ID: 1140846958

View in Genome Browser
Species Human (GRCh38)
Location 16:78899581-78899603
Sequence GGCCAATGTTCCCGTTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140846958_1140846962 24 Left 1140846958 16:78899581-78899603 CCTGAACAACGGGAACATTGGCC 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1140846962 16:78899628-78899650 TAAAAGATATGATGACTAGTTGG 0: 1
1: 0
2: 0
3: 11
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140846958 Original CRISPR GGCCAATGTTCCCGTTGTTC AGG (reversed) Intronic
909473824 1:76059613-76059635 GGACAGTGTTCCCTTTGTTAGGG + Intergenic
909566013 1:77054349-77054371 GTCCAATATTCCTGTTGTCCTGG - Intronic
915121763 1:153633871-153633893 GGCCAATGGTCCTGTTGTTGGGG - Intronic
1062834737 10:628306-628328 GGCCAATGGTCTCGTTCTTCAGG - Intronic
1067247778 10:44560710-44560732 AGCCAATGTTCACCTTGTTCTGG - Intergenic
1088982762 11:114878454-114878476 TGCCATTCTTCCAGTTGTTCTGG - Intergenic
1095523495 12:43096348-43096370 GGGCAATGGTCCCGTTGTCCTGG + Intergenic
1096272245 12:50174631-50174653 GGCAACTGTTCCAATTGTTCAGG - Intergenic
1098244943 12:68507264-68507286 GTCCAAAGTTACCATTGTTCAGG - Intergenic
1103742148 12:123098149-123098171 GGCCCATGATTCCGTTGTACAGG - Intronic
1106430668 13:29677412-29677434 GGCTAATGTTCTCATTTTTCTGG + Intergenic
1108305891 13:49132210-49132232 GGCCATTGTTGCAGTTGTCCTGG - Intronic
1108813103 13:54254332-54254354 GGCCCCTGTTCCCTTTGGTCAGG - Intergenic
1119313159 14:73667827-73667849 GTCCATTTTTCCAGTTGTTCAGG + Intronic
1133859028 16:9576654-9576676 GGAGAATGTTGCTGTTGTTCGGG + Intergenic
1138589427 16:57991655-57991677 GGCCATTGTTCCCGGCTTTCTGG + Intergenic
1140846958 16:78899581-78899603 GGCCAATGTTCCCGTTGTTCAGG - Intronic
1148132516 17:45270649-45270671 GGCCCCTGTTCCCGCTGTGCTGG + Intronic
1152428908 17:80236556-80236578 GGCCATTGTTTCTGTTGTTTGGG + Intronic
1162248386 19:9422286-9422308 TGCCAATGTTCCCCTTGACCTGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164573838 19:29393707-29393729 GGCCACTGTCCCCTCTGTTCAGG - Intergenic
928427100 2:31188407-31188429 GGCCAATCTTCCCCTTCTCCTGG + Intronic
930722356 2:54649644-54649666 GCCCAATGTTCCCGGTGTCTCGG - Exonic
935170103 2:100604231-100604253 GACAAATGTTCCCATTGTGCTGG + Intergenic
946019263 2:216629401-216629423 GGCCAATGTTCTTCTTGATCTGG + Intergenic
946338565 2:219054624-219054646 GGCCAATGTGACCGTAGTGCCGG - Exonic
948453914 2:238095656-238095678 TGTCAACGTTCCCCTTGTTCTGG + Intronic
1170890616 20:20372354-20372376 GGCCAATCTTCCAGTTTTTAAGG - Intergenic
1171484731 20:25478544-25478566 GGCCATCTTTCCCATTGTTCAGG + Intronic
1172019806 20:31906108-31906130 GGCCATTGTTCCAGTTGCTATGG + Intronic
1179130338 21:38630602-38630624 GGGCAATGTTGACTTTGTTCTGG + Intronic
1183257783 22:36773795-36773817 GGCAAATGTTCTCATTTTTCTGG + Intronic
1183655568 22:39182691-39182713 GTCCAATGTGCCCATTTTTCAGG - Intergenic
952274577 3:31864963-31864985 GGCCTATGTTCCTGTTGCACAGG + Intronic
952625282 3:35395399-35395421 GGCCACTGCTCCTGTAGTTCAGG - Intergenic
956149106 3:66222477-66222499 GGCCAATGTTACCGCTTTTAAGG + Intronic
957302265 3:78407605-78407627 TGCCAATGTTACCGTTTTACTGG - Intergenic
957978275 3:87474772-87474794 GGCCTATATCCCCTTTGTTCTGG + Intergenic
960240876 3:115340367-115340389 GGCCAATCATCCCCTTGTGCTGG - Intergenic
966545807 3:181146274-181146296 GCCCAATGTTCCTGTTGGTATGG + Intergenic
982564580 4:156971637-156971659 GACCAAAGTTCACCTTGTTCGGG + Intergenic
985481292 5:112603-112625 GGCCAATGATCCTGTTTTTAGGG + Intergenic
986231056 5:5865040-5865062 GGCCAGTGTTGCCTTTGATCTGG - Intergenic
987204677 5:15612842-15612864 AGCCAATGTTCTCTTTGTTTTGG - Intronic
987744056 5:21947835-21947857 GGCCTATGGCCCCGTTGCTCTGG + Intronic
996590434 5:125140772-125140794 TGCCAATGTTCACCATGTTCTGG + Intergenic
1005901976 6:30224562-30224584 GGCAAATGTCTCAGTTGTTCAGG - Intergenic
1012303344 6:97618250-97618272 GGCCAATTTTACTGTTGTTGAGG + Intergenic
1013820126 6:114144929-114144951 GGCCAAGGCTCCCACTGTTCAGG - Intronic
1013950218 6:115771190-115771212 GGCCAGTGTGACAGTTGTTCTGG + Intergenic
1018450354 6:163901610-163901632 GGCCTGTCTTCCCTTTGTTCTGG + Intergenic
1027591160 7:80120664-80120686 TGACAATGTTCCTGTTGTTCGGG - Intergenic
1031703876 7:124958767-124958789 GGCCTATGGTCCCTTTGTTTTGG + Intergenic
1043690653 8:83146827-83146849 GGCTAATTTTCCCATTGGTCAGG - Intergenic
1059448629 9:114356118-114356140 GGCTAATGTTCCTGCTGTGCTGG + Exonic
1061200179 9:129133388-129133410 GGCCCAGGCTCCCATTGTTCAGG - Intronic
1188055969 X:25541621-25541643 GGCCTATGGTCCCTTTGTTTTGG - Intergenic
1190529356 X:51359885-51359907 GGACAATGTTCCCTTGGTTATGG - Intergenic
1197710763 X:129665646-129665668 GGCCAATGTAACCATTCTTCTGG + Intergenic
1199894383 X:152117198-152117220 GGCAAAGGTCCCCATTGTTCTGG + Intergenic