ID: 1140852008

View in Genome Browser
Species Human (GRCh38)
Location 16:78943771-78943793
Sequence AGATTTCCCCTTCAAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140852008_1140852015 13 Left 1140852008 16:78943771-78943793 CCCACAATTTGAAGGGGAAATCT 0: 1
1: 1
2: 0
3: 12
4: 164
Right 1140852015 16:78943807-78943829 TCACTGTTTGGTGGACTAAATGG 0: 1
1: 0
2: 0
3: 11
4: 119
1140852008_1140852010 1 Left 1140852008 16:78943771-78943793 CCCACAATTTGAAGGGGAAATCT 0: 1
1: 1
2: 0
3: 12
4: 164
Right 1140852010 16:78943795-78943817 TCCCACCGCACATCACTGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 60
1140852008_1140852013 4 Left 1140852008 16:78943771-78943793 CCCACAATTTGAAGGGGAAATCT 0: 1
1: 1
2: 0
3: 12
4: 164
Right 1140852013 16:78943798-78943820 CACCGCACATCACTGTTTGGTGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140852008 Original CRISPR AGATTTCCCCTTCAAATTGT GGG (reversed) Intronic
902976951 1:20095646-20095668 AGATATCCCTTTCAAAAGGTAGG + Intergenic
904757283 1:32775020-32775042 ACATTTTCCCTTCTAAATGTGGG - Intergenic
907017739 1:51033640-51033662 AGATTTCTCCTACAAAGTGTAGG + Intergenic
908166266 1:61462389-61462411 TGTTTTCCATTTCAAATTGTAGG + Intronic
908206450 1:61855295-61855317 AGATTTCCTGTTAAAATTTTTGG - Intronic
908495589 1:64691247-64691269 AGATTTCACCTACAATTTCTAGG - Intronic
908999236 1:70198242-70198264 ATATTTCCCTTTCAAATAATTGG + Intronic
911434378 1:97837380-97837402 AGATTAGCACTTAAAATTGTTGG - Intronic
912770789 1:112462702-112462724 AGATCTTCCCTACAAATTATTGG - Intronic
915901797 1:159852304-159852326 ATATTTCCATTTCAATTTGTTGG - Intronic
916126186 1:161573594-161573616 AGAACTACCCTTCAAATTGGAGG + Intergenic
916136104 1:161655434-161655456 AGAACTACCCTTCAAATTGGAGG + Intronic
916196635 1:162229941-162229963 AGATTTTCCATTCAAATTACAGG - Intronic
918888290 1:190227342-190227364 AAATTTCCTTTGCAAATTGTTGG + Intronic
919083768 1:192896008-192896030 AGAACTCCCTTTCATATTGTGGG - Intergenic
920186848 1:204164928-204164950 GGTTTTCTCCTTCTAATTGTGGG + Intronic
921033785 1:211357008-211357030 ACATTTCCCCTACACCTTGTTGG - Intronic
921437554 1:215143350-215143372 TGATTTGCCCTTAACATTGTAGG + Intronic
1065112303 10:22452273-22452295 AGATTTACCCTTCAACTTGGTGG - Intronic
1067036079 10:42918302-42918324 ATATTTCTCCTTCAATTTATTGG + Intergenic
1068234197 10:54211618-54211640 AGAATTCTTCTTCAAAATGTAGG + Intronic
1069308825 10:67007183-67007205 AGATTTTACCTTCAAATTCTTGG + Intronic
1079541960 11:21587373-21587395 AACTTTTCCCTTCAAAGTGTGGG - Intergenic
1079791906 11:24748983-24749005 AGATTTCCATTTCTAATTGAAGG - Intronic
1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG + Intronic
1081918562 11:46750806-46750828 AGATTTCCACCTCAACTTGATGG + Intronic
1083689572 11:64399041-64399063 AGATATCCCCTCCAAAGTGAAGG + Intergenic
1087074970 11:94120361-94120383 TTATGTCCCCTTCAAGTTGTAGG + Intergenic
1088070745 11:105781427-105781449 AAATTTAGACTTCAAATTGTGGG - Intronic
1090686299 11:129125183-129125205 AAATTTCCCCTGGAAGTTGTTGG + Intronic
1091272870 11:134330359-134330381 AAATTTCCCCTTAACCTTGTGGG - Intergenic
1092905324 12:13095896-13095918 AAATTTCCTCTGCAAATTGCAGG - Intronic
1093555174 12:20464308-20464330 ATATATCCCCTTCAAAATGAGGG + Intronic
1094602854 12:31925467-31925489 AAAGTTTCCTTTCAAATTGTGGG + Intergenic
1095922265 12:47543191-47543213 AGATATCCCCTTGCAAATGTTGG + Intergenic
1098033888 12:66282572-66282594 AGATTTCACGTTAAAAATGTAGG - Intergenic
1098063554 12:66587885-66587907 AGATTTCCCCTTCAAAATGTGGG - Intronic
1098766166 12:74491987-74492009 AGATTTACCCTTCAACTTATTGG - Intergenic
1099112391 12:78577922-78577944 AGAGTTTCCCTTCATATTCTTGG + Intergenic
1100324682 12:93529775-93529797 AGACTTTCCCTTCATATCGTTGG + Intergenic
1100849482 12:98694803-98694825 ACAATTCCCATTCAACTTGTTGG - Intronic
1101228729 12:102717021-102717043 ATATTCCCTCTTCAAATTTTTGG + Intergenic
1104623456 12:130335420-130335442 AGTTTTCCTTTTCAAATTTTAGG + Intergenic
1105669705 13:22599259-22599281 AAAATACCCCTTTAAATTGTAGG + Intergenic
1107702845 13:43065757-43065779 AGATTTCTCCTGCAATTTATTGG - Intronic
1110179985 13:72605271-72605293 ATATTTCCCCTTTAGACTGTAGG - Intergenic
1111310127 13:86473245-86473267 ACATTTCCCCTTCAATTTAATGG - Intergenic
1111474860 13:88731219-88731241 ATAGTTCCTTTTCAAATTGTTGG - Intergenic
1112752854 13:102599212-102599234 ATATTTACCCTCCAAATAGTTGG - Intronic
1114561389 14:23593905-23593927 GGATTTCTTCTTCAGATTGTTGG + Intergenic
1114826794 14:26090466-26090488 AGATTTCCCCATGAGATTGGTGG + Intergenic
1115183564 14:30657464-30657486 ATATTTTCACTTCAAATAGTAGG - Intronic
1115593415 14:34886089-34886111 AGATTTCCTTTTTAAAATGTTGG - Intergenic
1115638487 14:35314516-35314538 AGATTTCCCCCACAAGTTATAGG - Intronic
1117897269 14:60500450-60500472 AGTTTTTTCCTTCAAATTATTGG - Intronic
1120679068 14:87457740-87457762 AGAGTTACCCCTCACATTGTTGG + Intergenic
1121386995 14:93537000-93537022 ATATTTTCCCTTTAAATTCTAGG + Intronic
1121807440 14:96841889-96841911 AAATTTCCCCTTCAAAGGGAAGG - Intronic
1123170801 14:106371128-106371150 GGATTTCCCCTGGAAATAGTGGG - Intergenic
1127120836 15:55770758-55770780 TGATTTCCTCCTCAAATTGATGG - Intergenic
1128121054 15:65146825-65146847 AGATGTCCCTTTTAAATTGTTGG - Intergenic
1129075020 15:72986868-72986890 AGATTTCTTTTTCAGATTGTTGG - Intergenic
1129910013 15:79219437-79219459 AGAATGCCCCTTCAATCTGTAGG + Intergenic
1130883285 15:88073206-88073228 AGAGTTTCTCTTCCAATTGTGGG - Intronic
1137511023 16:49100924-49100946 AGATTTCCCCTTCAAGATGAAGG - Intergenic
1138039098 16:53642965-53642987 GGATTTCCCTTTTAAATTGTTGG - Intronic
1140033366 16:71355661-71355683 AGAAATCCCCTTCAGGTTGTGGG - Intergenic
1140285618 16:73600071-73600093 AGAATTCCCTTACAAAATGTTGG - Intergenic
1140746376 16:77983897-77983919 GGATCTTCCTTTCAAATTGTAGG + Intergenic
1140852008 16:78943771-78943793 AGATTTCCCCTTCAAATTGTGGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155244046 18:23890436-23890458 AGATCTCCCTTTGATATTGTAGG + Intronic
1156631969 18:38980822-38980844 ACTTTTCCACTTCAAATTGATGG - Intergenic
1157857931 18:51118322-51118344 TTATGTCCCCTTCAAACTGTAGG - Intergenic
1158616134 18:58988859-58988881 AAATTTCCTCTTGAAATTTTTGG + Intergenic
1158763308 18:60416129-60416151 AGCTTTCCCTTTAAAATTTTTGG + Intergenic
1159268883 18:66122724-66122746 AGATTTCCTTTTCCAATTTTGGG + Intergenic
1159536694 18:69724081-69724103 CCATCTCCCCTTCAATTTGTAGG + Intronic
1160139331 18:76306906-76306928 AGATCTTCCCTTCAGATTTTTGG + Intergenic
1166136440 19:40780017-40780039 AGACTTCCTCTTCAAATTCCTGG + Exonic
1166531900 19:43547901-43547923 AGATTTTCCCCTTAAATGGTGGG - Intronic
925468587 2:4134701-4134723 CCATTTCCCCTTAAAATTGTGGG + Intergenic
928105788 2:28469891-28469913 ACATTTCCCATTCTATTTGTGGG - Intronic
934172635 2:89553306-89553328 AGAATTACCCTTCCATTTGTGGG - Intergenic
934282948 2:91627658-91627680 AGAATTACCCTTCCATTTGTGGG - Intergenic
934920926 2:98344808-98344830 TGTTTTCCCCTTCAAATCTTAGG + Intronic
935138372 2:100328496-100328518 AAAATTCCCATTCAAACTGTTGG - Intergenic
939023763 2:136987931-136987953 AAATTTCCCCTTGAAACTGAAGG + Intronic
941492817 2:166163450-166163472 AGAGTTCTCCATGAAATTGTCGG + Intergenic
942074750 2:172347011-172347033 TGATATCCCATTCAAATTCTTGG + Intergenic
943251830 2:185531946-185531968 AAATTTCCACATTAAATTGTGGG - Intergenic
947059810 2:226151066-226151088 TGAATTAACCTTCAAATTGTTGG + Intergenic
1169092276 20:2868278-2868300 CTATTTCCCCTTGAAATTGGTGG - Intronic
1170083383 20:12501717-12501739 AGATTTTTCCTTCAACTTGAAGG - Intergenic
1170354341 20:15475805-15475827 AGAATTACCCTTCAGATGGTAGG - Intronic
1170650508 20:18236093-18236115 AAATTTCCTTTTCAGATTGTTGG + Intergenic
1172172553 20:32948391-32948413 TTATTTCCCCTTCAAATATTTGG - Intronic
1174620913 20:51873946-51873968 AGATTTCCCCACCAAATTCAGGG + Intergenic
1174814736 20:53676981-53677003 ATTTTTCCCTTTCAAATTCTTGG + Intergenic
1179105170 21:38393619-38393641 AGATTGACCCATCAAATTGCTGG - Intronic
1180918931 22:19508488-19508510 AGCTGTCACCCTCAAATTGTGGG - Intronic
952059138 3:29485837-29485859 AGATTTCTGCTTCCAATGGTGGG + Intronic
956514804 3:70034889-70034911 AGATTTCCTCTTAATAGTGTAGG - Intergenic
958843538 3:99238113-99238135 AGAATTCCCCTTCAAAATAATGG + Intergenic
964835145 3:160929923-160929945 ACATATCCCCTCCAAACTGTAGG + Intronic
965657745 3:171006890-171006912 ACTTTTCCCCTTGGAATTGTTGG - Intronic
967071477 3:185966195-185966217 ATTTTTCCCCTTCTAATTCTGGG + Intergenic
969120656 4:4908147-4908169 TGATTTCTCTTTCAGATTGTTGG - Intergenic
972779192 4:42271216-42271238 AGATTTCCCTTTCAAACCTTAGG - Intergenic
974537082 4:63186807-63186829 TTATGTCCCCTTCAAGTTGTAGG + Intergenic
977025486 4:91813553-91813575 AGATTTTCACTTACAATTGTAGG - Intergenic
977434666 4:96978779-96978801 TGATTTCCCCATCAAAAAGTGGG + Intergenic
977461473 4:97331309-97331331 AGATTCCACCTTCAGCTTGTTGG + Intronic
978634404 4:110786685-110786707 AGACTTCCTCCTAAAATTGTAGG - Intergenic
979016059 4:115435240-115435262 ATCTTTTCCCTTCAAGTTGTAGG - Intergenic
979102443 4:116637036-116637058 GGATTTCCTCTTTAAATTGAAGG - Intergenic
980059047 4:128109210-128109232 CTATTTCCACTTCAAATTTTTGG - Intronic
981970099 4:150657460-150657482 AGATTTACACCTCAAATTATAGG + Intronic
984470532 4:180166223-180166245 AGATTTCACATTCTATTTGTTGG - Intergenic
985977944 5:3436333-3436355 AGCTTTTCCCTTCAAAATTTGGG - Intergenic
987592569 5:19949805-19949827 AGATTCCTGCATCAAATTGTAGG - Intronic
991042469 5:62190235-62190257 AGGCTTCCCCTCCAACTTGTGGG - Intergenic
991074651 5:62521360-62521382 AGGTTTCCCCCTCAAAATTTTGG + Intronic
991172339 5:63642983-63643005 CAATTTCCCCTCCAAATTTTGGG - Intergenic
993013939 5:82514360-82514382 AGATTTGCATTTCAATTTGTGGG + Intergenic
993872562 5:93269313-93269335 ATGTGTCCCCTTCACATTGTTGG + Intergenic
995918646 5:117282402-117282424 ATATTTCCCTTTGAAAATGTTGG + Intergenic
996673533 5:126148461-126148483 TGATTTCCCCTTCATAGTGGAGG - Intergenic
999813807 5:155155371-155155393 AGATTGTCCCTTCAAGTGGTTGG - Intergenic
999921353 5:156324901-156324923 AGATTTCTTCCTCAACTTGTGGG + Intronic
1000358537 5:160424907-160424929 TGACTTTCCCTTCAAATTATGGG - Intronic
1001880833 5:175242725-175242747 ATGTTTCTCCTGCAAATTGTTGG - Intergenic
1007872209 6:45053382-45053404 AGATTTCCATTTTAAATTTTTGG - Intronic
1010763597 6:79752741-79752763 AGAATTTCCCTACAAATAGTAGG + Intergenic
1014544535 6:122717923-122717945 AGATTTGCCCCTCAAACTGGAGG + Exonic
1014984332 6:127983850-127983872 AGATTTCCCGTTTAAAGTTTTGG - Intronic
1018092982 6:160361904-160361926 AGCTTTCCCCTTCTAATACTAGG + Intronic
1021756789 7:23859897-23859919 TTATGTCCCCTTCAAGTTGTAGG - Intergenic
1021940551 7:25674722-25674744 AGTTTTTGCCTTAAAATTGTGGG + Intergenic
1022000921 7:26225346-26225368 AGATTTCCCAGTCAACTAGTAGG + Intergenic
1023222800 7:37937430-37937452 AAATTTCCCCTGCCATTTGTTGG - Intronic
1024502148 7:50121539-50121561 AGAGTTCCACTACAAAATGTGGG - Intronic
1024836740 7:53529299-53529321 AGGTTACCTCTTCACATTGTTGG + Intergenic
1026479475 7:70765477-70765499 AGATCTGCCCTTAAAATTCTGGG - Intronic
1028427048 7:90701218-90701240 AGATACCACCTACAAATTGTTGG - Intronic
1028770866 7:94619417-94619439 GGAATTCCACTTCACATTGTTGG + Intronic
1031815202 7:126425205-126425227 AAATATCCCTTTCAAAATGTGGG - Intergenic
1034580042 7:152034098-152034120 TTATGTCCCCTTCAAGTTGTAGG - Intronic
1036473855 8:9075553-9075575 AGATTTCCACTTCTAATAATAGG - Intronic
1039655836 8:39404795-39404817 AGATTTTCCCTACCAAATGTTGG + Intergenic
1041161351 8:55047908-55047930 TTATTTCCCCTTCAATTTATTGG - Intergenic
1044456696 8:92398708-92398730 TTATGTCCCCTTCAAACTGTAGG - Intergenic
1050311448 9:4357286-4357308 AGATTGCCCCTCCCAAGTGTGGG + Intergenic
1050382991 9:5050657-5050679 AGATATTTCCTTCAAATTTTTGG + Intronic
1050822038 9:9890764-9890786 TGCTTTCCCCTTCCAATTGGTGG - Intronic
1057920117 9:99090402-99090424 ACATTTCCCTGTCAAATTCTTGG + Intergenic
1058212694 9:102190470-102190492 CGATTTCAGCTTCAAAATGTAGG - Intergenic
1058310453 9:103495397-103495419 AGAAGTCTCCTTCAAATTGTTGG - Intergenic
1058691933 9:107527442-107527464 AGATGCCCCCTTGAAATAGTGGG + Intergenic
1185636025 X:1552699-1552721 AGGTTTCCCCTACAGTTTGTGGG + Intergenic
1186668832 X:11748356-11748378 AGACTTCCCACTAAAATTGTTGG - Intergenic
1186880079 X:13856352-13856374 AGCTTTCCCATTCAAAGTGTGGG + Intronic
1188556093 X:31413881-31413903 AGTTTTCACCTTAATATTGTAGG - Intronic
1188725170 X:33573991-33574013 AGCTTTCCCCATTACATTGTAGG - Intergenic
1189739594 X:44104226-44104248 AGATGAGCTCTTCAAATTGTTGG - Intergenic
1189928390 X:45981955-45981977 AGATTTCACCTTTTAGTTGTAGG - Intergenic
1190578536 X:51867571-51867593 AGATATACCCTTCAACTGGTGGG - Intronic
1191608501 X:63086593-63086615 AGTTTTCCCCTTTTAATTTTGGG - Intergenic
1192825069 X:74687209-74687231 TGATTTCCTTTTCAGATTGTTGG + Intergenic
1194146830 X:90276555-90276577 ATTTTTTCCCTTCAAATTTTGGG + Intergenic
1194455836 X:94101970-94101992 AGATTTTGCCTTAAAATTGTGGG - Intergenic
1196557839 X:117111389-117111411 GTATTTCCTCTTCAAATTTTTGG - Intergenic
1196849940 X:119927717-119927739 AGATTTCCCCTACAAATAGGAGG - Intronic
1197281081 X:124536803-124536825 AGTTTTTCCCTTAAAATTTTTGG + Intronic
1197643808 X:128995548-128995570 ACATTTCCCTTTCAATGTGTTGG - Intergenic
1198738882 X:139819538-139819560 AGATTTCAGTTTCAAAGTGTTGG - Intronic
1199242612 X:145565273-145565295 AAATTTCACCTTCAAAGGGTAGG - Intergenic
1200493236 Y:3853321-3853343 ATTTTTTCCCTTCAAATTTTGGG + Intergenic