ID: 1140848911

View in Genome Browser
Species Human (GRCh38)
Location 16:78916101-78916123
Sequence TGTGCGGGAGTACACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140848911 Original CRISPR TGTGCGGGAGTACACTGTGC TGG (reversed) Intronic
900187880 1:1341015-1341037 TGTGCAGGGGTGCATTGTGCAGG - Intronic
900618616 1:3576859-3576881 TGTGCGGGGGTGGAGTGTGCAGG - Intronic
900677214 1:3895136-3895158 TGTGCTGGAGTATGCTGTGTGGG + Intronic
902222529 1:14976094-14976116 TGTGCGGCTGTGCAGTGTGCGGG - Intronic
905217159 1:36416925-36416947 TGGGCGGGAGCAGACTTTGCAGG - Intronic
906139909 1:43527975-43527997 TGTGTGTGAGGACCCTGTGCTGG + Intronic
917318637 1:173756017-173756039 TGTGGGGAAGTACTCTTTGCAGG + Exonic
921531497 1:216287424-216287446 TATGCTGGAGTACACTGCACTGG + Intronic
921661979 1:217814414-217814436 TGTGCAGCTGTACACTGTGGTGG + Intronic
922897057 1:229108689-229108711 GGTGCTGGTGTGCACTGTGCAGG - Intergenic
1065473848 10:26112553-26112575 TGTGCTGCAGTAAACTGTGAAGG - Intronic
1067247298 10:44557595-44557617 TGGGAGGGAGCAAACTGTGCAGG - Intergenic
1069963507 10:72094017-72094039 TGTGCTGGAGCTCACTGTCCTGG - Intergenic
1075778742 10:125003771-125003793 TGTGCTGGACTAGCCTGTGCTGG - Intronic
1084573538 11:69974637-69974659 TGTGGGGAGGTACACTGAGCAGG - Intergenic
1102247171 12:111362878-111362900 TGGGCGGGAGGGCACTGGGCCGG + Exonic
1103587816 12:121969145-121969167 TGGCAGGGGGTACACTGTGCTGG - Intronic
1106366886 13:29090391-29090413 TGTGGGAGAGTTCACTGTGCTGG + Intronic
1107295135 13:38899820-38899842 TGTGTGGGAGGGCTCTGTGCAGG - Intergenic
1108712644 13:53048993-53049015 TCAGCGGGAGTACAATGTGAAGG + Intronic
1111866177 13:93771450-93771472 TGTCGGGGAGTGCACTCTGCAGG + Intronic
1113537034 13:111076260-111076282 AGTGCCTGAGAACACTGTGCTGG - Intergenic
1114696214 14:24630203-24630225 TGTATGGGAGGACACTGGGCTGG + Intergenic
1114874835 14:26702955-26702977 TATGCAGGATTACACTGAGCTGG - Intergenic
1122076050 14:99235224-99235246 TGGTCTGGAATACACTGTGCAGG + Intronic
1132570090 16:640791-640813 TGTGCTGGGGGACTCTGTGCTGG - Intronic
1132570339 16:641502-641524 TGTGCTGGAGGTCTCTGTGCTGG - Intronic
1134800230 16:17077390-17077412 TGTGCGGGAGAATACTGGGAGGG + Intergenic
1140848911 16:78916101-78916123 TGTGCGGGAGTACACTGTGCTGG - Intronic
1144082568 17:11778108-11778130 TATGAGGGAGCAAACTGTGCTGG + Intronic
1145866008 17:28242094-28242116 TGTGATGGAGGACACAGTGCAGG + Intergenic
1147349967 17:39834887-39834909 TGTGGAGGAGGCCACTGTGCAGG - Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1152612503 17:81322696-81322718 TGTGCGGGGGGACTCAGTGCCGG - Intronic
1152903678 17:82958959-82958981 TGTGTGTGTGTACACTGTGGGGG + Intronic
1153478072 18:5518335-5518357 TGTGAGGGAGTACACGGGGTGGG - Intronic
1154220518 18:12449573-12449595 CGTGCGCGAGGACACTGAGCCGG - Exonic
1155009521 18:21761966-21761988 TGGGTGGGAGTACACGGTGGGGG + Intronic
1162784291 19:13024576-13024598 TGTGCAGACGGACACTGTGCCGG + Intronic
929883927 2:45861990-45862012 TGTGTGTGTGTACACTATGCTGG - Intronic
931014475 2:57960630-57960652 TGTGTGGGAGTTCACTGTTCTGG - Intronic
938324619 2:130390399-130390421 TGGGTGGGAGGACACTGTGAGGG - Intergenic
938576746 2:132611162-132611184 TCTGGGGGAGAACACAGTGCAGG + Intronic
944772269 2:202926151-202926173 TGTGGGGGAGGCAACTGTGCAGG + Intronic
1169205661 20:3739153-3739175 TGTACGGGAGTATAGTCTGCAGG + Intronic
1169205681 20:3739336-3739358 TGTACGGGAGTATAGTCTGCAGG + Intronic
1170611236 20:17915262-17915284 TGGGAGGAAGGACACTGTGCTGG + Intergenic
1177770691 21:25512444-25512466 TGTGCAGAAGTCCCCTGTGCAGG + Intergenic
1179035761 21:37757668-37757690 TGTGAGGGAGTACTCTCTCCAGG - Intronic
1179925445 21:44531679-44531701 TGGGCTGGAGGACCCTGTGCAGG - Intronic
1181129365 22:20721388-20721410 TGTGCGGGAGTATATTCTGTGGG - Exonic
1184831630 22:46992450-46992472 TCGGCGGGCCTACACTGTGCAGG - Intronic
950502320 3:13372351-13372373 TGTGCTGAAGTGCACTGTGCAGG + Intronic
961516768 3:127442829-127442851 TGGGCTGGAGTACACAGTGTGGG + Intergenic
961671391 3:128534174-128534196 TGTGTGGCATTACACTGTTCAGG + Intergenic
964204894 3:154162702-154162724 TGTGTGAGAGTGCACTGTGATGG + Intronic
973264050 4:48193459-48193481 TGTGCAGCAGTACACTTTGATGG - Intronic
979005461 4:115289589-115289611 GGTGAGGAAGTACACTGTGATGG + Intergenic
985299935 4:188477743-188477765 TGTGCAGGAGTCCACTGTCACGG - Intergenic
985574283 5:666361-666383 TGTGCGGGTCTGCACTCTGCTGG + Intronic
985702389 5:1381431-1381453 TGTGTGGGTGTGCACAGTGCAGG - Intergenic
992003464 5:72456544-72456566 TGGGCGGGAGTTCACCCTGCTGG - Exonic
992238788 5:74742961-74742983 TGTGCAAGAGTACAGTGGGCTGG - Intronic
995933072 5:117474280-117474302 TGTGCATGGGTACAGTGTGCAGG + Intergenic
1001017552 5:168155011-168155033 TGTGCGGGAGGGAGCTGTGCGGG - Intronic
1001561746 5:172674334-172674356 TGTGCAGGAGGATACTGGGCTGG - Intronic
1003052099 6:2789220-2789242 TGTGCTGGAGCACGCGGTGCTGG + Intergenic
1003054078 6:2803337-2803359 TGTGCGGGAGTACAGAGTTTAGG + Intergenic
1004290052 6:14358545-14358567 TGTGCGGGAGGACACAGGCCTGG + Intergenic
1005315591 6:24599843-24599865 TGTGGGGGAGGCCACTGTGCAGG + Intronic
1023164660 7:37331654-37331676 TGTGGAGGAGTACACAGAGCAGG - Intronic
1025007706 7:55366881-55366903 TGTGGGAGAGTAAAGTGTGCGGG + Intronic
1028709647 7:93892271-93892293 TGTGTGGGAATACACTGATCTGG - Intronic
1029129537 7:98319372-98319394 TGTGCGGGAGAGCACCGTCCGGG - Intronic
1030090354 7:105852594-105852616 TGTGCGGAAGGGCCCTGTGCAGG - Intronic
1035038724 7:155912043-155912065 TGTGCAGGAGGACATGGTGCTGG - Intergenic
1035755311 8:2026685-2026707 TGTGCTGGAGTAGACTGTCGGGG + Intergenic
1036661685 8:10713409-10713431 TGAGAGGGGGAACACTGTGCTGG + Intergenic
1042169452 8:65977873-65977895 TGTGCGGGAGCCCACTGCGGGGG + Intergenic
1044277695 8:90321617-90321639 TGGGCGGGAGAACACTGTAGGGG + Intergenic
1048289065 8:133165996-133166018 TGTGCTGGAGCAATCTGTGCTGG - Intergenic
1056094104 9:83233153-83233175 GGTGCGGGAGTTAACTGTGTGGG - Intergenic
1060426572 9:123511425-123511447 TGCACGGGACTAGACTGTGCTGG + Intronic
1061360590 9:130139546-130139568 TGTGAGGGAGCACACTGAGATGG + Exonic
1203496264 Un_GL000224v1:154402-154424 TGTTCTGGAGTCCAATGTGCGGG + Intergenic
1203508886 Un_KI270741v1:96324-96346 TGTTCTGGAGTCCAATGTGCGGG + Intergenic
1190941066 X:55041687-55041709 TGTGGGGGAGACCACTGTGTGGG - Intergenic
1192799876 X:74455750-74455772 TGTGCAGGAGTATAGTGTGTGGG + Intronic