGG - Intergenic
1133717812 16:8466260-8466282 ACAAACACACAGATGGAAGATGG - Intergenic
1134307416 16:13045695-13045717 AAGAAAATAAAGCTGGATCATGG + Intronic
1134400551 16:13905717-13905739 AAAAAAAAAAAGATGAAAGATGG - Intergenic
1134434274 16:14241175-14241197 AAGAAAAAACAGCTGGATGCTGG + Intronic
1134754818 16:16657643-16657665 AAGAAAGTAAGGAAGGAAGAAGG - Intergenic
1134811631 16:17172221-17172243 AAGGAAAGAGAAATGGAAGAGGG - Intronic
1134991244 16:18701465-18701487 AAGAAAGTAAGGAAGGAAGAAGG + Intergenic
1135247395 16:20868796-20868818 AAGAAAAGGCAGAAGAAAGAAGG + Intronic
1135898787 16:26435502-26435524 AAGAAAAAAAATATGGAAGGAGG - Intergenic
1136058705 16:27709887-27709909 AAGAAACTACAGCTTGGAGAAGG + Intronic
1136657965 16:31724220-31724242 AAAAAAATCCACATGAAAGAAGG - Intronic
1137472882 16:48777335-48777357 AAGAAATGACACATTGAAGATGG - Intergenic
1137640660 16:50025562-50025584 AAGAAAATAAAAATAGAAGCTGG - Intronic
1137658853 16:50185725-50185747 AAGAAAAGAGAGAGGGAGGAAGG - Intronic
1138009511 16:53364368-53364390 AAGAAAAAATAAAGGGAAGATGG - Intergenic
1138182661 16:54952756-54952778 AAGAAGATAGAGATGGAGAAAGG - Intergenic
1138764506 16:59585675-59585697 AAGAAAATACAGGTGGGACGTGG + Intergenic
1138815632 16:60200053-60200075 AGGAAAGTACACTTGGAAGAAGG + Intergenic
1138923858 16:61566959-61566981 TAGAAAAAGCAGGTGGAAGAAGG - Intergenic
1139054946 16:63171649-63171671 AAGAAAAGAAAGAAGAAAGAAGG + Intergenic
1139074427 16:63426645-63426667 AGTAAAATACACTTGGAAGAGGG + Intergenic
1139099651 16:63750062-63750084 AGTAAAATACACTTGGAAGAGGG + Intergenic
1139256054 16:65544117-65544139 AAGAAAACAGGGAAGGAAGAAGG + Intergenic
1140236134 16:73160585-73160607 AGGGAAATGCAGATGGAAGGAGG - Intergenic
1140308072 16:73822185-73822207 AAGAGAAAACAGATGCCAGAAGG - Intergenic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1140459706 16:75129918-75129940 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1140602347 16:76492419-76492441 AAGAAAATACAAAAGAAGGATGG + Intronic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1140976303 16:80063055-80063077 AAGAAAAAACAAATCAAAGAGGG + Intergenic
1141322491 16:83025038-83025060 TAGAAAAATCAGCTGGAAGAAGG + Intronic
1141898342 16:86972839-86972861 AAGCAAAGACAGATGGTAGATGG + Intergenic
1203115244 16_KI270728v1_random:1483454-1483476 AGGAAAATATACTTGGAAGAGGG + Intergenic
1143123263 17:4623545-4623567 AAGAAAAGAAAGAAGAAAGAAGG - Intergenic
1143545787 17:7594415-7594437 AAGAAAATGAGGCTGGAAGACGG - Intronic
1144169656 17:12647767-12647789 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
1144175168 17:12698217-12698239 AAGAAAAGAAAGATGTGAGATGG + Intronic
1144191043 17:12846104-12846126 AAAAAAATACAGCTGGCAAATGG + Intronic
1144426514 17:15147532-15147554 AATAAAATACAGAAAAAAGAAGG + Intergenic
1144435887 17:15240337-15240359 AAGAAAATACTGATGAAGAAAGG + Intronic
1144529042 17:16018402-16018424 ATGAGAAAACTGATGGAAGAGGG - Intronic
1145763284 17:27440334-27440356 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1145877046 17:28326955-28326977 AAAAAAAAAAAAATGGAAGAAGG - Exonic
1146135251 17:30314436-30314458 TAGAAAAGACATATGGAAAAAGG + Intergenic
1147499496 17:40949037-40949059 AAAAAAAAAAAGGTGGAAGAGGG + Intergenic
1147538616 17:41337046-41337068 AAGAAAGGAGAGAGGGAAGAGGG - Intergenic
1147700851 17:42393854-42393876 AAGAACATACAGCTGGTAAATGG + Intergenic
1147941903 17:44054715-44054737 AGGAAGATACAGGTGGGAGATGG - Intronic
1148453880 17:47800503-47800525 AAGAAAATAGAAAAAGAAGAGGG + Intergenic
1148726645 17:49796711-49796733 AAGAAAATAAAGAAAAAAGATGG - Intronic
1149012390 17:51871018-51871040 AAGAAAGTAAAGAAGGAAGGAGG - Intronic
1149096741 17:52850856-52850878 AATGAAATAAAGATGGAAGATGG - Intergenic
1149161066 17:53693799-53693821 AAGAGAATACAGAGTGAAAAAGG - Intergenic
1149500758 17:57150600-57150622 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1149532814 17:57408946-57408968 AAGAAAATAAAGAAAGAAAATGG - Intronic
1149674358 17:58446310-58446332 AAGAAAAGACACATTGAAGAGGG + Intronic
1149954774 17:61036428-61036450 AAAAAAATAAAGATGGGATAAGG - Intronic
1150274768 17:63889587-63889609 AACAAAAAAAAGAGGGAAGAAGG + Intergenic
1150324690 17:64247290-64247312 AAGAAAAGAAAGAAAGAAGAAGG + Intronic
1150827972 17:68493334-68493356 AGGAAAATACACTTGGAAGAGGG + Intergenic
1151512191 17:74567662-74567684 CAGAAAATCCAGATGGCAGCTGG - Intergenic
1152047541 17:77947482-77947504 AGGAAAATCAAGAAGGAAGAGGG + Intergenic
1152529542 17:80909221-80909243 AAGAAAAAAAAAATGGAAGAAGG - Intronic
1152909013 17:82986523-82986545 AAGTAAATCTAAATGGAAGAAGG + Intronic
1153033715 18:738755-738777 AAGAAAATTAAAATGGATGAGGG - Intronic
1153171123 18:2317144-2317166 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1153218222 18:2839562-2839584 AAGGAAGTACACTTGGAAGAGGG - Intergenic
1153276131 18:3369438-3369460 AAGAAAAGAAAGAAGAAAGAAGG + Intergenic
1153370174 18:4306486-4306508 AAGAAAATAAAGAAGAAAGGAGG + Intronic
1153551461 18:6266455-6266477 AAGAAGATGCAGATGGTAAAAGG + Intronic
1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG + Intronic
1154113013 18:11586403-11586425 AAGGAAGTACACTTGGAAGAGGG - Intergenic
1154275992 18:12960957-12960979 AGTAAAATACATTTGGAAGAGGG + Intronic
1154276993 18:12970398-12970420 AAGAAAAAACAGATGGACAGGGG - Intronic
1154487507 18:14885625-14885647 AAGAACATAAAGATGTACGAGGG - Intergenic
1155185189 18:23381499-23381521 TAGAAAATACAGATGGAGGCCGG - Intronic
1155637208 18:27970090-27970112 AAGGAAGTACTGTTGGAAGAAGG + Intronic
1155797377 18:30057508-30057530 AAGAAAAGAAAGAGGGAAGGAGG - Intergenic
1155797391 18:30057603-30057625 AAGAAAAGAAAGAGGGAAGGAGG - Intergenic
1155805164 18:30161051-30161073 AATACATTACAAATGGAAGATGG - Intergenic
1155890505 18:31262268-31262290 AATAAAATAAAAAGGGAAGATGG + Intergenic
1155915497 18:31553275-31553297 AAGAAAAGAGAGATGAGAGATGG + Intergenic
1155958746 18:31976214-31976236 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1156195171 18:34766732-34766754 AAGAAAATACAAATATAAGGGGG - Intronic
1156388964 18:36632911-36632933 AGTAAAATACACTTGGAAGAGGG + Intronic
1156474376 18:37396382-37396404 AAAAATTTACAGATGGAAAAAGG - Intronic
1156783436 18:40880335-40880357 AAGAAAATAAATATAGAATATGG - Intergenic
1157034887 18:43959744-43959766 AAGAAAATTGAGAGTGAAGACGG - Intergenic
1157056157 18:44231391-44231413 AAAGAAATACAGATAGAATATGG - Intergenic
1157180661 18:45495190-45495212 AAGAAAAGACAGACAGAGGAAGG + Intronic
1157491494 18:48126915-48126937 AAAGAAATAGAGATGGGAGAGGG + Intronic
1157676194 18:49570413-49570435 AATAAAATAATGCTGGAAGAAGG - Intronic
1157707599 18:49820612-49820634 AGGAAAGTACACTTGGAAGAGGG - Intronic
1158046932 18:53167677-53167699 AATAAAATATAAATGGAATATGG + Intronic
1158193132 18:54853875-54853897 AAAAAAATACAAATGATAGAGGG - Intronic
1158555641 18:58472536-58472558 AGGAAAATAAAGGTGGAAGAAGG + Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1158928581 18:62297419-62297441 ATGAAAATATAGAAGAAAGAAGG + Intronic
1159027286 18:63195376-63195398 TAGAAACTACAGATGGTAGTAGG + Intronic
1159054637 18:63451689-63451711 AGTAAAATACACTTGGAAGAGGG + Intergenic
1159112244 18:64072990-64073012 TAGAAAAGACAGGTGGAAAAAGG - Intergenic
1159396444 18:67864323-67864345 AAGAAAATACAACTGGAGGCCGG + Intergenic
1159449810 18:68585441-68585463 AACAAAATAGAAATGGAAAAAGG + Intergenic
1159553266 18:69918825-69918847 TGGAAAATACAGATGGAAAGTGG + Intronic
1159682887 18:71377069-71377091 AAGAAAAGACAGGTGGGAAAGGG - Intergenic
1159745713 18:72232393-72232415 AAGCACATACACTTGGAAGAGGG + Intergenic
1159952064 18:74491895-74491917 CAGAAAATGTAGATGGAAGTGGG + Intergenic
1159960492 18:74551781-74551803 AAAAAAGGACAGTTGGAAGAAGG - Intronic
1160105051 18:75965973-75965995 AGTAAAATACATTTGGAAGAGGG - Intergenic
1160312035 18:77802913-77802935 AAGACAATGCTGATGGAAAAGGG + Intergenic
1160986460 19:1841199-1841221 AAGAAAATAAACAGGGTAGAAGG - Intronic
1161502746 19:4626133-4626155 AAAAAAAAAAAAATGGAAGAAGG - Intergenic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161863223 19:6814732-6814754 AAGACAAGACAGAGGGAAAAAGG - Intronic
1161875936 19:6909566-6909588 AGGAAAAGAAAGAAGGAAGAAGG - Intronic
1161933711 19:7357967-7357989 AAGCACATATAGAAGGAAGAGGG - Intronic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162208775 19:9075550-9075572 AAGAAAAGACTGGAGGAAGAGGG + Intergenic
1162845239 19:13387250-13387272 AAGAAAATAAAAATGGAGGCCGG - Intronic
1164086964 19:21911805-21911827 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1164087129 19:21913101-21913123 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1164126654 19:22324566-22324588 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1164146724 19:22517262-22517284 AAGAAAAGAGAAAAGGAAGACGG + Intronic
1164680307 19:30130198-30130220 AACAAAATCCTGAAGGAAGATGG + Intergenic
1164806086 19:31118180-31118202 AAAGAAATGCAGATGGGAGAAGG + Intergenic
1164833171 19:31338803-31338825 AAGAAAAAAAAGATGGAGGGAGG - Intronic
1165236292 19:34424459-34424481 AAGTAAATATAGTTGGAAGAGGG + Intronic
1165667450 19:37645223-37645245 AAGAAAAAAAAAGTGGAAGAAGG + Intronic
1167032141 19:46969823-46969845 AGGAAAATACAGAGGGCAGATGG - Intronic
1167222914 19:48214721-48214743 AGGAAAGTACACTTGGAAGACGG - Intronic
1167302048 19:48683663-48683685 ATGAAAGTACACTTGGAAGAGGG - Intergenic
1167724872 19:51204138-51204160 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1167734064 19:51280863-51280885 AAGAAGATACCAGTGGAAGAGGG + Intergenic
1167952064 19:53035858-53035880 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1167954745 19:53055676-53055698 AGGAAAGTACAGTTGGAAGACGG - Intergenic
1168488925 19:56791019-56791041 AAGAAAAAACAGATTAATGAAGG - Intronic
1168653496 19:58109867-58109889 GAGAATATAAAGATGGATGAAGG + Intronic
924963238 2:53259-53281 AAGAAAATCCATATGGAATCTGG + Intergenic
925487802 2:4355311-4355333 AAGAAAACACAGATGTATGGGGG + Intergenic
925728298 2:6895897-6895919 AGGAAAATACATATGGAGTAAGG + Exonic
925751905 2:7096648-7096670 AGGAAAGTACACTTGGAAGAGGG + Intergenic
925768891 2:7263252-7263274 AAGGAAAGAAAGATGGATGAAGG - Intergenic
925813725 2:7726823-7726845 AAAAAAAAAAAGATGGTAGATGG + Intergenic
925838064 2:7965117-7965139 AACAAAATCAAGTTGGAAGAGGG - Intergenic
926438842 2:12865694-12865716 AAAAAAATACAAAAAGAAGAAGG - Intergenic
926439630 2:12874516-12874538 AGTAAAGTACAGTTGGAAGAGGG + Intergenic
926475461 2:13315488-13315510 GATAAAATACAGAAGGAAGGGGG - Intergenic
926494022 2:13561652-13561674 AAGAAAAGACACACTGAAGAAGG + Intergenic
926637334 2:15196052-15196074 ACGAAAGTACATTTGGAAGAAGG - Intronic
926747021 2:16167188-16167210 CAGAAAACTCAGATAGAAGAGGG - Intergenic
926764372 2:16311322-16311344 AAGCAAATACAGATGTCACATGG + Intergenic
926818366 2:16824244-16824266 AAGAAAGGAGAGATAGAAGAAGG - Intergenic
926853279 2:17224609-17224631 AAGAAAATACAGAATGAACTTGG + Intergenic
927120077 2:19951220-19951242 ACTAAAATAAAGATGGTAGATGG - Intronic
927350756 2:22111056-22111078 ATGAAAATAAAAATGGGAGAGGG - Intergenic
927409707 2:22810444-22810466 AAGTAAACACACAAGGAAGAAGG - Intergenic
927551932 2:24009064-24009086 AGGAAAGTACACTTGGAAGAGGG + Intergenic
927799554 2:26085546-26085568 AGGAAAATACACTTGGAAGAAGG - Intronic
927813258 2:26192222-26192244 AAAAAAAAAAAAATGGAAGAGGG + Intronic
927877330 2:26666998-26667020 AAGGAAAGAGAGAAGGAAGAAGG - Intergenic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928572538 2:32623765-32623787 AAGAAAAGAAAAATAGAAGATGG - Intergenic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
928656089 2:33453094-33453116 AAGAAAAGGCACATTGAAGAGGG - Intronic
928720303 2:34113597-34113619 AAGAAAATTCAGATGAAAGTGGG - Intergenic
928800101 2:35079007-35079029 TAGAAAATAGAGCTAGAAGATGG + Intergenic
928963651 2:36955367-36955389 AAGAAAATCGAGAGGGAGGAGGG + Intronic
929009205 2:37424433-37424455 AGGAAAGTACACTTGGAAGAGGG + Intergenic
929227316 2:39524201-39524223 AAGACTATGAAGATGGAAGAGGG + Intergenic
930112911 2:47694428-47694450 AAAAAAAAAAAGAGGGAAGAGGG + Intergenic
931005438 2:57846171-57846193 AAGAAAAGATACATTGAAGAGGG + Intergenic
931015503 2:57975471-57975493 TAAAAAATAGAGATGGAGGAAGG - Intronic
931049460 2:58394368-58394390 CAGAAAATACACTTTGAAGATGG + Intergenic
931164976 2:59736795-59736817 AAGAAAACAATGAAGGAAGAAGG + Intergenic
931294217 2:60905736-60905758 AGAAAAATACACTTGGAAGAGGG + Intronic
931385191 2:61792171-61792193 AGGAAAGTACACTTGGAAGAGGG - Intergenic
931503573 2:62898760-62898782 AGGAAAAGAGAGAAGGAAGAGGG + Intronic
931735652 2:65191034-65191056 AAGAAAAGACATATTGAGGAGGG + Intergenic
931786765 2:65626205-65626227 AACAAGATACTGATGGAAAAGGG + Intergenic
931852724 2:66269090-66269112 AAAAAATGACAGAAGGAAGAAGG + Intergenic
932005581 2:67923910-67923932 AAGGAAGTACACTTGGAAGAGGG - Intergenic
932925488 2:75968849-75968871 AAGAACATAGACAAGGAAGATGG + Intergenic
933096456 2:78189229-78189251 AAAAAGAAACATATGGAAGAAGG + Intergenic
933114320 2:78447391-78447413 AAGAAAAGACACATTGAGGAGGG - Intergenic
933210838 2:79567110-79567132 GAGAAAATTAAGTTGGAAGAAGG + Intronic
933369302 2:81395062-81395084 AAGAAAATAAAGAAGGGGGAGGG + Intergenic
933741290 2:85536351-85536373 ACGAATATAAAGATGGCAGAAGG - Intergenic
933892462 2:86784375-86784397 AAGAAAGAACAAAAGGAAGAAGG + Intergenic
933994586 2:87658836-87658858 AAGAAAATGCAAATGGAAGTGGG + Intergenic
935182317 2:100701949-100701971 AAGAAAATACTGACAGACGATGG - Intergenic
935513314 2:104002883-104002905 AAGAAAAGAAAGAAAGAAGAAGG + Intergenic
936299272 2:111292077-111292099 AAGAAAATGCAAATGGAAGTGGG - Intergenic
936698237 2:114976921-114976943 AAGATGATAGATATGGAAGATGG - Intronic
936703822 2:115045696-115045718 AAGAAAAGAAGCATGGAAGAGGG - Intronic
936746427 2:115582059-115582081 AATAAAGTACACTTGGAAGAGGG + Intronic
936765938 2:115848569-115848591 AGGAAAGTACATTTGGAAGAAGG - Intergenic
936768427 2:115882267-115882289 AAGAAAATACAGAAGGTTAAAGG + Intergenic
936779466 2:116014763-116014785 AGGAAACTACAGACAGAAGATGG - Intergenic
937237464 2:120439248-120439270 AAGAAACTACTGAAGGATGAGGG - Intergenic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
937630273 2:124093735-124093757 GAGAAAATACTCATGGAATAAGG + Intronic
937842655 2:126539203-126539225 AAAAAACTACTTATGGAAGAGGG + Intergenic
938003207 2:127763420-127763442 TAGAAAATAGAGAAGGAACATGG - Intronic
938161833 2:128992202-128992224 AAGAAATCAAAGATGAAAGAAGG + Intergenic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938870224 2:135467591-135467613 TAGAAAGTACAGATGAAAGAAGG - Intronic
939131245 2:138237980-138238002 AAGGAAATACAGTTGGAAGAAGG - Intergenic
939143082 2:138379065-138379087 AAGAATAGACATATTGAAGAGGG + Intergenic
939153596 2:138500562-138500584 AAGAAAAGAGAGAGGGCAGAGGG - Intergenic
939318344 2:140581772-140581794 AGAAAAATACAGAGAGAAGAGGG - Intronic
939902841 2:147870820-147870842 AAGTATATAAAGAAGGAAGAGGG - Intronic
940180130 2:150922870-150922892 AAGAGAATTAAGATGGCAGAAGG + Intergenic
940207295 2:151217220-151217242 AATAAAATACACTTAGAAGACGG + Intergenic
940242281 2:151576361-151576383 AAGAAAACACAGGTAGAAGCAGG + Intronic
940352648 2:152706375-152706397 AAGAGAATTCAGAAGGAAAACGG + Intronic
940374215 2:152939226-152939248 AAGAAAAAACAGAGAGAAAAGGG - Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
940555652 2:155225344-155225366 AAGAAAATTCAGATTGAACATGG - Intergenic
940988199 2:160070939-160070961 AAGAAAATAGAGAAGGTAGCAGG - Intergenic
941124823 2:161571999-161572021 AAGAAAAAATTGAGGGAAGATGG - Intronic
941375195 2:164719933-164719955 AAGAAAAAAAAAATAGAAGAGGG + Intronic
941427324 2:165365039-165365061 AAGAAAATGCATACAGAAGATGG + Intronic
941551935 2:166927602-166927624 AAGATAATAAAAATGGAAGAGGG - Intronic
942032585 2:171977761-171977783 AAAGGAATACAGAAGGAAGAAGG - Intronic
942329282 2:174805108-174805130 TACAAAATACACATGGAATAAGG + Intronic
942478979 2:176361920-176361942 AAGAAAATCCATATGTAAGTGGG + Intergenic
942519615 2:176790053-176790075 AGGAAGATAGAGATGGAAAATGG - Intergenic
942694493 2:178625046-178625068 AAAACAATAGAGATGGAAGGAGG + Intronic
942706100 2:178774367-178774389 CAGAAAATATAGAAGGAAAATGG - Exonic
942809302 2:179978189-179978211 AAGAAAATATAGTTAGAGGAAGG - Exonic
942818483 2:180081331-180081353 AGGAAAATACAGATGCAGGAGGG - Intergenic
942832304 2:180251456-180251478 AAGAAAAAAAAAATTGAAGAAGG + Intergenic
943113967 2:183643246-183643268 AAAAAAAAAAAGATGGAAGATGG - Intergenic
943257324 2:185612406-185612428 AGTAAAATATAGATGGAAAATGG - Intergenic
943499934 2:188674942-188674964 AGGAAATTATAGTTGGAAGAGGG - Intergenic
943542892 2:189239790-189239812 AAAAAAATAAAGACAGAAGAGGG + Intergenic
943804467 2:192105771-192105793 AAGAAAATGCAGTTGGATTAAGG - Intronic
943855450 2:192784049-192784071 AAGAAAAAAAAGAAGAAAGAAGG - Intergenic
944091577 2:195917523-195917545 AGGAAAGTACACTTGGAAGAGGG - Intronic
944364730 2:198904574-198904596 AATAAAATAAATAAGGAAGAGGG - Intergenic
944969207 2:204972675-204972697 TAGAAAATACAGCTGGAAAAAGG - Intronic
945483551 2:210368844-210368866 AAGAAAATTCAGAAGGAAAATGG - Intergenic
945619291 2:212113107-212113129 ATGAAAATACAGATCGAATTTGG + Intronic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946214084 2:218170128-218170150 AAGAAAGTACAGAGAGAAGATGG - Intergenic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
946511853 2:220366443-220366465 AAGAAAACAAAAAAGGAAGAGGG - Intergenic
946589768 2:221232443-221232465 AATGAAATCCAGATGTAAGAAGG + Intergenic
946626577 2:221618489-221618511 TAGAAAAAACGTATGGAAGATGG + Intergenic
947051258 2:226045764-226045786 AGTAAAATACACTTGGAAGAGGG - Intergenic
947082559 2:226414982-226415004 AAGAAAGGACAAAAGGAAGAAGG + Intergenic
947156896 2:227171821-227171843 AGGAAAGTACACTTGGAAGAGGG + Intronic
947319231 2:228897813-228897835 GAGACAATACAGAGGGGAGAGGG - Intronic
947401224 2:229733349-229733371 AGGAAAGTACACTTGGAAGAGGG + Intergenic
947599830 2:231439970-231439992 AGGAAAGTACACTTGGAAGAGGG - Intergenic
947761014 2:232604073-232604095 AAGAAAATCAAGAAGGAAGGAGG - Intergenic
948791954 2:240383734-240383756 AAGAAAGAACAAAAGGAAGATGG - Intergenic
1168822939 20:788176-788198 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1168884296 20:1235408-1235430 AATACAATACAGATTGAAAATGG - Intronic
1169300144 20:4435106-4435128 AAGAAAATGGAGTGGGAAGAAGG + Intergenic
1169431143 20:5537616-5537638 AAGAGAAGAAAGATGAAAGAAGG + Intergenic
1169553907 20:6729829-6729851 AAGAAAATAGAGAAGACAGAAGG - Intergenic
1169662286 20:7993203-7993225 AAGATTATAAAGATGGAAGAAGG - Intronic
1169751425 20:8998582-8998604 AAGATAATAGAGTTAGAAGAGGG - Intergenic
1169841832 20:9946612-9946634 ATGAAAATACAACTTGAAGAAGG + Intergenic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1170286863 20:14719504-14719526 AAGAAAATAAAGAAAGAAAAAGG + Intronic
1170369456 20:15632838-15632860 AGGAAAAGAGAGAGGGAAGAAGG - Intronic
1170473193 20:16688635-16688657 AAGAAAAAGCACACGGAAGAGGG + Intergenic
1170531697 20:17299622-17299644 AAGAAAAGAGAAATGGAAGATGG - Intronic
1170748863 20:19126057-19126079 AAGAAAAGACACATTGAAGAGGG - Intergenic
1170776126 20:19376126-19376148 AAGAAAATAAATAAGGATGAAGG + Intronic
1171079579 20:22164912-22164934 AAGAAAAGAAAGATAAAAGAAGG + Intergenic
1171177064 20:23060138-23060160 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1172116380 20:32575791-32575813 TAGAAAAGAGAGATGGGAGATGG + Intronic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173311763 20:41902977-41902999 AAGAAAATAACCATGGAAGGGGG + Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173684872 20:44916250-44916272 AAGAAAAAACAGATTTAAGAGGG - Intronic
1174085351 20:48004175-48004197 AAAAAATTGTAGATGGAAGATGG + Intergenic
1175465688 20:59189997-59190019 AGGAAAAGCCAGATGCAAGAAGG - Intergenic
1176107363 20:63395728-63395750 AAGAGAGTAGAGAGGGAAGAAGG + Intergenic
1176673777 21:9758116-9758138 AGGAAAATAAAGCAGGAAGAAGG - Intergenic
1176793771 21:13353709-13353731 AAGAACATAAAGATGTACGAGGG + Intergenic
1176975653 21:15318011-15318033 AAGAAAAAAGAAATGGAAAATGG + Intergenic
1177403184 21:20632724-20632746 GAAAAAATAGAGAGGGAAGAGGG - Intergenic
1177441215 21:21128017-21128039 AAAAAAATACAAAGGGAAAATGG - Intronic
1177662769 21:24107931-24107953 ATTAAAATGCACATGGAAGATGG - Intergenic
1177680719 21:24366433-24366455 AAGAAAATAGCAATGAAAGATGG - Intergenic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1178416412 21:32408733-32408755 AGGAAAATAGAGATGTAACATGG + Intergenic
1178456180 21:32753836-32753858 AACAAATTACAGATGGGAAAAGG + Intronic
1178479718 21:32969001-32969023 AAGAAAGTACACTTGGAAGAGGG - Intergenic
1178769842 21:35493009-35493031 AAGAAAACACTGATAGAAAATGG + Intronic
1179009956 21:37548887-37548909 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1179196718 21:39171058-39171080 CAGAAACTACAGATGGATGATGG + Intergenic
1179396218 21:41042817-41042839 AAGAAAAATAAGAAGGAAGACGG - Intergenic
1180947292 22:19703433-19703455 ATTAAAATACAGAGGGAAGCCGG - Intergenic
1182230915 22:28836950-28836972 AAGAAAATAAAGATGGAGTTGGG - Intergenic
1182664777 22:31949648-31949670 AAGAATGTACACATGGAAGGTGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183004037 22:34885423-34885445 AAAAAAAAACACAAGGAAGAGGG - Intergenic
1183445755 22:37853363-37853385 AGGAAAGGACAGTTGGAAGAGGG + Intronic
1183811340 22:40260375-40260397 AAGAAAGAAAAGATGAAAGATGG + Intronic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
1184024886 22:41848246-41848268 AAAAAAATACAGGGGGAGGAGGG - Intronic
1184064498 22:42109743-42109765 AAGAAAACTCAGAAGGAAAATGG - Intergenic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
1185186348 22:49402939-49402961 AAGAAAGCACACTTGGAAGAGGG + Intergenic
949411435 3:3769383-3769405 GAGAGAATAGAGATGGAAAAGGG - Intronic
949914415 3:8947299-8947321 AACAAACAACAGATGGAAAAAGG + Intronic
950237601 3:11337086-11337108 AAGAAAAAACAGAGTTAAGATGG - Intronic
950352470 3:12369940-12369962 GAGAAAATGCAGGAGGAAGAAGG - Intronic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950816948 3:15714729-15714751 ATAAAAATAAAGATGCAAGAGGG - Intronic
950912952 3:16614049-16614071 AGGAAAATAAAGAGGGAAGCTGG - Intronic
951179180 3:19638838-19638860 AAAAAAATAAAGATGTCAGAAGG + Intergenic
951247007 3:20352829-20352851 AATAAAATAAAAATGGATGAAGG - Intergenic
951399337 3:22212191-22212213 GAGAAAAGACAGGTGGAAGAAGG + Intronic
951405176 3:22288418-22288440 AATAAATGAAAGATGGAAGATGG - Intronic
951591386 3:24269175-24269197 AACATAATACAAATGGGAGAAGG + Intronic
951618347 3:24573173-24573195 GAGAAAAAATACATGGAAGAAGG + Intergenic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
951898045 3:27629745-27629767 AGAAAAAAAGAGATGGAAGAAGG + Intergenic
952240237 3:31524764-31524786 AATAAAATAAAAATTGAAGAAGG - Intergenic
952292297 3:32029256-32029278 AGGAAAGTACACTTGGAAGAGGG - Intronic
952571811 3:34726500-34726522 AAGACAATACAGCTGGTAAATGG - Intergenic
952860669 3:37809944-37809966 AGGAAATTACATATGGAATATGG - Intronic
953075344 3:39564866-39564888 AAGAAAAAATAAATGGAAAAGGG - Intergenic
953117096 3:40003959-40003981 CAGAAAAGACAGATGGCAGGTGG - Intronic
953293693 3:41691385-41691407 AGTAAAGTACAGTTGGAAGAGGG - Intronic
953798932 3:46006567-46006589 AGTAAAATACACTTGGAAGAGGG - Intergenic
953844479 3:46416574-46416596 AGGAAAGTACACTTGGAAGAGGG + Intergenic
953892109 3:46759005-46759027 AAGCAAATACAGAATGAAAAAGG + Intronic
954349989 3:50035257-50035279 AGGAAAGTACACTTGGAAGAGGG + Intronic
954365098 3:50141423-50141445 AAGAAAAAAAAGAGAGAAGAAGG - Intergenic
954743897 3:52775762-52775784 AAGAAACTGCAGGTGCAAGATGG + Intergenic
955992897 3:64647185-64647207 AAAAAAATACACATGGAAATTGG - Intronic
956193114 3:66625872-66625894 AAGCAGCTTCAGATGGAAGAAGG - Intergenic
956629667 3:71303783-71303805 AAGAAAATAAAAACGGAAAAAGG + Intronic
956713061 3:72055369-72055391 AAGAAAACAAAGCAGGAAGAGGG + Intergenic
956839960 3:73129789-73129811 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
957130984 3:76222357-76222379 AAGAAAGTATACTTGGAAGAGGG + Intronic
957890952 3:86356594-86356616 AAGAAAAGTCACATTGAAGATGG - Intergenic
958029567 3:88091463-88091485 AAGATTATATAGATGAAAGAGGG - Intronic
958122048 3:89303465-89303487 AAGAAAATAAAGGAGGAAGGAGG + Intronic
958532437 3:95350475-95350497 AGGAAAGTACACCTGGAAGAGGG - Intergenic
958673304 3:97232699-97232721 AAGAAAGTACACTTGGAAGAGGG + Intronic
958742068 3:98086533-98086555 AAGAAACAGCAGATGGAAGAAGG + Intergenic
958764369 3:98347246-98347268 AAGAACATACATTTGGAAAAGGG + Intergenic
959235301 3:103713824-103713846 AAGAAAATAAAGAAAGAAGAGGG + Intergenic
959243968 3:103839064-103839086 AAGAAATTATAGAAAGAAGACGG + Intergenic
959294724 3:104521241-104521263 AAGGAAGTACACTTGGAAGAGGG + Intergenic
959333360 3:105034797-105034819 AGTAAAGTACAGTTGGAAGAGGG + Intergenic
959463043 3:106650552-106650574 AAAAAAAAGCAGATGGAAGAAGG - Intergenic
960009275 3:112815809-112815831 AAGAAAAGAAAGATGGAAGAAGG - Exonic
960066811 3:113383124-113383146 AAGAAAAGACAGAGGGATAAAGG + Intronic
960325314 3:116288315-116288337 AAGAAAAGACAGATGAGAGAAGG + Intronic
960374419 3:116880901-116880923 AAGAAAACAAAGGTAGAAGAAGG - Intronic
960660956 3:120057976-120057998 AAGAAAATATAGCTGGGATAGGG - Intronic
960731316 3:120730930-120730952 AATAAAATGAAGATGGTAGAGGG + Intronic
960744992 3:120877662-120877684 AAGGAAAAAGAGGTGGAAGAGGG - Intergenic
960843399 3:121983524-121983546 AAGGAAGTACATTTGGAAGAGGG + Intergenic
961128294 3:124441850-124441872 AAGAAAATATGGAAGGAAGGAGG + Intronic
961332419 3:126150500-126150522 AAGAATATTCAGCTGGAGGATGG - Exonic
961462144 3:127057559-127057581 TTGAAAATTCAGTTGGAAGAGGG - Intergenic
961854369 3:129854675-129854697 AAGAAAGGATAGATGGGAGATGG - Intronic
961935975 3:130584311-130584333 AAGAAAAATCAGATGACAGAAGG + Intronic
961940703 3:130634903-130634925 AAGAAAATATATATGATAGAGGG - Intronic
962209269 3:133463351-133463373 AAGGAAATACACTTGGAAGAGGG + Intronic
962347912 3:134634475-134634497 AAGACAATTCAGTTGGAAAAAGG + Intronic
962408865 3:135123900-135123922 AAGAGGATAAAGGTGGAAGAAGG - Intronic
963542978 3:146617909-146617931 AAGAAAAAACATATTTAAGAAGG - Intergenic
963688225 3:148464943-148464965 AAGAAAATGAAGAGGAAAGAGGG - Intergenic
963921271 3:150908214-150908236 AAGGACATAAAAATGGAAGAGGG - Intronic
963927504 3:150966506-150966528 GAGAAAGCACAAATGGAAGAAGG - Intronic
963931080 3:151004877-151004899 AAGAAAAGACAGAAAGAAGAGGG - Intergenic
964175438 3:153822050-153822072 AGGAAAGTACACTTGGAAGAAGG - Intergenic
964236450 3:154535971-154535993 AAGAAGATAAAGGAGGAAGAGGG - Intergenic
964326799 3:155555694-155555716 AAGAAAAGACACATGGAGGTGGG - Intronic
964915633 3:161838224-161838246 AGTAAAATACATTTGGAAGAGGG + Intergenic
965323116 3:167271490-167271512 AAGAAAACTCAGAAGGAAAATGG + Intronic
965401953 3:168223066-168223088 AAGAAAATTCAGAGGAAAAAAGG + Intergenic
965594871 3:170400665-170400687 AAGAAAAGAAAGAAAGAAGAAGG - Intergenic
965797736 3:172458705-172458727 AAGAAAAGACAGATAGAAAGTGG - Intergenic
966052765 3:175641344-175641366 AAGCAAAGAAAGAGGGAAGAGGG - Intronic
966480180 3:180399315-180399337 AAGAAACTACAAACAGAAGAAGG + Intergenic
966641906 3:182201396-182201418 AAGAAAATAAGGAGGGAATAGGG - Intergenic
966959864 3:184924784-184924806 AAAAAAATACAATTAGAAGACGG - Intronic
967299833 3:188001991-188002013 AAGAAAAACCAGATTGAAGTGGG - Intergenic
967432985 3:189409977-189409999 AAGAAAATACAGATAGAAATAGG - Intergenic
967473622 3:189890772-189890794 AAGAAACTGCAGAGGGAGGAGGG - Exonic
967732056 3:192916340-192916362 AAGAAAACCTAGAAGGAAGAAGG + Intronic
967760214 3:193215551-193215573 TAGAAAAGGCAGGTGGAAGAAGG - Intergenic
967827148 3:193886125-193886147 AGTAAAGTACAGTTGGAAGAGGG - Intergenic
968119858 3:196118406-196118428 AAGAAAATAAAAATGTAAGTCGG - Intergenic
968294711 3:197567062-197567084 AAGAGAAAACAGGGGGAAGAAGG - Intronic
969097686 4:4746223-4746245 AATTAAATACAGATGAAAGGAGG + Intergenic
970122752 4:12775205-12775227 AAGTAGCTAGAGATGGAAGATGG - Intergenic
970331621 4:14991882-14991904 AAAAACATTCAGAGGGAAGAGGG - Intergenic
970522095 4:16895627-16895649 AGGAAGAGAGAGATGGAAGAGGG + Intronic
970548303 4:17152881-17152903 AAAAAAATAAAGTTGGAAGGGGG + Intergenic
970698333 4:18704634-18704656 AAGAAAAGAAAGAGGGAAGGAGG - Intergenic
970723217 4:19012221-19012243 AAGAGAATGAACATGGAAGAAGG - Intergenic
971014010 4:22468778-22468800 AAAAAGATAGAGATGGAAGAAGG + Intronic
971317507 4:25579842-25579864 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
971791898 4:31180789-31180811 AAGAAATTGCTGATGAAAGATGG - Intergenic
971797455 4:31246350-31246372 AAGAAAGAACAAATGGAAGAGGG + Intergenic
971919443 4:32917820-32917842 AAGAAAAGAAAGAAGGAGGAAGG - Intergenic
971967381 4:33577913-33577935 AAGAAAGTACACTTGGAAGAGGG + Intergenic
971990515 4:33886565-33886587 ATGAAAGAACAGCTGGAAGAGGG - Intergenic
972076653 4:35098606-35098628 ATGCAAATACAGAGGGAAGTTGG + Intergenic
972126851 4:35778331-35778353 AAGAAAGTACACTAGGAAGAGGG - Intergenic
972176869 4:36419166-36419188 AAGAAAACACAGATGGCAGATGG + Intergenic
972257178 4:37369708-37369730 AAGAAAATGCAAAAGGTAGAGGG + Intronic
972598553 4:40551597-40551619 AAGGAAGTACACAAGGAAGAGGG + Intronic
973064874 4:45776853-45776875 AAGAACAAAAAGAAGGAAGAAGG - Intergenic
973066513 4:45800859-45800881 ATGAAAATACAAATGAAAGTTGG - Intergenic
973115756 4:46456421-46456443 TAAAAAATAGAGATTGAAGAAGG + Intronic
973284227 4:48397366-48397388 AAGGAAATACAGAAGGAAAGAGG + Intronic
973728211 4:53797120-53797142 TAGAAAGTATAGATTGAAGAGGG - Intronic
974198440 4:58607597-58607619 TAAAACATACAGAAGGAAGAAGG - Intergenic
974206677 4:58712442-58712464 AAGTAATTCAAGATGGAAGATGG - Intergenic
974246371 4:59324645-59324667 AAGAAAAAACATATTGAAGAGGG - Intergenic
974266885 4:59597591-59597613 AAGAAAAAACACATAGAAGAGGG + Intergenic
974462343 4:62204476-62204498 AAGAAAGTGCATTTGGAAGAGGG - Intergenic
974713221 4:65630573-65630595 AATAAAGTACACGTGGAAGAGGG - Intronic
974771606 4:66421949-66421971 AATAGAATAAAGATGGGAGAGGG - Intergenic
975195562 4:71519061-71519083 AAGAAAAGACACATTGAAGAAGG - Intronic
975523784 4:75327796-75327818 AAGACAATGCAGCAGGAAGAAGG - Intergenic
975858276 4:78648352-78648374 CAGAAAAGAAAGATGAAAGAAGG - Intergenic
975901963 4:79164059-79164081 AAAAAAATACAGTAGCAAGAGGG - Intergenic
976122327 4:81796770-81796792 AAGAAAATACAATGGGAAAAAGG + Intronic
976212684 4:82687541-82687563 ACGAGAATAAAGATAGAAGAAGG - Intronic
976528674 4:86123721-86123743 AAGTAAGTACATGTGGAAGAAGG - Intronic
976715765 4:88120950-88120972 AACAATACACAGGTGGAAGAAGG + Intronic
976723742 4:88195636-88195658 AATAAAGTACACTTGGAAGAGGG + Intronic
976850657 4:89541631-89541653 AAGAAAAGACACATTGAAGAGGG + Intergenic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977181722 4:93883223-93883245 AAGAATATACAGACTGAAAAAGG - Intergenic
977219077 4:94317510-94317532 CAGAAAATACATATGGCATATGG - Intronic
977312471 4:95404640-95404662 AGGGAAATACAGATACAAGAGGG + Intronic
977609421 4:99016935-99016957 AAGAAAATACAGAAGGGAGATGG - Intronic
977941200 4:102861236-102861258 AAGAATAGACACATTGAAGAGGG - Intronic
978161464 4:105553033-105553055 AAGAAAACACACAAGGCAGAGGG + Intronic
978293687 4:107177079-107177101 ATGGAAATAGAGATGAAAGATGG - Intronic
978479912 4:109177158-109177180 AAGACAAAAAAGATGGAACATGG + Intronic
978587448 4:110289146-110289168 AAGAAAAAAGGGATGGAACAGGG + Intergenic
978686848 4:111455427-111455449 AAGAAGATGCAGCTGGAAGATGG + Intergenic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978859846 4:113435199-113435221 AAAAAAAAAAAAATGGAAGAAGG + Intergenic
978860594 4:113443955-113443977 AAGAAAAGAAGGAAGGAAGAAGG - Intergenic
978915231 4:114117928-114117950 AAGAAAAAACAGAATTAAGATGG - Intergenic
978938586 4:114410311-114410333 AATAAATTACACTTGGAAGAGGG + Intergenic
979056143 4:115997573-115997595 AGGAAAGTACACTTGGAAGAGGG + Intergenic
979201897 4:117988427-117988449 AAGAAAATAAATAAGGAAAACGG + Intergenic
979358350 4:119732137-119732159 AATAAAGTACACATGGAAGAGGG - Intergenic
979384517 4:120048835-120048857 AAGAAAATAGAAAAGAAAGAGGG - Intergenic
979451939 4:120882449-120882471 GACAAAATGAAGATGGAAGAAGG - Intronic
979833633 4:125332897-125332919 AAGCAAATACACAAAGAAGATGG + Intronic
979865641 4:125749625-125749647 AAGAAAAGAAAGAAGAAAGAAGG - Intergenic
979936475 4:126703762-126703784 AAGAACATACACATGCAAGATGG - Intergenic
979994407 4:127413149-127413171 AAGAAAATTTAGAGGAAAGAAGG - Intergenic
980041803 4:127948457-127948479 AGGAAAGTACACTTGGAAGAGGG - Intronic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980157997 4:129129901-129129923 AAGGAAATACAGATGGACTTAGG + Intergenic
980239749 4:130158383-130158405 TAGAACAAAAAGATGGAAGAAGG + Intergenic
980259778 4:130433320-130433342 AAGGAAGTACACTTGGAAGAGGG - Intergenic
980266195 4:130519953-130519975 AATAAACTACACATGGAAAATGG + Intergenic
980571554 4:134626857-134626879 AGGAAAGTACACTTGGAAGAGGG + Intergenic
980792145 4:137633432-137633454 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
980875417 4:138657504-138657526 AAGAAAAGAGAGAGGGCAGAAGG - Intergenic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981046107 4:140266801-140266823 AAGAAAATAAAAAGGGAGGAAGG + Intronic
981156119 4:141438353-141438375 TAGAAGACACAGAGGGAAGAAGG - Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981552684 4:145957899-145957921 AAGAAAAGAAAGAAAGAAGAAGG - Intergenic
981599144 4:146465978-146466000 TAGAAAATACAGAAGGAAAGAGG - Intronic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981757011 4:148151283-148151305 AAGAAAACACATATTAAAGAGGG - Intronic
982035845 4:151344939-151344961 GAGAAAATCAAGAAGGAAGAAGG - Intergenic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
982186529 4:152807592-152807614 AAGAAAACACAAATGAAAAATGG - Intronic
982317027 4:154042403-154042425 AAAAAAAAAAAGATGGAACAGGG - Intergenic
982475013 4:155839825-155839847 CAGAAAAAAAAGATGGTAGATGG + Intronic
982822093 4:159953878-159953900 AACAAAAAACAGATCAAAGACGG - Intergenic
982988855 4:162244953-162244975 AGGGAAATACACTTGGAAGAGGG - Intergenic
983160983 4:164413889-164413911 AAGAAAATACAGAAGGCACCTGG + Intergenic
983247499 4:165305140-165305162 ATTAAAAGAAAGATGGAAGAAGG - Intronic
983395215 4:167185481-167185503 AAGAAAAAAGAAAGGGAAGAAGG - Intronic
983418218 4:167484783-167484805 AGTAAAATACACTTGGAAGAGGG + Intergenic
983431019 4:167651590-167651612 AAGGATATACTGGTGGAAGAAGG + Intergenic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
983723211 4:170884444-170884466 AATATAATACAAATGGAATATGG + Intergenic
984113066 4:175644070-175644092 AAGAAAGTAGAGTTGGAAAAGGG - Intronic
984476758 4:180244871-180244893 AAGAAAAGAAAGAAGGAAAAAGG - Intergenic
984493527 4:180467761-180467783 AAGAACCTACAATTGGAAGAGGG + Intergenic
984580913 4:181509104-181509126 AAGAAACTACACGTGGAACATGG + Intergenic
984804841 4:183742547-183742569 AAGAAAAAAAAAAAGGAAGAAGG - Intergenic
984804888 4:183742872-183742894 ATGAGAATAAAAATGGAAGAAGG - Intergenic
984932675 4:184860815-184860837 GGGAAAATATAAATGGAAGAAGG - Intergenic
984998867 4:185465433-185465455 AAGGAAGAAGAGATGGAAGATGG - Intronic
985058175 4:186053325-186053347 AAGAAAATATAGATTTAATATGG - Intergenic
985179800 4:187246335-187246357 AAGAAAACACACATTGAAGAGGG - Intergenic
985400937 4:189593555-189593577 AGGAAAATAAAGCAGGAAGAAGG + Intergenic
985818271 5:2142779-2142801 CAGAAAACACACAGGGAAGAAGG - Intergenic
985883851 5:2660764-2660786 AAGAAAATAAAAATTAAAGATGG + Intergenic
985925568 5:3013683-3013705 GAGCAAATAAAGATGGAATAAGG - Intergenic
986076551 5:4343885-4343907 ATGAACACACAGAGGGAAGAAGG + Intergenic
986108155 5:4680770-4680792 ATTAAAATACAGAGGGATGAAGG + Intergenic
986224324 5:5799209-5799231 AGGAAAGTACACTTGGAAGAGGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986535248 5:8779895-8779917 AAGAAAGTACAGCTGGGAGGTGG - Intergenic
986653545 5:9988713-9988735 AAGAAAATCCATATGGATGCTGG + Intergenic
986748533 5:10764407-10764429 AGGAAAGTACACTTGGAAGATGG - Intergenic
986817090 5:11424818-11424840 AAGAAAAGAAGGAAGGAAGATGG + Intronic
986879083 5:12147813-12147835 AAGGAAAGAAAGAGGGAAGAAGG - Intergenic
987257258 5:16168751-16168773 AGGAAGAAAGAGATGGAAGAAGG + Intronic
987289456 5:16494868-16494890 AAAAGAAGACAGATGGATGAAGG + Intronic
987384972 5:17320402-17320424 AAGAATTTACAGATGGTTGATGG - Intergenic
987569409 5:19636725-19636747 GAGAAAATTCTGATGGAATATGG - Intronic
987765936 5:22229750-22229772 GAGAAACTGCAGATGGAACATGG - Intronic
987898473 5:23979830-23979852 AATAAAGTACATATGGAAGAGGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988214976 5:28260287-28260309 AAAACAATACATATGGAAAAAGG - Intergenic
988464947 5:31480853-31480875 AAGAAAGGAGAGAAGGAAGATGG + Intronic
988583869 5:32491999-32492021 AGGAAAGTACACTTGGAAGAGGG + Intergenic
989136767 5:38163574-38163596 AAGAAAATACAGAAGGGAGAGGG - Intergenic
989148493 5:38273085-38273107 AAGAAAAGACACATTGAAGAAGG + Intronic
989276073 5:39590473-39590495 AAGAAAATAAAGCTGTAAGATGG - Intergenic
989476728 5:41882953-41882975 AAGAAAGTACACTTGGGAGAGGG + Intergenic
989961808 5:50424941-50424963 GAGAAAGTAAAGATGGAAGAGGG - Intronic
989999818 5:50879808-50879830 AGGAAAGTACACTTGGAAGAGGG - Intergenic
990080504 5:51907357-51907379 AAAAAAATACAGAAGGAATTAGG + Intergenic
990112283 5:52342030-52342052 AAGGACATACAGATGGAAACTGG + Intergenic
990277454 5:54213208-54213230 AAGAAAACACACGTGTAAGAAGG + Intronic
990594194 5:57296553-57296575 AGTAAAATACACTTGGAAGAGGG - Intergenic
990658748 5:57988232-57988254 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
990676839 5:58196168-58196190 AAGAAAAGATAGATATAAGAAGG + Intergenic
990763967 5:59161758-59161780 AAGTAAATACAGGGGGAAAACGG - Intronic
990764575 5:59168092-59168114 ACAAAAATACAGAAGGAAGACGG + Intronic
990896116 5:60701504-60701526 AAGGAAGTACACTTGGAAGAGGG + Intergenic
991048229 5:62245170-62245192 AGGAAAATATACTTGGAAGAGGG - Intergenic
991092918 5:62710140-62710162 AAGAAAAGAAAGAGGGAGGAAGG - Intergenic
991180144 5:63741258-63741280 AAGAAAATACACATTGGTGATGG - Intergenic
991942135 5:71863230-71863252 AAGAAACAACAGAGGGAAGGAGG - Intergenic
992262003 5:74979745-74979767 AAAAAAAGAAAGAAGGAAGAAGG + Intergenic
992308487 5:75468277-75468299 AAGAAAATACCCATTGAAGAGGG + Intronic
992408527 5:76482521-76482543 TAGTACATACAGAAGGAAGAGGG + Intronic
992675659 5:79103454-79103476 AAAAAAAAACAAATGGAAGAGGG + Intronic
993364859 5:87022730-87022752 AAGAAAGTATACTTGGAAGAGGG - Intergenic
993724402 5:91351757-91351779 AGGAAAGTACACTTGGAAGAAGG - Intergenic
994152475 5:96463741-96463763 AAGCAGAGACAGATGGAAGGGGG - Intergenic
994279103 5:97878674-97878696 AAGAAAATAGAGACAGAAGAAGG - Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994639384 5:102386971-102386993 AAGAAAAGACACATTGAAGAGGG - Intronic
994787706 5:104185971-104185993 AGGAAAGTACACTTGGAAGAGGG - Intergenic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
995046968 5:107661547-107661569 AAGAAAATACAGACAGATGTCGG - Intronic
995217550 5:109612961-109612983 TAGAAAATACAGATGAATAAAGG - Intergenic
995288413 5:110419193-110419215 AAGAAAGCAAAGATGGAGGAAGG + Intronic
995482841 5:112609989-112610011 AGGAAAGTACACTTGGAAGAGGG - Intergenic
995796794 5:115949752-115949774 AAGGAAAACCAGATAGAAGAAGG + Intergenic
996629536 5:125611066-125611088 AACAAAACACAGATCAAAGAGGG + Intergenic
997022939 5:130023333-130023355 CAGAAATTACATAAGGAAGAAGG + Intronic
997219132 5:132144560-132144582 ATGAAAATAGAGATGACAGAGGG + Intergenic
997621044 5:135295621-135295643 GAGAAAATACAGAAGGAACCTGG - Intronic
998154763 5:139778604-139778626 AAGAAAATAAAGATGGATGTGGG - Intergenic
998382696 5:141736984-141737006 AAGAAAATAAATTGGGAAGAAGG - Intergenic
998739623 5:145185672-145185694 AAAACAATACAGATGTAAGTTGG + Intergenic
998766442 5:145493079-145493101 AATAAAAGGCACATGGAAGAGGG - Intronic
999032102 5:148305550-148305572 AAGAAAATATACATTGAAGAGGG - Intergenic
999077068 5:148806403-148806425 AAGAAAAGACACAAGGAAAATGG + Intergenic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
999292704 5:150437211-150437233 AAGAAAGAAAAGAAGGAAGAAGG + Intergenic
999396293 5:151230754-151230776 AAGAAAAGACAGATGTTTGAGGG + Intronic
999899947 5:156076230-156076252 AGGTAAAGACACATGGAAGAAGG - Intronic
1000128581 5:158272332-158272354 AAGAAAAAAAAGATGATAGATGG + Intergenic
1000233337 5:159335499-159335521 AAGGAAGTACACTTGGAAGAGGG - Intergenic
1000315627 5:160087602-160087624 ACTAAATTACAGATGGAAGGTGG + Intronic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001461820 5:171922521-171922543 AAGGCAATTCAGAAGGAAGAAGG + Intronic
1001502883 5:172252642-172252664 AGGAAACTTCAGATAGAAGAGGG - Intronic
1002622494 5:180498235-180498257 AAGAAAATATAAATGGATGAAGG - Intronic
1003256162 6:4476741-4476763 AAGAAAATTTAGAGGGAAGAAGG - Intergenic
1003454480 6:6269027-6269049 AAGTAAAGGCAGAAGGAAGAAGG + Intronic
1003456382 6:6286453-6286475 AAGAAAATACACTTGGAAAAGGG - Intronic
1003833764 6:10044249-10044271 CAGAAAACACACAGGGAAGAAGG - Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004229512 6:13818398-13818420 AGGAGAAAAGAGATGGAAGATGG + Intergenic
1004303210 6:14476931-14476953 AAGAAAATACAGCTGGAGCTGGG + Intergenic
1004324230 6:14659386-14659408 GAGAAATTACAGATGGAAAGAGG - Intergenic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1004998283 6:21215391-21215413 AAGAAGATACAGATACAAGGAGG + Intronic
1005007169 6:21299151-21299173 AAGAAAAGAGAAAGGGAAGAAGG - Intergenic
1005011498 6:21340165-21340187 AAGAAGAAGCACATGGAAGAGGG - Intergenic
1005022254 6:21429635-21429657 ATGAAAATACAGGTGGATGGGGG - Intergenic
1005105982 6:22224610-22224632 AAGAGAATAGAGATGGCACATGG - Intergenic
1005724701 6:28637279-28637301 AAAAAAAAACAGCTTGAAGATGG - Intergenic
1005741764 6:28797754-28797776 AAATAAATAAATATGGAAGATGG + Intergenic
1005748519 6:28862296-28862318 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1005764401 6:28996594-28996616 AAGAAAATACAAATGTCAGAGGG + Intronic
1006017985 6:31097658-31097680 AGGAAAGTACATTTGGAAGAGGG - Intergenic
1006210697 6:32392105-32392127 AAGAAAATACAGCTGCATAAGGG - Intergenic
1006211225 6:32396626-32396648 AAAAAAATACAGGTAGAAGCAGG - Intronic
1006219462 6:32476269-32476291 TGGAAAAAACAGATAGAAGAGGG - Intergenic
1006531426 6:34658352-34658374 AAAAAAAAAAAGATGGATGATGG + Intronic
1006699328 6:35958985-35959007 AAGAAAATGATGATGGGAGATGG - Intronic
1006827202 6:36944344-36944366 AAGAAAATAAAGAAAGAAAAAGG + Intergenic
1007013344 6:38438816-38438838 AAAACAAAACAGAAGGAAGATGG + Intronic
1007410734 6:41659847-41659869 AAAAAAAGGCAGATGGAAAAGGG + Intergenic
1007534691 6:42576022-42576044 AAGAAAAAACAGAAGGGAAAAGG - Intronic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008316438 6:50047475-50047497 AAGAAAAGACACATTAAAGAGGG - Intronic
1008781828 6:55116505-55116527 AAGAAAGGAAAGAGGGAAGAAGG + Intronic
1008784132 6:55144943-55144965 AAGAAAAGACAGTTTGAATAGGG - Intronic
1008937792 6:57011391-57011413 ATGAAAATGTAGATGCAAGAAGG + Intronic
1008978689 6:57457917-57457939 AAGAAAATGAACAAGGAAGATGG - Intronic
1009054218 6:58316151-58316173 AAAAAAATACAGGTGACAGAGGG + Intergenic
1009166824 6:60350876-60350898 AAGAAAATGAACAAGGAAGATGG - Intergenic
1009236919 6:61134428-61134450 AAAAAAATACAGGTGACAGAAGG - Intergenic
1009349054 6:62651941-62651963 AAGAAAAAGCAGAGAGAAGAGGG - Intergenic
1010001485 6:70954710-70954732 AAGAAATTTCAGGTGGAGGAAGG + Intronic
1010194441 6:73225252-73225274 AATAAAAAACAGATGAAGGAGGG + Intronic
1010248713 6:73686135-73686157 AATAAAAGACACATTGAAGAAGG - Intergenic
1010320524 6:74504075-74504097 AAGAAAAGACACATTGAAGAGGG + Intergenic
1010654165 6:78492181-78492203 AAGATAATACAGCTTGAAAATGG + Intergenic
1010733622 6:79416858-79416880 AATAAATTACAGTTGGAAAAGGG + Intergenic
1011168454 6:84478118-84478140 AAGAAAAAAAAGGTGGAAGTGGG + Intergenic
1011210573 6:84951870-84951892 AAGAAAATACATAAGCAAAATGG + Intergenic
1011338747 6:86288436-86288458 AAGAAGATATACAAGGAAGATGG - Intergenic
1011522844 6:88228690-88228712 AAGAAAAAATACATTGAAGAGGG + Intergenic
1011524565 6:88249946-88249968 AAGAAAATTCATAGGGAAGTAGG + Intergenic
1011616813 6:89204855-89204877 AAGAAAATACAGATGCAGAATGG - Intronic
1011617610 6:89211482-89211504 AAGAAGAGACAGATGTCAGAGGG - Intronic
1012382880 6:98641129-98641151 AAAAAAAAAAAGATGGAAGGTGG + Intergenic
1012779334 6:103536766-103536788 AATAAAGTACACTTGGAAGAGGG + Intergenic
1012914879 6:105158961-105158983 AAAAACAGACAGATTGAAGATGG - Intronic
1012991007 6:105925877-105925899 GAGAAAATATACATGTAAGAAGG - Intergenic
1013015295 6:106155469-106155491 AAGAAAAGACAGGTGGCAGGAGG + Intergenic
1013416032 6:109925417-109925439 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1013425273 6:110006488-110006510 CAGAAAATACATATCTAAGAAGG - Intergenic
1013435150 6:110097247-110097269 ATGAAAATACAGATGTGAGATGG + Intergenic
1013508865 6:110826639-110826661 ACACAAATACAGAGGGAAGACGG - Intronic
1013581627 6:111540654-111540676 AAGAAAAGAAATATAGAAGAGGG + Intergenic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1013816690 6:114107548-114107570 AAGAAAAGACAGATTGGATAGGG + Intronic
1013835483 6:114330229-114330251 AAGAAAATAAACATGGATAATGG + Intronic
1013976726 6:116087632-116087654 GAGAAGATACAGAAGGAACAGGG + Intergenic
1014042846 6:116849879-116849901 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1014098657 6:117485864-117485886 ATGAAAATACAGCAGAAAGAAGG + Intronic
1014339392 6:120184475-120184497 AAAAAAATAAAGAGGAAAGAGGG - Intergenic
1014688276 6:124530894-124530916 TAGAACAAAAAGATGGAAGAAGG - Intronic
1015217648 6:130768285-130768307 ATGAAAAGAGAGAGGGAAGAAGG - Intergenic
1015382846 6:132589303-132589325 AATGAAACAGAGATGGAAGATGG + Exonic
1015422974 6:133032473-133032495 AAGCAAATACAGATGTTTGAGGG + Intergenic
1015451177 6:133367875-133367897 AATAAAATATATATGGAAGATGG + Intronic
1015606823 6:134965778-134965800 AGTAAAATACATATGGAAGGCGG - Intronic
1015824866 6:137300891-137300913 AGGAAATTACAATTGGAAGAAGG + Intergenic
1015966237 6:138697281-138697303 AAGTGACTGCAGATGGAAGAGGG - Intergenic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1016235357 6:141857478-141857500 AAGAAAGTACACTTGGAAGAGGG + Intergenic
1016546473 6:145229613-145229635 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1016926315 6:149352541-149352563 AGGAAAATAGAGATGGAAAGGGG - Intronic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017047191 6:150357671-150357693 AAGGAAATAGAGATGGCAGAGGG + Intergenic
1017104605 6:150875679-150875701 AAGCAAATAAAGTGGGAAGAGGG - Intronic
1017507899 6:155085262-155085284 AAGAAGATACAATTTGAAGAAGG + Intronic
1017744418 6:157434129-157434151 AAGAAAATAGAGAAGAAAAACGG + Intronic
1018455293 6:163946261-163946283 AAGAAAATAAACATGCAAGACGG - Intergenic
1018523798 6:164684475-164684497 AAGAAAATAAATAGGCAAGACGG + Intergenic
1018653680 6:166011826-166011848 AAGCAAACACAGAAGGATGATGG + Intergenic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019106651 6:169673203-169673225 AACAAAATACAGAGGGAAAATGG + Intronic
1020412304 7:7906394-7906416 AATAAAATGCATTTGGAAGAGGG + Intronic
1020435794 7:8161063-8161085 AAGAAAATACACGTGGGAGTCGG + Intronic
1020571344 7:9866954-9866976 AAGAAAATTCAGAAGAAAGACGG - Intergenic
1020587300 7:10085190-10085212 AAGAAAGTACACTTGGAAGAGGG + Intergenic
1020663873 7:11014877-11014899 AAAAAAAAAAACATGGAAGATGG - Intronic
1020727090 7:11829640-11829662 ATGAAAATAAAGAGGCAAGAAGG - Intronic
1021035737 7:15795794-15795816 TAGAAAATGGAAATGGAAGATGG + Intergenic
1021105805 7:16638435-16638457 ATGAACAGCCAGATGGAAGAGGG + Intronic
1021535237 7:21696251-21696273 AAGAAAATACAAATGAAATATGG - Intronic
1021730270 7:23588795-23588817 AAAAAAATATATATGGAAGTAGG + Intergenic
1021819661 7:24484272-24484294 AATACAATACAGATGGCAAAAGG - Intergenic
1021972688 7:25981151-25981173 AAGAAGAGAAACATGGAAGAGGG + Intergenic
1022736304 7:33079487-33079509 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1023029142 7:36077992-36078014 AAGAAAGTAGACTTGGAAGAGGG + Intergenic
1023071149 7:36435369-36435391 AAGAAAATAGAGATGGTGGGGGG + Intronic
1023229386 7:38009687-38009709 TTGAAAATAGAGATGGGAGAGGG + Intronic
1023364572 7:39450956-39450978 AGGAAAATTCAGAGAGAAGATGG - Intronic
1024166960 7:46744410-46744432 AAAAAAAAAAAGATGAAAGACGG - Intronic
1024531431 7:50396672-50396694 AAAAAAATATAGTGGGAAGAAGG - Intronic
1024907904 7:54409795-54409817 CAGAAAAGACACATTGAAGAGGG + Intergenic
1025727360 7:64079043-64079065 AAGAGAATTCATATGGAAGAGGG + Intronic
1026227749 7:68457576-68457598 AAAAAAAAAAAGATGGAAGGTGG + Intergenic
1026258295 7:68732001-68732023 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026364355 7:69632608-69632630 AAGAAAACAGAGAGGGAAGAGGG - Intronic
1026730777 7:72910214-72910236 AGGAAAGTACACTTGGAAGAAGG - Intronic
1026798993 7:73385893-73385915 AAGGAAGTACACTTGGAAGAGGG - Intergenic
1026897015 7:74015131-74015153 AAGAAAATAAAAAAGGAAGTTGG - Intergenic
1027113312 7:75457956-75457978 AGGAAAGTACACTTGGAAGAAGG + Intronic
1027232056 7:76278496-76278518 AAAAAAATAAAAATGAAAGAGGG + Intronic
1027285562 7:76642551-76642573 AGGAAAGTACACTTGGAAGAAGG + Intergenic
1027459227 7:78431600-78431622 AAGAAAATGCAGATGGTAAATGG + Intronic
1027520775 7:79203985-79204007 AAGAAAAGGCACATGGAAGAGGG + Intronic
1027554750 7:79649005-79649027 TAGAAAATACCTATAGAAGATGG - Intergenic
1027652198 7:80882303-80882325 AAGAAAATAAAAATGCCAGAAGG - Intronic
1027697458 7:81430032-81430054 AGGGCAATACAGATGGCAGAGGG + Intergenic
1027946083 7:84748383-84748405 ATTAAAAGACACATGGAAGAGGG + Intergenic
1028018222 7:85741076-85741098 AAGAAAATTCACAAGGAAAATGG - Intergenic
1028365532 7:90025667-90025689 AAGAAAAAAAAGAGAGAAGACGG + Intergenic
1028480537 7:91299981-91300003 AAGACAATACAGATGGGAGGAGG - Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028833867 7:95352534-95352556 AAGAAAGTATACTTGGAAGAGGG - Intergenic
1028879164 7:95859989-95860011 AAGAAAATACACATTGAAGAGGG - Intronic
1028920643 7:96306739-96306761 AACAAAATGCAGAGGGATGAAGG - Intronic
1029789585 7:102828460-102828482 AAGAAAATAAAGGTTGAAAAGGG + Intronic
1029942143 7:104491480-104491502 AACAAATTATAGGTGGAAGAGGG + Intronic
1030014930 7:105209553-105209575 AAGAAAATAGAAAAGGAAAAAGG + Intronic
1030139651 7:106291784-106291806 AAGAAAATACAGATGGGAGGTGG - Intergenic
1030394437 7:108967701-108967723 AAAAAATGAGAGATGGAAGAAGG - Intergenic
1030468561 7:109934335-109934357 AAAAATATAAAGATGGAACATGG - Intergenic
1030532004 7:110722802-110722824 CAGAGAATACAGATGCTAGAAGG + Intronic
1030558215 7:111053149-111053171 AGGAAAGTACACTTGGAAGAGGG + Intronic
1030940500 7:115641117-115641139 AATAAAATACAGAATGAATATGG - Intergenic
1030976185 7:116126424-116126446 AAGAAAATAAAGAGGGCAAAGGG + Intronic
1031302429 7:120079206-120079228 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1031539722 7:122978535-122978557 AGTAAAATACATGTGGAAGATGG - Intergenic
1031832669 7:126646461-126646483 AGGAAATTACAGAGGGATGAAGG - Intronic
1031942346 7:127802244-127802266 GAGAAAATCCAGATGTAAGTGGG + Intronic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032337737 7:131042146-131042168 GTAAAAATACAGAGGGAAGAAGG + Intergenic
1032434521 7:131889209-131889231 AGGAAAACACTGAGGGAAGATGG - Intergenic
1032958322 7:137000137-137000159 AAGAAAATACTGATGAGTGAGGG - Intronic
1033097691 7:138445164-138445186 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1033625064 7:143102491-143102513 AAGGAAAAAAATATGGAAGAGGG + Intergenic
1033683418 7:143618834-143618856 AAGAAAAAAAAGATTAAAGATGG - Intergenic
1033701195 7:143838804-143838826 AAGAAAAAAAAGATTAAAGATGG + Intergenic
1033822300 7:145149014-145149036 AAGATAATAGAGTTAGAAGATGG - Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1033967404 7:146993137-146993159 AATAAAATACACTTGGAAGAAGG + Intronic
1034035255 7:147813132-147813154 AAGCAAGTTCAGATGGGAGATGG + Intronic
1034195414 7:149242944-149242966 AAGAAAGTAGAGAAGAAAGATGG + Intronic
1034620866 7:152456124-152456146 AAGAAAAATTACATGGAAGATGG + Intergenic
1035067116 7:156114334-156114356 AAGAAAGAATAGAAGGAAGAAGG + Intergenic
1035358166 7:158291848-158291870 AAGAAGAGAGAGATGAAAGAGGG + Intronic
1035401967 7:158571599-158571621 AGGAAAGTACACTTGGAAGAGGG + Intronic
1035421786 7:158735639-158735661 AAGAAAATACAGCAGAATGATGG - Intronic
1036044210 8:5121979-5122001 AATAAAGTACACTTGGAAGAGGG + Intergenic
1036104572 8:5826003-5826025 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1036110156 8:5890007-5890029 AAGAACATACATACGTAAGAAGG + Intergenic
1036441235 8:8782684-8782706 AAGGAAGTACACTTGGAAGAGGG - Intergenic
1037010773 8:13839574-13839596 AAGAAAATACAGAAAGGATAGGG + Intergenic
1037132866 8:15427581-15427603 AGGAAAGTACATTTGGAAGAAGG - Intronic
1037268395 8:17095734-17095756 AAGGAAATAAAGAGGGAAGGAGG - Intronic
1037282133 8:17253318-17253340 AAGAAAAGGCAGAGGGAAAAAGG - Intronic
1037344597 8:17885431-17885453 AAGAAAATTCAGATAAAAGCAGG + Intronic
1037423759 8:18732246-18732268 AACAAAATACTGATTGTAGATGG + Intronic
1037512441 8:19597681-19597703 GAGAAAATACAGATGTTAAAAGG + Intronic
1037675737 8:21049509-21049531 TAGAAACTAGAGATGGAGGAAGG + Intergenic
1037962474 8:23108208-23108230 AGGAAAGTACACTTGGAAGATGG + Intronic
1038177276 8:25192486-25192508 AAAAGAATACAGATGGAAATGGG - Intronic
1038331903 8:26615652-26615674 AAGAAAACACAGATGGCAATTGG + Intronic
1038472293 8:27835486-27835508 AAGATAACACAGATGGAAGAAGG - Intronic
1038834146 8:31099930-31099952 AAGGTAATACACATGGCAGATGG + Intronic
1038869805 8:31481669-31481691 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1038958092 8:32489023-32489045 AGTAAAATACACTTGGAAGAGGG + Intronic
1039053552 8:33515621-33515643 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1039097788 8:33905100-33905122 AAGATAACAGAGAAGGAAGAAGG - Intergenic
1039125724 8:34199449-34199471 AAGTAGAGAAAGATGGAAGATGG - Intergenic
1039210573 8:35208186-35208208 AACAAAATACAGCTGGTAAATGG - Intergenic
1039703190 8:39981781-39981803 ATGAAAATGGAGATGGAAGAGGG + Intronic
1039805617 8:40994977-40994999 AAAAAAAGACAGAGGGAGGAAGG + Intergenic
1039860811 8:41455580-41455602 AAGAAAAGAAAGAAGAAAGAAGG + Intergenic
1040381052 8:46873413-46873435 TAAAAAATATAGATGGAAAATGG + Intergenic
1040621780 8:49099998-49100020 AGGAGAATTCAGAAGGAAGATGG + Intergenic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1040862845 8:52018071-52018093 AAGAGAATACGAAGGGAAGATGG - Intergenic
1041033294 8:53760498-53760520 AATAAAGTACACTTGGAAGAGGG - Intronic
1041374891 8:57203432-57203454 AGCAAGATACAGTTGGAAGAGGG + Intergenic
1041378006 8:57221901-57221923 AGCAAGATACAGTTGGAAGAGGG + Intergenic
1041385651 8:57299126-57299148 AGTAAAATACACTTGGAAGAGGG + Intergenic
1041385755 8:57300117-57300139 AATAAAGTACACATGGAAGAAGG + Intergenic
1041492460 8:58449621-58449643 AAGCAGAAACAGATGGAAAAAGG + Exonic
1041720788 8:60973595-60973617 AGTAAAGTACAGCTGGAAGAGGG + Intergenic
1041766061 8:61419447-61419469 AAGAAAATAATGAGGGAAAATGG + Intronic
1041837253 8:62230378-62230400 GAGAAAATAAAGCCGGAAGAGGG - Intergenic
1042543085 8:69926734-69926756 AAGAAAATACAGAGAAAACATGG + Intergenic
1042601735 8:70505667-70505689 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1043506637 8:80909276-80909298 GAGAAAATACAGACAGCAGAGGG + Intergenic
1043599523 8:81920226-81920248 AGGAAAGTACATTTGGAAGAGGG - Intergenic
1043848489 8:85188893-85188915 AAGAAAAGTCACATTGAAGAGGG - Intronic
1043885151 8:85590300-85590322 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1043944095 8:86230429-86230451 AACAAAATAGAGGTGGAAGGTGG + Intronic
1044071043 8:87759999-87760021 AAGAAAAGACAGAAATAAGAGGG - Intergenic
1044113135 8:88301563-88301585 AAGAAAATACAGATATATGCAGG + Intronic
1044119278 8:88374702-88374724 AATAAAGTACAGTTGGAAGATGG - Intergenic
1044252714 8:90022829-90022851 AAGACAATAATGAGGGAAGAAGG - Intronic
1044389290 8:91629944-91629966 AACAAAATATAGCTGTAAGAAGG - Intergenic
1044502271 8:92971884-92971906 AAGAAAATATAGTTTGAAGTTGG - Intronic
1045085116 8:98674078-98674100 GAGAAAATACATATGAAAAATGG + Intronic
1045270373 8:100656256-100656278 AGGAAAGTACACTTGGAAGAGGG - Intronic
1045317077 8:101052477-101052499 AAGAAAATAAAAATGGATGGAGG - Intergenic
1045356698 8:101395898-101395920 ATGAAAATAGGGATGGGAGAAGG - Intergenic
1045433811 8:102139220-102139242 AAAACAAAACAGGTGGAAGAAGG - Intergenic
1045601728 8:103724147-103724169 AAGAACAGACACATCGAAGAGGG - Intronic
1045769494 8:105718847-105718869 AAGAAAATATATGTGAAAGAGGG - Intronic
1046520676 8:115321060-115321082 AAGAGAATAGAGCAGGAAGAAGG - Intergenic
1046647906 8:116805775-116805797 TAGAAAAGGCAGGTGGAAGAAGG - Intronic
1046766458 8:118074835-118074857 GAGAAAAAAAAGATGGATGAGGG + Intronic
1046885059 8:119357348-119357370 AAGAAAAGACAGATGGAAGAAGG - Intergenic
1046906586 8:119580375-119580397 AAGGAAACAGAGATTGAAGAAGG - Intronic
1047093751 8:121601458-121601480 AAGAAAATACTAATTGAATATGG - Intergenic
1047228964 8:122979819-122979841 ATGAAAATACAATGGGAAGATGG + Intergenic
1047329973 8:123878108-123878130 AATTAAAAACAGCTGGAAGAAGG + Intronic
1047536831 8:125727580-125727602 AAGAGAATAGAGAGGGAAGTGGG + Intergenic
1048414749 8:134213831-134213853 CAGAAAATACAGAGGACAGAGGG - Intergenic
1048680602 8:136837366-136837388 AAGAAAGAAAAGAGGGAAGAGGG - Intergenic
1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG + Intergenic
1050172836 9:2840782-2840804 AGGAAAATACAGAAGGAACCTGG - Intronic
1050409560 9:5348765-5348787 CAAAAAATAAAAATGGAAGATGG - Intergenic
1050660544 9:7878933-7878955 AAGAGATTACACATGGAAAATGG - Intronic
1050912231 9:11085810-11085832 AAAGAAATACAAATGGAGGAGGG + Intergenic
1050978460 9:11973958-11973980 AAGAAAATAAAAATGAGAGATGG + Intergenic
1051207515 9:14704047-14704069 AAGAAAAGATACATTGAAGAGGG + Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051923106 9:22290967-22290989 ATGAAGATAGAGAAGGAAGAAGG + Intergenic
1052121429 9:24722353-24722375 AAGAAAAAACAAATGGCAGCGGG + Intergenic
1052302643 9:26971486-26971508 AAGAAAACACAGAAGGAAAATGG - Intronic
1052662314 9:31449746-31449768 AAGAAAAGAGAGAGGGGAGAAGG - Intergenic
1052695735 9:31875506-31875528 AAGAAATTGCAGGTGGAAGAGGG - Intergenic
1052828029 9:33191335-33191357 AAGTAAGTTAAGATGGAAGAAGG - Intergenic
1052957461 9:34264438-34264460 AAAAAAAAAAAGAGGGAAGAAGG + Intronic
1052979209 9:34435612-34435634 AGTAAAATACATATGGAAGATGG - Intronic
1053010172 9:34628392-34628414 GTGAAAATAGAGATGGAACAGGG + Intergenic
1053523617 9:38807091-38807113 AGGAGAAGACTGATGGAAGATGG - Intergenic
1053786214 9:41654628-41654650 AAAAAAAAACAGATCGGAGAAGG + Intergenic
1054195847 9:62031508-62031530 AGGAGAAGACTGATGGAAGATGG - Intergenic
1054642561 9:67557182-67557204 AGGAGAAGACTGATGGAAGATGG + Intergenic
1054858801 9:69928843-69928865 AAGAAAACTCAGAAGGAAAATGG - Intergenic
1055101818 9:72473394-72473416 ATGGAAATACGGAAGGAAGAAGG + Intergenic
1055542433 9:77325548-77325570 AAGAGAAAACAAAGGGAAGATGG - Intronic
1055832198 9:80393536-80393558 AACAAAAAAGAGATGCAAGAAGG + Intergenic
1055983909 9:82036247-82036269 CAGAAAAAACAGATGGCAGTGGG + Intergenic
1056501319 9:87212611-87212633 AAGAAAATATACAGGGAAGGTGG - Intergenic
1056647736 9:88429551-88429573 ATGAACAGCCAGATGGAAGAAGG + Intronic
1056806583 9:89733499-89733521 AAGGAAATGAAGAGGGAAGAAGG - Intergenic
1057037873 9:91824861-91824883 AAGAAAATACAGCTGGCAAGAGG - Intronic
1057097094 9:92320901-92320923 AAGAATATACAGATAGAGGCCGG - Intronic
1057585740 9:96327220-96327242 AAGAAAAGAAAAATGGAGGATGG - Intronic
1057747331 9:97762565-97762587 TAGAAAATACAGATTTTAGAAGG - Intergenic
1058096177 9:100862716-100862738 TAGAAAAAGCAGGTGGAAGACGG + Intergenic
1058203874 9:102077424-102077446 AGAAACATACAGAGGGAAGAAGG - Intergenic
1058298748 9:103342859-103342881 CAGAAACTACAGCTGGAACATGG + Intergenic
1058415605 9:104785485-104785507 AAGATAATGAAGATGGAAGCTGG + Exonic
1059103843 9:111494572-111494594 AAAAAAAAAAAAATGGAAGAAGG - Intergenic
1059150584 9:111946244-111946266 AAGAAAATAAGGATGCAAGGAGG + Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059370018 9:113822641-113822663 TAGAAGAAAAAGATGGAAGAAGG + Intergenic
1059403642 9:114086434-114086456 AAGAAGATAGAAATGGAAAAAGG + Intronic
1059572997 9:115460391-115460413 TAGAAAATACAGAAGAAATAAGG + Intergenic
1059684763 9:116624491-116624513 ATGAGAATACAGAAGGAAGGGGG + Intronic
1059803519 9:117774149-117774171 AAGAAAATAGGGAGAGAAGAAGG - Intergenic
1059951859 9:119472937-119472959 AAGAAAATACAGAAAGCAGCTGG + Intergenic
1060104945 9:120867851-120867873 AAGGAACCACAGATGTAAGAGGG - Intronic
1060922599 9:127432709-127432731 AAGAATAAAGATATGGAAGATGG - Intronic
1060954306 9:127627467-127627489 AAGAAAAAAGACATGGAAAAAGG - Intronic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1062679535 9:137771184-137771206 AAAAAAAAAGACATGGAAGATGG - Intronic
1185648055 X:1629060-1629082 AAGAAAGGAAAGAAGGAAGAAGG - Intronic
1185805194 X:3050587-3050609 AGGAAAGTACACTTGGAAGATGG + Intronic
1185857257 X:3547322-3547344 AGCAAAATACAAATGGAAGTAGG - Intergenic
1185875711 X:3700563-3700585 AAGAAAAAAGAGAAAGAAGAAGG - Intronic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1186035740 X:5421680-5421702 AGCAAAATACACTTGGAAGAGGG + Intergenic
1186107142 X:6219632-6219654 AAGAAAGGACGGAAGGAAGAAGG - Intronic
1186189115 X:7052014-7052036 AAGAAAATGCAGAGGGACAAAGG - Intronic
1186240325 X:7558555-7558577 AAGAAAATACATGGGGAATATGG - Intergenic
1186323419 X:8453566-8453588 AAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1186490751 X:9970337-9970359 AAGAAGAGAAAGAGGGAAGAAGG - Intergenic
1186494634 X:10002423-10002445 AAGAAAAGAGAGAGGGAGGAAGG + Intergenic
1186642613 X:11472358-11472380 AAGAAAATAAAATTGGATGATGG + Intronic
1186730950 X:12408885-12408907 AAGAAAAGAAAGATAGAAAAAGG - Intronic
1186907821 X:14130888-14130910 TAGAATCTTCAGATGGAAGATGG - Intergenic
1186911096 X:14167257-14167279 AATAAAATACAGACTGAAAATGG - Intergenic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1187443055 X:19337233-19337255 AAAATAATACATTTGGAAGAAGG + Intergenic
1187805554 X:23115748-23115770 AGGAAAATACAGATTTAAGTTGG + Intergenic
1187925643 X:24247722-24247744 AAGAATAGCCAGTTGGAAGATGG - Intergenic
1187944412 X:24412350-24412372 ACCTAAATACAGATGGAGGAGGG + Intergenic
1188197503 X:27255547-27255569 AAGAAAACAAAGATGGACAAAGG - Intergenic
1188250017 X:27881827-27881849 AAGAAAATACTGCAGGAAAAAGG - Intergenic
1188284497 X:28311590-28311612 AATAAATTACACTTGGAAGAGGG + Intergenic
1188294723 X:28433322-28433344 AACAAAATTCAGATGTAGGATGG + Intergenic
1188713784 X:33434924-33434946 AAGAATATAAAGAGGGAAAACGG + Intergenic
1188989788 X:36803481-36803503 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1189129208 X:38480739-38480761 AAGGAAATACAGATCTCAGAAGG - Intronic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1189665698 X:43352311-43352333 ACCACAATACAGATGGAAAAAGG - Intergenic
1190047515 X:47124604-47124626 AAGAAAAGAAAGAAAGAAGAAGG + Intergenic
1190406251 X:50090634-50090656 AGGAAAAAACAAATTGAAGATGG - Intronic
1190717470 X:53115788-53115810 AAGAAAAGATACATTGAAGAGGG - Intergenic
1190968381 X:55323930-55323952 AAGAAAAGACACATTGAAGAGGG - Intergenic
1191607417 X:63077909-63077931 AATAAAGTACACTTGGAAGAGGG - Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191665660 X:63700057-63700079 AAGAAAATGCAGCTATAAGAAGG + Intronic
1191679775 X:63829232-63829254 AAGTAAAAACACATGGAAGTGGG - Intergenic
1191733239 X:64361062-64361084 AACAAAATACAGAATGAAAAAGG + Intronic
1191881072 X:65844181-65844203 AAGAAGATAGAAATGGAACAGGG + Intergenic
1191956839 X:66651553-66651575 AAGAAAAGACACATCAAAGAGGG + Intergenic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1192249821 X:69402553-69402575 TACAAAATACAACTGGAAGAAGG - Intergenic
1192252656 X:69425630-69425652 ATGAAGATACAGATTGGAGAGGG - Intergenic
1193507217 X:82359716-82359738 AAGAAAATAAAGATAGATGCTGG - Intergenic
1193563574 X:83049991-83050013 TAGAAAAGGCAGGTGGAAGAAGG - Intergenic
1193596869 X:83457451-83457473 GAGAAAATAAATATTGAAGAAGG + Intergenic
1193757860 X:85430471-85430493 AAGAAAAGAGGGAGGGAAGAAGG - Intergenic
1194190290 X:90826863-90826885 AAGACATTACAGGTAGAAGATGG - Intergenic
1194215430 X:91124732-91124754 AAGGAAATACACCTGGAAGAGGG - Intergenic
1194721628 X:97346988-97347010 AAGGAAACAGAGAAGGAAGAAGG - Intronic
1194778989 X:97999690-97999712 TCGAGAATACAGATGTAAGAGGG - Intergenic
1194850747 X:98865480-98865502 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1195559509 X:106267554-106267576 AAAAAAATACAGGTTAAAGAAGG + Intergenic
1195562452 X:106298785-106298807 AAAAAAATACAGGTTAAAGAAGG - Intergenic
1195574554 X:106435417-106435439 AAGGAAAGACAAATGTAAGATGG + Intergenic
1195710069 X:107766508-107766530 AAGCAGATACAAAAGGAAGAGGG + Intronic
1195858061 X:109351970-109351992 GAGAAAGTACAAATGAAAGAAGG - Intergenic
1196068120 X:111488228-111488250 AAGGAAAGAAGGATGGAAGAAGG - Intergenic
1196366115 X:114926124-114926146 AAGAAAGTACACTTGGAAGAGGG - Intergenic
1196588431 X:117458162-117458184 AAGAAAAGATACATTGAAGAGGG + Intergenic
1196589353 X:117467595-117467617 AAAAACATACAGTGGGAAGATGG - Intergenic
1197010133 X:121550929-121550951 AAGAAATCATAGATGGAAGGTGG + Intergenic
1197164433 X:123360969-123360991 CAGAAAATAATGATGGAAGGGGG + Intronic
1197605139 X:128576545-128576567 AAGAACCCACAGATGAAAGATGG - Intergenic
1197633269 X:128886599-128886621 TAGAAAAAGCAGGTGGAAGAAGG - Intergenic
1197816275 X:130501834-130501856 GGGAGAAGACAGATGGAAGAAGG - Intergenic
1198583436 X:138093403-138093425 AAGAAAATACAGTTTCAAAAAGG - Intergenic
1198967486 X:142243707-142243729 GAGAAAAGACACATCGAAGATGG + Intergenic
1198991179 X:142516186-142516208 GAGAAAGTACAGAAGAAAGAGGG - Intergenic
1199179517 X:144836804-144836826 AAAATAACACAGATGGAGGAGGG + Intergenic
1199479655 X:148284133-148284155 TCCAAAATACATATGGAAGAAGG - Intergenic
1200023274 X:153230028-153230050 TTGAAAATACAAAAGGAAGAAGG - Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200768893 Y:7105500-7105522 AAGAGAATAATCATGGAAGAAGG + Intergenic
1201259195 Y:12141295-12141317 AAGAAAATACAGATTAAGGATGG + Intergenic
1201276071 Y:12300017-12300039 AGGAAAGTACACTTGGAAGACGG - Intergenic
1201416704 Y:13754421-13754443 AAAAAAAAAAAGAAGGAAGATGG + Intergenic
1201517668 Y:14835446-14835468 AAGGAAAGAAAGAGGGAAGAGGG + Intronic
1201697389 Y:16840952-16840974 AAGGAAAAATAGAAGGAAGAAGG + Intergenic
1202075291 Y:21031487-21031509 AAAAAAAGAAAAATGGAAGAGGG + Intergenic
1202332211 Y:23766687-23766709 ATGAAAATATAGATGAAAGACGG + Intergenic
1202340576 Y:23860670-23860692 AAGAAAGTACAAATTGAACATGG - Intergenic
1202349918 Y:23978401-23978423 AAGAAAAGAAAGAAAGAAGAGGG + Intergenic
1202520861 Y:25691720-25691742 AAGAAAAGAAAGAAAGAAGAGGG - Intergenic
1202530190 Y:25809412-25809434 AAGAAAGTACAAATTGAACATGG + Intergenic
1202538558 Y:25903376-25903398 ATGAAAATATAGATGAAAGACGG - Intergenic