ID: 1140852390

View in Genome Browser
Species Human (GRCh38)
Location 16:78947348-78947370
Sequence GAAAAATAACAAATGCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1538
Summary {0: 1, 1: 0, 2: 4, 3: 108, 4: 1425}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140852390_1140852398 21 Left 1140852390 16:78947348-78947370 CCTAGCTGCATTTGTTATTTTTC 0: 1
1: 0
2: 4
3: 108
4: 1425
Right 1140852398 16:78947392-78947414 CCCTGCATTTATTACAGCGCAGG 0: 1
1: 0
2: 1
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140852390 Original CRISPR GAAAAATAACAAATGCAGCT AGG (reversed) Intronic
900632146 1:3642744-3642766 AAAAAAAAAAAAATGCTGCTGGG + Intronic
901037938 1:6347467-6347489 TAAAAATAACAACAGCAGCTGGG + Intronic
901087238 1:6618550-6618572 GAAATATACTGAATGCAGCTGGG - Intronic
901304189 1:8220682-8220704 GAAAAATAAAAAAATTAGCTGGG + Intergenic
901410829 1:9082883-9082905 AAAAAAAAAAAAATGCAGATTGG + Intronic
901434281 1:9236675-9236697 AAAAAAAAAAAAAAGCAGCTAGG + Intronic
901617913 1:10556398-10556420 GAAAAAGAACACGTGCAGATAGG - Intronic
901675941 1:10884939-10884961 AAAAAATAAAAAATCAAGCTAGG - Intergenic
901705504 1:11070074-11070096 AAAAAGAAACAAATGTAGCTGGG + Intronic
901712077 1:11123627-11123649 AAAAAATAAAAAAATCAGCTGGG - Intronic
901846634 1:11987145-11987167 GAAAAATAAAAAAATTAGCTGGG + Intronic
901942373 1:12673095-12673117 GAAAAACACCAAATGCACGTGGG + Intergenic
902284276 1:15396511-15396533 AAAAAATAACAAAACCAGCCGGG + Intronic
903280370 1:22246704-22246726 ACAAAATAACAAATGCACATTGG - Intergenic
903348113 1:22700698-22700720 TAAAAATACCAAATTTAGCTGGG + Intergenic
903373115 1:22849762-22849784 GAAAAAAAACAACTTCTGCTAGG + Intronic
903628692 1:24749659-24749681 CAAAAGTAAAAAAGGCAGCTGGG + Intronic
904085117 1:27900823-27900845 TAAAAATAAAAAATTTAGCTGGG - Intronic
904180933 1:28666219-28666241 GAAAAATACAAAAAGGAGCTGGG + Intergenic
904443381 1:30547736-30547758 GAAAAATAGCTAATGCATATTGG + Intergenic
904650326 1:32000814-32000836 TAAAAATACAAAATGTAGCTGGG - Intergenic
904803371 1:33113261-33113283 AAAAAATAATAAAACCAGCTGGG - Intronic
905125023 1:35710138-35710160 GAAAAATATAAAAATCAGCTGGG - Intergenic
905624409 1:39478161-39478183 TAAAAATAAAAAATTTAGCTGGG - Intronic
905778851 1:40689950-40689972 GCAGAATTAGAAATGCAGCTAGG - Intergenic
905822165 1:41001749-41001771 CAAAAACAACAAAACCAGCTGGG + Intronic
906098452 1:43240180-43240202 GAAGAATGACAAGTCCAGCTTGG + Intronic
906183941 1:43845648-43845670 AAAAAATAAAAAATGAAGATAGG - Intronic
906288451 1:44603573-44603595 TAAAAATGACAAATTCATCTTGG + Intronic
906406861 1:45549173-45549195 AAAAAAAAAAAAATTCAGCTAGG - Intergenic
906983505 1:50657049-50657071 AAAAAATAACAAAATTAGCTAGG + Intronic
906988319 1:50710900-50710922 AAAAAAAAACAAATGCCACTTGG - Intronic
907023129 1:51087802-51087824 TAAAAATACAAAAAGCAGCTGGG - Intergenic
907756595 1:57316633-57316655 GAAAAAAATAAAAAGCAGCTTGG + Intronic
907826690 1:58024280-58024302 GAAAGATCACAAAAGAAGCTCGG + Intronic
907854347 1:58287189-58287211 GAAAAATAGCTAATGCATGTTGG + Intronic
907883100 1:58569647-58569669 CAAAAAAAAAAAAAGCAGCTTGG - Intergenic
908080385 1:60571259-60571281 GAAAAAAGACACATGCAGCTAGG + Intergenic
908130643 1:61071896-61071918 TAAAAATAAAAAATTTAGCTGGG - Intronic
908135012 1:61122884-61122906 GAAAAATAGCAAATGCATGCTGG - Intronic
908180145 1:61595720-61595742 TAAAAATACAAAAAGCAGCTGGG - Intergenic
908270523 1:62417360-62417382 GACAAATAACTAATGCATGTGGG - Intergenic
908344771 1:63220919-63220941 TAAAAATAAAAAAAGTAGCTAGG + Intergenic
908364585 1:63406632-63406654 GTAAAGTAACAAATTCAGCAAGG - Intronic
908475983 1:64489119-64489141 CATAAATAAGAAATACAGCTTGG - Intronic
909366291 1:74826800-74826822 GATAAATAACTAATGCACGTGGG + Intergenic
909587696 1:77309108-77309130 GAAAAATAGCTAATGCATGTGGG + Intronic
909674768 1:78226815-78226837 GAAAACTAATAAACACAGCTAGG - Intergenic
909676781 1:78247404-78247426 AAAAAATAACAAATGCTGGCAGG - Intergenic
910171304 1:84379968-84379990 GTAAAATAACAACAGCAGCTAGG - Intronic
910968193 1:92828910-92828932 AAAAAATAAAAATTGTAGCTGGG - Intergenic
910987378 1:93018690-93018712 CAAAAATACAAAATTCAGCTGGG + Intergenic
911011366 1:93284526-93284548 TAAAAATAACAAAATTAGCTGGG - Intergenic
911127706 1:94355820-94355842 GAAAAATAATCAAAGCATCTAGG + Intergenic
911146608 1:94558487-94558509 AAAAAATAACAAGGGCAGCAAGG + Intergenic
911165098 1:94717925-94717947 GAAAAATAACAAAATTAGCCGGG - Intergenic
911185869 1:94904584-94904606 TAAAAATAAAAAATTCAGCTGGG + Intronic
911436802 1:97870354-97870376 CAAAAATATGAAATGCAGTTAGG + Intronic
911555116 1:99334232-99334254 GAAAAATAACATATGAATCAAGG + Intergenic
911667800 1:100573797-100573819 AAAAAATAACAGATGCTGATGGG + Intergenic
912018774 1:105076522-105076544 GTAAAATAAATAATGCAGATAGG - Intergenic
912788808 1:112630636-112630658 AAAAAATAAAAAATCCGGCTGGG - Intronic
912824988 1:112897548-112897570 GAAAAAAAAAAAAAGAAGCTTGG - Intergenic
912900363 1:113640758-113640780 GACAAATAACTAATGCATGTGGG + Intronic
912992589 1:114503890-114503912 GAAAAAAAGCAAATTCAGCTTGG + Intronic
913027869 1:114864005-114864027 GACAAATACCTAATGCAGGTGGG + Intronic
913113146 1:115673758-115673780 TAAAAATACAAAAAGCAGCTGGG - Intronic
913176818 1:116280875-116280897 AAAAAATAACAACTGCTGGTGGG - Intergenic
914794741 1:150910533-150910555 GAAAGAAAACAAATGGTGCTGGG - Intergenic
914889474 1:151610256-151610278 AAAAAAAAAAAAAAGCAGCTGGG - Intergenic
914902327 1:151717295-151717317 GAAAAAGAAAAAATGCAGAGAGG + Intronic
915114423 1:153587240-153587262 GAAAAAGAAAAAAATCAGCTGGG + Intergenic
915228078 1:154425782-154425804 GAAAAAAAAAAAAAGCAGCCGGG + Intronic
915234910 1:154473505-154473527 GAAAAAAAAGAATGGCAGCTGGG + Intronic
915547691 1:156611120-156611142 GAAAAATACAAAAATCAGCTAGG + Intergenic
915548974 1:156621263-156621285 TAAAAATACGAAATTCAGCTGGG - Intronic
915659000 1:157386187-157386209 GAAAAATAGCTAATGCATATAGG - Intergenic
915775918 1:158486115-158486137 GATAAATAGCTAATGCAGCTGGG - Intergenic
916560082 1:165927018-165927040 AAAAAAGAACAAAATCAGCTGGG - Intergenic
916596933 1:166252523-166252545 AAAAAAAAGCAAATGTAGCTGGG - Intergenic
916621652 1:166504340-166504362 GAAAAATACCTAATGCATGTGGG + Intergenic
917268384 1:173246264-173246286 GAAAAATACCTAATGCATATGGG - Intergenic
918026511 1:180754619-180754641 AAAAAATACAAAAAGCAGCTGGG - Intronic
918036298 1:180875570-180875592 GAAAAATGTAAAATGCAGCTAGG + Intronic
918256156 1:182749844-182749866 GACAAATAACTAATGCATGTAGG - Intergenic
918872875 1:189998857-189998879 AAAAAACAAGTAATGCAGCTTGG - Intergenic
918972535 1:191438183-191438205 AAAAAACAACAAATGGTGCTGGG + Intergenic
919160829 1:193828224-193828246 GAAAAATAGCTAATGCATGTTGG + Intergenic
919807409 1:201388387-201388409 CAAAAAAAAAAAAGGCAGCTGGG + Intronic
919873159 1:201839375-201839397 GAAAAATACAAAAATCAGCTGGG - Intronic
919902365 1:202053650-202053672 AAAAAATAACAGATGCAGCCAGG + Intergenic
919950683 1:202360546-202360568 CAAAAATAAAAAATTTAGCTGGG + Intronic
920241098 1:204551204-204551226 AAAAAATACAAAATTCAGCTGGG - Exonic
920598581 1:207298694-207298716 GAAAAATGAAAATCGCAGCTGGG + Intergenic
920612821 1:207458268-207458290 AAAAAAAAAAAAATGAAGCTTGG - Intronic
920632542 1:207666734-207666756 GAAAAATAACTAATGGTACTAGG + Intronic
921044390 1:211463580-211463602 TAAAAATACAAAAAGCAGCTGGG + Intergenic
921155677 1:212436468-212436490 TAAAAATACCAAAAGTAGCTGGG - Intronic
921371141 1:214424133-214424155 GAAAAATACAAAAAGTAGCTGGG + Intronic
921513803 1:216065599-216065621 GAAAAATTAGCAATGCAGCTGGG + Intronic
921518172 1:216123777-216123799 GAAAAATAAGAGCTGGAGCTTGG + Intronic
921621762 1:217333288-217333310 GAAAGAGAACAAATGCAGCTGGG + Intergenic
921927571 1:220724264-220724286 GAAAAATAAAAAAATTAGCTGGG + Intergenic
922005257 1:221523890-221523912 GAAAAGGAACAACAGCAGCTGGG + Intergenic
922297167 1:224261034-224261056 TAAAAATAAAAAAATCAGCTGGG - Intronic
922402490 1:225274487-225274509 AAAAAATAACAGATGCGGCCGGG - Intronic
922904265 1:229162063-229162085 GAAAATTAAAAAACGTAGCTGGG - Intergenic
923189593 1:231607742-231607764 AGAAAATAACAGATGCTGCTAGG - Intronic
923345180 1:233044827-233044849 TAAAAATACAAAAAGCAGCTGGG - Intronic
924281872 1:242446408-242446430 GAAAAATACAAAAATCAGCTGGG + Intronic
924918851 1:248604538-248604560 GAAAAATACCTAATGCATGTGGG + Intergenic
1063208172 10:3854636-3854658 AAAAAAAAAAAAATGTAGCTGGG - Intergenic
1063240566 10:4165392-4165414 AAAAAAAAAAAAATTCAGCTTGG - Intergenic
1063547360 10:6994308-6994330 GTAAAATAAGCAATGCTGCTGGG + Intergenic
1064251686 10:13710851-13710873 GAAAAATACAAAATTTAGCTGGG + Intronic
1064407792 10:15079870-15079892 AAAAAAAAAGAAAAGCAGCTGGG - Intronic
1064463824 10:15559855-15559877 GAAAAATAGCTAATGCATGTTGG + Intronic
1064598118 10:16966607-16966629 TAAAAATACGAAATGTAGCTGGG - Intronic
1064751163 10:18530517-18530539 AAAAAAAAAAAAATGCAGTTGGG + Intronic
1064758429 10:18593740-18593762 GAAAAATACCTAATGCATGTGGG + Intronic
1064798197 10:19037909-19037931 GAAATATAACAAATGCAAGATGG - Intergenic
1064890246 10:20162918-20162940 AAAAAAAAAAAAATCCAGCTGGG + Intronic
1065003289 10:21356778-21356800 TAAAAATAATAAAGGAAGCTAGG + Intergenic
1065011973 10:21429005-21429027 GAAAAAAAAAAAATACAGTTGGG - Intergenic
1065031303 10:21588982-21589004 TAAAAATAAAAAAATCAGCTGGG - Intronic
1065245417 10:23751186-23751208 TAAAAATAAAAAATTCAGCCCGG - Intronic
1065332290 10:24614786-24614808 AAAAAAAAAAAAATGCGGCTAGG + Intronic
1065360066 10:24881225-24881247 TAAAAATAAAAAAATCAGCTGGG - Intronic
1065397974 10:25261805-25261827 GATAAATGACAAGAGCAGCTAGG + Intronic
1065401555 10:25308262-25308284 GAAAAATAGCTAATGCATCCTGG - Intronic
1065575412 10:27113057-27113079 AAAAAATAACAAAATTAGCTAGG + Intronic
1065789683 10:29249521-29249543 GAGAAATACAAAATGCATCTCGG + Intergenic
1065933741 10:30501918-30501940 GAAAAATCACAGAAGAAGCTGGG - Intergenic
1066003871 10:31129621-31129643 AAAAAAAAAAAAAGGCAGCTGGG + Intergenic
1066028971 10:31397861-31397883 GTAGAATAACACATGCATCTAGG - Intronic
1066072602 10:31835036-31835058 TAAAAATAAAAAAATCAGCTGGG + Intronic
1066129927 10:32383041-32383063 AAAAAATTACAAAAGCAGTTAGG + Intergenic
1066710590 10:38229367-38229389 TAAAAATACCAAAATCAGCTGGG - Intergenic
1067023193 10:42819950-42819972 TAAAAATACCAAAATCAGCTGGG - Intronic
1067058760 10:43067052-43067074 GATAAATTACAAATGCAAATGGG + Intergenic
1067269895 10:44782121-44782143 AAAAAATAACAAATGCTGATGGG + Intergenic
1068001391 10:51338243-51338265 GAAAAATAACTAATGCATTCTGG + Intronic
1068016669 10:51525401-51525423 AATAAATAAGAAATGCAGCCGGG + Intronic
1068073148 10:52221049-52221071 AAAAAATAACAGATGCGGGTGGG - Intronic
1068205453 10:53845218-53845240 AAAAAATAACAAATGCTGTAAGG + Intronic
1068261073 10:54582751-54582773 GAAAATTAAAAAATATAGCTGGG + Intronic
1068377683 10:56205603-56205625 GAAAAACAGCAAATGCATGTAGG + Intergenic
1068377983 10:56210205-56210227 GAAAAATAACAAATATATTTTGG - Intergenic
1068907810 10:62345875-62345897 TAAAAATAAAAAAAGTAGCTGGG + Intergenic
1069017590 10:63447776-63447798 TAAAAATAAAAAAATCAGCTGGG + Intronic
1069022717 10:63506537-63506559 GAAAGTTTACAAAAGCAGCTAGG - Intergenic
1069272610 10:66548210-66548232 CAAAAATATCAAATACAGCCAGG - Intronic
1069420611 10:68243234-68243256 GAAAAATGCTAAATCCAGCTGGG + Intergenic
1069446767 10:68479849-68479871 GAAAAATACAAAACTCAGCTGGG + Exonic
1069477605 10:68748697-68748719 GAAAAAAAGAAAATGCAGCCTGG - Intronic
1069516776 10:69083909-69083931 GAAAAATACCAAAATCAGCTGGG - Intergenic
1070077672 10:73153569-73153591 TAAAAATAAAAAAATCAGCTGGG + Intronic
1070103428 10:73410619-73410641 CAAAAATAACAAAATTAGCTGGG + Intronic
1070440819 10:76441517-76441539 GAACAACAACAAATACACCTAGG + Intronic
1071839014 10:89449489-89449511 CAAAAATAACAAATGGAGAAAGG + Intronic
1071850948 10:89569804-89569826 TAAAAATAAAAAATTCAGCCAGG + Intergenic
1071861949 10:89683119-89683141 TAAAAATAAAAAATGCAGGATGG - Intergenic
1072159142 10:92750106-92750128 CAAAAATAAGAAAATCAGCTGGG - Intergenic
1072550604 10:96474393-96474415 GAGGCATCACAAATGCAGCTGGG + Intronic
1072735540 10:97876627-97876649 CAAAAATAACAAATGCCTTTAGG - Intronic
1072841256 10:98776284-98776306 AAAAAAAAAAAAATTCAGCTGGG + Intronic
1072877675 10:99190755-99190777 TAAAAATAAAAAAATCAGCTTGG + Intronic
1072988541 10:100166257-100166279 GAAAAATACAAAATTTAGCTAGG + Intronic
1073159871 10:101383222-101383244 GAAAAATAAAAAAATTAGCTGGG - Intronic
1073609025 10:104925025-104925047 GAAGAATATCTAATGCAGCCAGG - Intronic
1073621864 10:105058421-105058443 GAAATAGAACAAATGGAGTTGGG + Intronic
1073717150 10:106120637-106120659 GATAAATAGCTAATGCAGCTGGG + Intergenic
1073726742 10:106240773-106240795 GAAAATTAACAAATGCACATAGG - Intergenic
1073877171 10:107938347-107938369 TAAAAATAACAAATCAGGCTGGG - Intergenic
1073933730 10:108605453-108605475 GACAAATACCTAATGCATCTGGG - Intergenic
1073949355 10:108787968-108787990 GAGAAACAACAAATGCAGTAGGG - Intergenic
1074310281 10:112316495-112316517 TAAAATTAACAAATGAGGCTGGG - Intergenic
1074561858 10:114542248-114542270 AAAAAATAACAAAATCAGTTGGG + Intronic
1074595828 10:114866088-114866110 GAAAAATAGCTAATGCATGTGGG - Intronic
1074666991 10:115738531-115738553 GAAAATTCCAAAATGCAGCTGGG - Intronic
1074824404 10:117204099-117204121 AAAAAATAAAAAAATCAGCTGGG + Intronic
1074972994 10:118557057-118557079 TAAAAATAACAAAACTAGCTGGG - Intergenic
1075000236 10:118791532-118791554 AAAAATTTACAAATGCAGCCGGG + Intergenic
1075292338 10:121241270-121241292 TAAAAATAAAAAAAGTAGCTGGG - Intergenic
1075757417 10:124824546-124824568 AAAACAAAACAAAGGCAGCTAGG + Intronic
1075794775 10:125112092-125112114 AAAAAAAGTCAAATGCAGCTGGG - Intronic
1075860318 10:125669712-125669734 GAAAAATAGCTAATGCATGTGGG - Intronic
1075919363 10:126197692-126197714 TATAAATACCAAATGCAGCCAGG - Intronic
1076642066 10:131924696-131924718 AAAAAAAAAAAAAGGCAGCTGGG + Intronic
1076657035 10:132031587-132031609 TAAAAATACAAAAAGCAGCTGGG - Intergenic
1076750996 10:132542961-132542983 TAAAAATAAAAAAATCAGCTGGG - Intronic
1077999236 11:7480049-7480071 GAAAAATCACAAAATTAGCTGGG - Intergenic
1078783143 11:14459061-14459083 GATAAATAACCAATGGGGCTGGG - Intronic
1079165689 11:18040526-18040548 AAAAAAAAACAAATTTAGCTGGG - Intronic
1079221552 11:18566057-18566079 TAAAAATAAAAAAAGTAGCTGGG - Intronic
1079491956 11:20998966-20998988 GAAAAGCAGCAAATGCAACTTGG + Intronic
1079817154 11:25076177-25076199 GAACAAAAACAAAAGCAGCTGGG - Intronic
1079908798 11:26283951-26283973 GAAAAATGAGAAAAGCAGTTAGG + Intergenic
1080012103 11:27470762-27470784 GAAAAATAACAAATGGGGAGGGG + Intronic
1080201201 11:29672522-29672544 GAGAAATGACAATGGCAGCTTGG + Intergenic
1080398683 11:31914028-31914050 AAAAAATAACAGATGCTGGTGGG - Intronic
1080620056 11:33979835-33979857 GAAAAATAAAAAAATTAGCTGGG - Intergenic
1081480975 11:43488859-43488881 AAAAAATAAAAAATACAGCTGGG - Intronic
1081820531 11:45989701-45989723 AAAAAATAAAAAATTTAGCTGGG + Intronic
1082052006 11:47778268-47778290 GAAAAATAATAAAATCATCTTGG - Exonic
1082674152 11:56075079-56075101 GAAAAATAGCTAATGCATGTTGG - Intergenic
1082833596 11:57637428-57637450 GAAAAATAAAAAAATTAGCTGGG - Intergenic
1083074729 11:60024377-60024399 TAAAAATACCAAATTTAGCTGGG + Intergenic
1083102278 11:60320879-60320901 GAAAAATAGCTAATGCATGTGGG - Intergenic
1083125130 11:60557613-60557635 AAAAAATAACAAATGTTGGTGGG + Intergenic
1083778096 11:64903922-64903944 GAAGAACCACAAATGCAGCAGGG - Intronic
1083985842 11:66214780-66214802 TAAAAATAAAAAAATCAGCTGGG - Intronic
1084066355 11:66706624-66706646 AAAAAAAAAAAAAAGCAGCTAGG - Intronic
1084135605 11:67178243-67178265 TAAAAATAAAAAAATCAGCTGGG + Intronic
1084311429 11:68318497-68318519 AAAAAACAACAAAATCAGCTGGG - Intronic
1084864511 11:72044826-72044848 TAAAAATAAAAAAATCAGCTGGG - Intronic
1084865778 11:72055818-72055840 AAAAAAAAAAAAATTCAGCTGGG + Intronic
1084964026 11:72734279-72734301 AAAAAATAACAAAATTAGCTGGG - Intronic
1084989250 11:72907886-72907908 TAAAAATAACAAAACCAGCCAGG - Intronic
1085121013 11:73967582-73967604 TAAAAATAAAAAATTTAGCTGGG + Intronic
1085428119 11:76422898-76422920 TATAAATAACAAATGCTGCCAGG - Intergenic
1085442258 11:76575890-76575912 TAAAAATAAAAAAATCAGCTGGG - Intergenic
1085705559 11:78784088-78784110 GGGAAATAACTATTGCAGCTAGG + Intronic
1085815595 11:79733974-79733996 GCCAAATAACACATGTAGCTTGG + Intergenic
1086083024 11:82924838-82924860 AAAAAAAAACAAATGAAACTTGG + Intronic
1086430808 11:86734473-86734495 AAAAAAAAAAAAAAGCAGCTAGG - Intergenic
1086518907 11:87646585-87646607 AAAAAATACAAAATGTAGCTGGG - Intergenic
1086521485 11:87673156-87673178 GAAAAATAGCAAATGTATGTTGG - Intergenic
1086524188 11:87705284-87705306 CTATAATAACAAAAGCAGCTTGG - Intergenic
1086527922 11:87750751-87750773 AAAAAACAATAAAAGCAGCTAGG - Intergenic
1086717429 11:90079496-90079518 GAAAAAAAAAAAAAGTAGCTGGG - Intergenic
1086900728 11:92365107-92365129 TAAAAATAAAAAATTTAGCTGGG + Intronic
1087697172 11:101392958-101392980 TAAAAATAAGAAAATCAGCTGGG + Intergenic
1087868681 11:103265244-103265266 GACAAATACCTAATGCAGGTAGG + Intronic
1088294089 11:108273500-108273522 GAAAAATAAAAAAATTAGCTGGG - Intronic
1088442373 11:109885710-109885732 AAAAAATAACAGATGCTGATGGG + Intergenic
1088826989 11:113504225-113504247 GGAAAAAAAAAAATGGAGCTGGG + Intergenic
1089230516 11:116970643-116970665 AAGAAATAACAAATACAGCCGGG - Intronic
1089990738 11:122857306-122857328 TAAAAATAAAAAAATCAGCTGGG + Intronic
1090544269 11:127745945-127745967 GAAAAATAACTAATGCATGCTGG + Intergenic
1091084273 11:132705430-132705452 AAAAAATAACAAATTCAGCTGGG + Intronic
1091523750 12:1275325-1275347 TAAAAATACCAAATTTAGCTGGG + Intronic
1091963451 12:4718815-4718837 TAAAAATAACAAAATTAGCTGGG - Intronic
1092462830 12:8700903-8700925 GAAAAATATAAAAAGTAGCTGGG + Intronic
1092548851 12:9475469-9475491 GAAAAATAACTAATGCATGCTGG + Intergenic
1092671919 12:10872514-10872536 GAAAAATAACTAATGGTACTAGG + Intronic
1092702815 12:11251492-11251514 GAAAAATAACTAATGTTACTAGG + Intergenic
1093060458 12:14597267-14597289 GAAAATTAACAAAGACATCTAGG - Intergenic
1093121011 12:15271654-15271676 GAAAAAACCCAAATGCAGATTGG - Intronic
1093202981 12:16211925-16211947 TAAAAATGACTAATGCAGCTTGG + Intronic
1093240119 12:16659592-16659614 GAAAAATATAAAATTTAGCTGGG + Intergenic
1093382518 12:18510264-18510286 GAAAATTAAAAAATGAAGATAGG - Intronic
1093464001 12:19432169-19432191 GGAGAGTAACAAATGCAGCGTGG + Intronic
1093465908 12:19448838-19448860 AAAAAATGAAAAAAGCAGCTGGG - Intronic
1093621276 12:21292754-21292776 TAAAAATACAAAATGTAGCTGGG - Intronic
1093718945 12:22415389-22415411 GAAAAATACAAAATTTAGCTGGG + Intronic
1094126252 12:27025185-27025207 TAAAAATGAAAAATGCTGCTTGG + Intronic
1094207550 12:27856533-27856555 GAAAAATAGCTAATGCATGTTGG - Intergenic
1094241477 12:28230782-28230804 AAAAAATACAAAATGTAGCTGGG - Intronic
1094267727 12:28577586-28577608 GAAAAAGAACAAATGCACTGTGG + Intronic
1094504150 12:31046996-31047018 GAAAAATAACTAATGCATGCTGG - Intergenic
1094534883 12:31312214-31312236 GAAAAATAAAAAATACAGCATGG - Intronic
1094554793 12:31487889-31487911 GAAAACAAACAAAAACAGCTGGG + Intronic
1094562130 12:31565231-31565253 AAAAAATAAAAAAACCAGCTAGG + Intronic
1094660365 12:32464517-32464539 GAAAAAGGACAAATGCACATAGG + Intronic
1094723244 12:33086744-33086766 GAAAAATAACTAATGGTACTAGG - Intergenic
1095187419 12:39216898-39216920 AAAAAAAAAAAAATACAGCTGGG + Intergenic
1095249293 12:39959938-39959960 GATAAATAGCTAATGCATCTGGG - Intronic
1095450032 12:42320743-42320765 GAACAAAAGCAAATGCAGCTGGG - Intronic
1096058625 12:48677484-48677506 GAAAAAAAAGGAATGAAGCTGGG + Intronic
1096085092 12:48860242-48860264 TAAAAATACCAAAAGTAGCTGGG - Intronic
1096087653 12:48876769-48876791 TAAAAATAAAAAATTTAGCTGGG - Intergenic
1096283149 12:50274421-50274443 CAAAAATAAAAAATTTAGCTGGG + Intronic
1096373610 12:51089237-51089259 GAAAAATAAAAATTAGAGCTGGG + Intergenic
1096486567 12:51986078-51986100 GTAAGATAACAAAAGCAGTTCGG + Intronic
1096947053 12:55418716-55418738 GAAAAATGTTAAAGGCAGCTAGG - Intergenic
1096990884 12:55801776-55801798 GAAAAATAATAAAATTAGCTGGG - Intronic
1096992090 12:55813104-55813126 TAAAAATACCAAAAGTAGCTGGG - Intronic
1097653268 12:62330291-62330313 AAAAAAAAACAAATGGGGCTGGG + Intronic
1097685923 12:62690809-62690831 GAAAAATACAAAATTTAGCTAGG + Intronic
1098011680 12:66059876-66059898 GCAGAAAAACAAATGCTGCTGGG + Intergenic
1098256182 12:68618056-68618078 GAACAAGAACTAATACAGCTGGG - Intronic
1098427110 12:70377124-70377146 AAAAAATAACTAATCCAGCTGGG - Intronic
1098725413 12:73958555-73958577 TAAAAATACAAAATTCAGCTGGG + Intergenic
1098739152 12:74148898-74148920 GAAAAATAAAATATGAAGCATGG - Intergenic
1098930359 12:76405296-76405318 GAAAAATAAAAAAATTAGCTGGG + Intronic
1099065297 12:77969682-77969704 GAAAAATACAAAAAGCAGCCAGG + Intronic
1099098867 12:78411527-78411549 AAAAAATAACAGATGCCGCAAGG - Intergenic
1099142535 12:78996792-78996814 GTAAACTAACAAAAGCAGCCTGG + Intronic
1099373119 12:81862557-81862579 GACAAACAACAAATCCAGCCAGG - Intergenic
1099374476 12:81882162-81882184 GAAAAATAGCTAATGCATCCTGG - Intergenic
1099545654 12:83976705-83976727 GAAAAATACCTAATGCATGTGGG + Intergenic
1099561687 12:84184984-84185006 GAAGAATAAAATATGGAGCTGGG + Intergenic
1099956463 12:89355456-89355478 GAGAAATCAGAAATGTAGCTGGG - Intergenic
1100086737 12:90920002-90920024 AAAATAGAGCAAATGCAGCTAGG - Intronic
1100317192 12:93455225-93455247 GAAAAATACCTAATGCATGTGGG - Intergenic
1100328292 12:93562231-93562253 GAAAAATGACTAATGCATGTGGG + Intergenic
1100342404 12:93691917-93691939 GAAAAATAACTAATGCATGTGGG + Intronic
1100483017 12:94997548-94997570 TAAAAGTAACAAATGCACATGGG + Intronic
1100558549 12:95722812-95722834 GAAAAATAATAAAATTAGCTGGG + Intronic
1100648392 12:96556935-96556957 GAAAAATAACTAATGGTACTAGG + Intronic
1100783159 12:98050616-98050638 CAAAAATACAAAATGTAGCTGGG + Intergenic
1101263281 12:103057309-103057331 GACAAATAACTAATGCATGTGGG - Intergenic
1101483619 12:105128936-105128958 AAAAAAAAAAAAATGTAGCTGGG - Intronic
1101644897 12:106622613-106622635 AAAAAAAAAAAAATGCAGCTTGG - Intronic
1101769702 12:107737774-107737796 GAAAAACAACAATTGGTGCTAGG - Intronic
1101941393 12:109101710-109101732 AAAAAATTAAAAAAGCAGCTAGG + Intronic
1101971956 12:109320925-109320947 CAAAAATAACAAAATTAGCTGGG + Intergenic
1102017079 12:109655246-109655268 AAAAATTAAAAAATTCAGCTGGG - Intergenic
1102215594 12:111159307-111159329 GAAAAAAAAAAAAAACAGCTGGG - Intronic
1102337552 12:112094818-112094840 TAAAAATACCAAATTTAGCTGGG - Intronic
1102373071 12:112398825-112398847 GACAAATAACTAATGCATGTGGG + Intergenic
1102494986 12:113313442-113313464 GAAAAATATCAAATGTGGCCAGG + Intronic
1102898255 12:116615834-116615856 AAAAAATAAAAAATGTAGCCCGG - Intergenic
1102965193 12:117120286-117120308 TAAAAATACAAAATGTAGCTGGG + Intergenic
1103576220 12:121879301-121879323 AAAAAATAACTAATACAACTTGG + Intergenic
1103774739 12:123358781-123358803 GAAATACAACAAAGGGAGCTTGG + Intronic
1104985528 12:132594555-132594577 GAAAAATACAAAAAGTAGCTGGG + Intergenic
1106191650 13:27458854-27458876 AAAAAAAAACAAATCCACCTAGG - Intergenic
1106218073 13:27720714-27720736 TAAAAATACCAAAATCAGCTGGG + Intergenic
1106641868 13:31593066-31593088 AAAAAGTAAAAAATGCAGCTGGG - Intergenic
1106984009 13:35323008-35323030 AAAAAATACAAAATGCAGCTGGG - Intronic
1107086084 13:36429770-36429792 TAAAAATACAAAATGTAGCTGGG - Intergenic
1107309040 13:39056728-39056750 CAAAAATAACAAATGCTGGTGGG - Intergenic
1107628931 13:42322962-42322984 GATACATAGCAAAAGCAGCTTGG + Exonic
1107921999 13:45218201-45218223 GATCTCTAACAAATGCAGCTAGG - Intronic
1108079875 13:46724209-46724231 TAAAAATTAAAAATTCAGCTGGG - Intronic
1108355809 13:49627947-49627969 GAAAAATACAAAAATCAGCTGGG + Intergenic
1108594833 13:51940482-51940504 TAAAAATACAAAATGTAGCTGGG + Intronic
1108976711 13:56453535-56453557 GAAAAATAGCTAATGCATCCAGG - Intergenic
1109071398 13:57773366-57773388 GAAAAATAACAGATGCTGGCAGG - Intergenic
1109281054 13:60356240-60356262 TAAAAATACAAAATGCAGCTGGG + Intergenic
1109293705 13:60505030-60505052 AAAAAATAACTCCTGCAGCTAGG - Intronic
1109541366 13:63782486-63782508 GAAAAAAAACTCCTGCAGCTAGG + Intergenic
1109714595 13:66204784-66204806 GAGAAATAACTAATGCATATGGG + Intergenic
1109928005 13:69171962-69171984 GAAAAATACAAAATGTAGCTAGG + Intergenic
1110123988 13:71918287-71918309 GAAGAATAAGAAATGTGGCTGGG - Intergenic
1110129239 13:71986463-71986485 GAAAAATAAACAATGCAGAAAGG + Intergenic
1110216186 13:73027494-73027516 AAAAAATAAAAAAATCAGCTGGG - Intergenic
1110346908 13:74459083-74459105 TAAAAATACCAAAATCAGCTGGG + Intergenic
1110566521 13:76962746-76962768 GACAAATAAAAAATGCAGAAGGG + Intergenic
1110615242 13:77534444-77534466 TAAAAATAAAAAAATCAGCTGGG - Intergenic
1110828697 13:80004626-80004648 GAAAAATAAAAAAATTAGCTGGG + Intergenic
1111045693 13:82811074-82811096 GACAAATAGCTAATGCATCTAGG + Intergenic
1111310197 13:86474265-86474287 GGAAAATAACTTATGCAGCAGGG - Intergenic
1111612409 13:90620985-90621007 GAAAAATACAAAAATCAGCTGGG + Intergenic
1111676596 13:91396223-91396245 TAAACATTACAAATGAAGCTAGG - Intergenic
1112124997 13:96455378-96455400 GAAAAAAAAAAAATGTAGCTGGG - Intronic
1112385951 13:98939730-98939752 GAACAATAACAATTGAACCTAGG - Intronic
1112413079 13:99180349-99180371 AAAAAATAAAAAAATCAGCTGGG - Intergenic
1112455455 13:99557722-99557744 AAAAAATAACAAAATTAGCTGGG + Intronic
1112742413 13:102490044-102490066 GGAAAATAATAAATAAAGCTTGG + Intergenic
1112920477 13:104605440-104605462 TAAAAATACCAAAATCAGCTGGG + Intergenic
1113601073 13:111568591-111568613 GAAAAATAACACTCGCAGGTTGG + Intergenic
1114181290 14:20370072-20370094 TAAAAATAAAAAAATCAGCTGGG - Intronic
1114314367 14:21496000-21496022 GACAGATAAAAAATCCAGCTGGG + Intronic
1114561262 14:23592471-23592493 AGAGAATAACAAATGCAGCCAGG - Intergenic
1114639804 14:24212085-24212107 AAAAAAAAAGAAAGGCAGCTAGG - Intronic
1114664890 14:24371840-24371862 AAAAAATACAAAAAGCAGCTGGG - Intronic
1114686688 14:24538846-24538868 GAAAACTAACAAAGGTATCTGGG + Intergenic
1114698694 14:24653666-24653688 AAAAAATAACAAATGCTGCAAGG - Intergenic
1114899227 14:27035558-27035580 AAAAAATAAAAAATGAAACTAGG + Intergenic
1115083560 14:29486751-29486773 AAAAAATAACAAATGTGGCCTGG + Intergenic
1115189760 14:30734898-30734920 GAAAAATACCAATAGCAACTAGG - Intronic
1115228788 14:31135567-31135589 GAACAAAAACAAATGAAGATCGG + Exonic
1115231530 14:31166004-31166026 GAAAAATAAAAAAATTAGCTGGG - Intronic
1115546885 14:34471934-34471956 GAAAAAAAAAAAAGGCAGCGAGG + Intergenic
1115858749 14:37660344-37660366 GAAAAATAACTAATGCATGATGG - Intronic
1115917423 14:38331332-38331354 GATAAATAGCTAATGCAGGTTGG + Intergenic
1115951421 14:38726736-38726758 AAAAAAAAAAAAATGCAGATTGG - Intergenic
1116353507 14:43897294-43897316 GAAAAATAATAAATACAACTTGG + Intergenic
1116489567 14:45490090-45490112 GAAAAATAGCTAATGCATGTTGG + Intergenic
1116884614 14:50207743-50207765 TAAAAATAAAAAAATCAGCTAGG + Intronic
1116887352 14:50233751-50233773 TAAAAATAACAAAACTAGCTGGG + Intergenic
1116943320 14:50811958-50811980 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1117400745 14:55356610-55356632 AAAAAATAAAAAAATCAGCTGGG - Intronic
1117601814 14:57383981-57384003 TAATAATAAAAAATGCATCTGGG + Intergenic
1117815051 14:59589153-59589175 TAAAAACAACAATGGCAGCTGGG + Intergenic
1117817036 14:59609122-59609144 TAAAAATAACAAAAGTAGCTGGG + Intronic
1117825675 14:59700768-59700790 GAAAACAAACAAATGAATCTTGG + Intronic
1118071856 14:62254350-62254372 GAAAAATAACAGATTTGGCTGGG + Intergenic
1118196083 14:63627790-63627812 GAAAAAAAAAAAATTCAGCTGGG + Intronic
1118295361 14:64563281-64563303 GAAAAATACCAAATGTTGATGGG - Intronic
1118456447 14:65949165-65949187 GAAATAAAACAAATGAAGCTTGG - Intergenic
1118598776 14:67456622-67456644 AAAAAATAACACATGCTGCAAGG + Intronic
1118798766 14:69169729-69169751 TAAAAATACAAAAAGCAGCTGGG - Intergenic
1118822245 14:69353114-69353136 CAAAAATGACAAATGAGGCTGGG - Intronic
1119158539 14:72433366-72433388 GAAAAATAACTAATGCATGCTGG + Intronic
1119170471 14:72531270-72531292 TAAAAATAAAAAAATCAGCTGGG + Intronic
1119454418 14:74742407-74742429 GAAAAATAATATGAGCAGCTGGG - Intergenic
1119455782 14:74754452-74754474 AACAAGTAAGAAATGCAGCTAGG + Intergenic
1119486492 14:74991536-74991558 GAAAAATACAAAAATCAGCTGGG + Intergenic
1119503656 14:75152959-75152981 TAAAAATACCAAAATCAGCTGGG + Intronic
1119622936 14:76146414-76146436 GAAAAATACAAAAAGTAGCTGGG + Intergenic
1119675224 14:76548338-76548360 GGGAAAAAACAAATGCATCTTGG - Intergenic
1119957763 14:78818847-78818869 GAAAAACAAGAAATGGAGGTGGG - Intronic
1120139690 14:80915172-80915194 GAAAAAAAAAAAATTTAGCTGGG - Intronic
1120228917 14:81821718-81821740 GAAAAATAGCTAATGCATGTTGG - Intergenic
1120270307 14:82304571-82304593 GAATAATAAAAATTACAGCTGGG - Intergenic
1120294128 14:82618367-82618389 GAAAAATGCAGAATGCAGCTGGG - Intergenic
1120705359 14:87739962-87739984 GAAAAACAACAAAAGGGGCTGGG + Intergenic
1121136452 14:91503284-91503306 GAAAAAAAAAAAATGTAGCTCGG - Intronic
1121472991 14:94170963-94170985 AAAAAATAACAAAATTAGCTAGG - Intronic
1123043796 14:105501573-105501595 AAAAAATAAAAAAAGCAGCTGGG + Intergenic
1123424339 15:20157127-20157149 TAAAAATACCAAAATCAGCTGGG - Intergenic
1123477560 15:20600807-20600829 GAAAAATAACTAATGCATACGGG - Intergenic
1123533561 15:21163658-21163680 TAAAAATACCAAAATCAGCTGGG - Intergenic
1123640456 15:22399575-22399597 GAAAAATAACTAATGCATACGGG + Intergenic
1123668628 15:22630273-22630295 AAAAAAAAAAAAATGGAGCTGGG - Intergenic
1123910849 15:24965374-24965396 GAAAAATAAAAAAATCAGCCGGG + Intronic
1124009024 15:25820700-25820722 GAAAATTCAAAAATGCTGCTTGG + Intronic
1124050568 15:26193671-26193693 AAAAAATAACAAAAGAAGATTGG - Intergenic
1124200629 15:27675921-27675943 AAGAAATAATAAATACAGCTGGG + Intergenic
1124387274 15:29220436-29220458 GAAAAATCACAAATACTGATCGG - Intronic
1124453262 15:29817882-29817904 GAAAAATACCTAATGCATGTGGG + Intronic
1124686377 15:31786258-31786280 GAAAACAAACTAATACAGCTGGG + Intronic
1124717711 15:32081169-32081191 GAAAAATAGCAAATGCATGCTGG + Intronic
1124899196 15:33806911-33806933 AAAAAAAAAAAAATTCAGCTGGG - Intronic
1124947014 15:34278264-34278286 TAAAAATAAAAAAATCAGCTGGG + Intronic
1125129746 15:36269686-36269708 TAAAAACAAAAAATGTAGCTGGG - Intergenic
1125216233 15:37278599-37278621 GACAAATAGCTAATGCATCTGGG + Intergenic
1125235334 15:37506342-37506364 GACAAATAACTAATGCATGTGGG - Intergenic
1125264853 15:37867188-37867210 TAAAAATAATGAAGGCAGCTGGG - Intergenic
1125694378 15:41622749-41622771 GAAAAATACCAAAGGCTGGTGGG - Intronic
1125952360 15:43763546-43763568 TAAAAATGACCAATTCAGCTGGG - Intronic
1126030748 15:44495263-44495285 AAAAATTAAGAAATGCAGCCAGG - Intronic
1126581241 15:50244461-50244483 AAAAATTAAAAAATGTAGCTGGG - Intronic
1126769873 15:52044631-52044653 GGAAAAAAAAAAATGCAACTTGG - Intronic
1127212654 15:56789960-56789982 GACAAATAACTAATGCATGTGGG + Intronic
1127240957 15:57113788-57113810 AAAAAAAAAAAAATTCAGCTAGG + Intronic
1127661559 15:61104258-61104280 GAAAATTAACAAACGCACCTAGG + Intronic
1127894958 15:63289841-63289863 AAAAATTAAAAAATTCAGCTGGG + Intronic
1128318546 15:66676798-66676820 AAAAAATATAAAAAGCAGCTGGG + Intronic
1128332935 15:66767948-66767970 AAAAAAAAAAAGATGCAGCTTGG - Intronic
1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG + Intergenic
1128450462 15:67803247-67803269 GAATAATACCAAGTCCAGCTGGG - Intronic
1128485323 15:68080125-68080147 TAAAAATAACAAATCCAGCCAGG - Intronic
1128670077 15:69568011-69568033 TAAAAATAAAAAATTCAGCTGGG + Intergenic
1128775319 15:70315949-70315971 GAAAAAGAACACAGGCATCTAGG - Intergenic
1128812371 15:70581867-70581889 TAAAAATAAAAAATGCAGTGAGG - Intergenic
1129147490 15:73662094-73662116 AAAATACAAAAAATGCAGCTGGG - Intergenic
1129491329 15:75928615-75928637 GAAAAATAACTAATGGAGAATGG + Intronic
1129863985 15:78888303-78888325 GAAAAATAAAAAAATTAGCTCGG + Intronic
1129990164 15:79955108-79955130 GAAAATTGACTAATGCAGCATGG - Intergenic
1130083909 15:80761452-80761474 GAAAAATAAAAAAATTAGCTGGG - Intergenic
1130343064 15:83015538-83015560 GAAAAATAAGAAAATTAGCTGGG - Intergenic
1130396159 15:83503641-83503663 GAAAAATAAGTATTGCAGCTGGG + Intronic
1130640737 15:85672349-85672371 GTAGAATAACAAATACAGGTGGG - Intronic
1131011523 15:89021987-89022009 TAAAAATAACAAAATTAGCTGGG - Intergenic
1131085052 15:89568895-89568917 AAAAAATTAAAAATGAAGCTGGG - Intergenic
1131194708 15:90346371-90346393 TAAAAATAAAAAAATCAGCTGGG - Intergenic
1131528706 15:93173866-93173888 GAAAAATACCAAATGCATGCAGG - Intergenic
1131600840 15:93847195-93847217 GAAAAATAGCTAATGCATGTGGG + Intergenic
1131817311 15:96234997-96235019 GAAAAATACAAAAAGTAGCTGGG - Intergenic
1131926671 15:97391935-97391957 AAAAAAAAAAAAAAGCAGCTGGG + Intergenic
1131997523 15:98146391-98146413 GAAGAAAAACAAATACACCTAGG + Intergenic
1132158120 15:99511054-99511076 TAAAAATTACAAATTCAGTTTGG + Intergenic
1132206807 15:99992055-99992077 GACAAATACCTAATGCATCTGGG + Intronic
1132982722 16:2746940-2746962 AAAAAAAAAAAAATGCAGCCTGG - Intergenic
1132996080 16:2823875-2823897 TAAAAATTACAAAAGTAGCTGGG - Intronic
1133024896 16:2984601-2984623 TAAAAATAAAAAAATCAGCTGGG - Intergenic
1133261263 16:4551868-4551890 GACAAATACCAAATGCAGGCAGG - Intergenic
1133313853 16:4869837-4869859 GAAAAAAAAGAAATGCTGCCGGG + Intronic
1133318832 16:4900723-4900745 TAAAAATGACATAGGCAGCTGGG - Intronic
1133610421 16:7428089-7428111 AGGAAATGACAAATGCAGCTGGG - Intronic
1133943170 16:10327395-10327417 TAAAAATAAAAAAATCAGCTGGG - Intronic
1133946131 16:10350068-10350090 CAAAAATACCAAATTTAGCTGGG + Intronic
1134143180 16:11740030-11740052 GAAAAATACAAAAATCAGCTGGG + Intronic
1134163475 16:11911845-11911867 AAAAAAAAAAAAATACAGCTGGG - Intronic
1134355974 16:13482638-13482660 GAAAAGTAAAAAATTTAGCTTGG + Intergenic
1134358857 16:13511392-13511414 GAAAAATGCCAAATGCAGCCAGG - Intergenic
1134880351 16:17740595-17740617 TAAAAATAAAAAATTTAGCTGGG - Intergenic
1135085361 16:19470736-19470758 AAAAAAAAAAAAAAGCAGCTGGG + Intronic
1135288047 16:21210868-21210890 AAAAAAAAAAAAATGCAGCCAGG - Intronic
1135512943 16:23103752-23103774 GAAAAATACAAAAATCAGCTGGG + Intronic
1135682946 16:24473978-24474000 AAAAAATAACATATGCAGAATGG - Intergenic
1135717514 16:24784482-24784504 AAAAAATAAAAAAATCAGCTGGG - Intronic
1135781935 16:25311346-25311368 TAAAAATACAAAATTCAGCTGGG - Intergenic
1135838107 16:25846371-25846393 AAAAAATAAAAAATGTAGCTGGG + Intronic
1135907397 16:26525494-26525516 CCAAAATTACAGATGCAGCTGGG + Intergenic
1135949343 16:26898698-26898720 GAAAAATAACTAATGCATGCTGG - Intergenic
1136177062 16:28524396-28524418 AAAAAATAAGAAATCCAGCTGGG + Intergenic
1136349154 16:29695784-29695806 AAAAAAAAAAAAAGGCAGCTGGG - Intronic
1136533360 16:30884479-30884501 AAAAAAAAACAAATGGAGATAGG - Intronic
1136642972 16:31583149-31583171 GATAAATAGCTAATGCAGGTGGG - Intergenic
1136662651 16:31777988-31778010 GATAAATAGCTAATGCAGGTGGG + Intronic
1136860529 16:33698760-33698782 TAAAAATACCAAAATCAGCTGGG + Intergenic
1137294488 16:47077333-47077355 AAAAAAAAAAAAATTCAGCTGGG + Intergenic
1137356951 16:47776111-47776133 AAAAAATAACAAATGCTGGCGGG + Intergenic
1137736835 16:50731017-50731039 AAAAAATAAAAAATTCAGCTGGG + Intronic
1137912484 16:52392136-52392158 GAAGAATTACAAATGCAAATTGG + Intergenic
1137930084 16:52578774-52578796 CAAAATTAGGAAATGCAGCTGGG + Intergenic
1137992528 16:53173837-53173859 AAAAAATAACAAATTTGGCTGGG - Intronic
1138004194 16:53315637-53315659 GAAAAATACAAAAGTCAGCTGGG - Intronic
1138175283 16:54892605-54892627 GAAAAATAATAATTTCGGCTGGG + Intergenic
1138306831 16:55984957-55984979 AAAAAATAACAGATGCGGCTGGG - Intergenic
1138751740 16:59430695-59430717 GAAAAATAACTAATGCATGTTGG + Intergenic
1138879313 16:60991490-60991512 GGAAAATAGCTAATGCAGGTGGG - Intergenic
1138995048 16:62440542-62440564 AAAAATTAACAAATGCTGGTAGG + Intergenic
1139101335 16:63771182-63771204 TAAAAATAAAAAAATCAGCTGGG - Intergenic
1139773506 16:69298097-69298119 TAAAAATAAAAAATGTATCTGGG - Intronic
1139870338 16:70103430-70103452 TAAAAATTACAAAATCAGCTGGG + Intergenic
1139874291 16:70133103-70133125 AAAAAAAAAAAAAAGCAGCTGGG - Intronic
1139878938 16:70168033-70168055 GAAAAAAAAAAAAAGTAGCTGGG + Intergenic
1140089695 16:71827496-71827518 TAAAAATAAAAAAATCAGCTGGG + Intergenic
1140212381 16:72980608-72980630 AAAAAAAAACAAAAACAGCTGGG + Intronic
1140284265 16:73586226-73586248 TAAAAATAAAAAAATCAGCTGGG + Intergenic
1140344376 16:74198370-74198392 AAAAAATATCACAGGCAGCTGGG + Intergenic
1140361487 16:74348039-74348061 AAAAAAAAAAAAAAGCAGCTGGG + Intergenic
1140373580 16:74427460-74427482 GAAAAAAAAAAAAAGTAGCTGGG - Intergenic
1140385104 16:74529125-74529147 TAAAAATTACAAAATCAGCTGGG - Intronic
1140425690 16:74859432-74859454 AAAAAAAAAAAAATACAGCTGGG - Intergenic
1140503666 16:75456291-75456313 TAAAAATAACAAATGAGGCCGGG + Intronic
1140587589 16:76311724-76311746 GTACAATTAAAAATGCAGCTGGG - Intronic
1140601918 16:76486658-76486680 GAAAATAAGCAAATGCATCTGGG - Intronic
1140630291 16:76844398-76844420 AAAAAATATTAAAGGCAGCTAGG - Intergenic
1140731577 16:77861424-77861446 GGGAAATCACAAATGCAGTTAGG - Intronic
1140775180 16:78242845-78242867 TAAAAATAACAAAATTAGCTGGG + Intronic
1140825063 16:78698462-78698484 GAATAATAAGAAATGCAAGTTGG - Intronic
1140852390 16:78947348-78947370 GAAAAATAACAAATGCAGCTAGG - Intronic
1141452159 16:84111903-84111925 AAAAAAAAAAAAATGCAGCTGGG + Intronic
1141549854 16:84798861-84798883 GAAAAAAAAAAAAAGCTGCTGGG - Intergenic
1141711640 16:85703002-85703024 AAAAAATAAAAAAATCAGCTGGG - Intronic
1142405177 16:89884623-89884645 GAAAAACAAGAAAAGCAGCACGG + Exonic
1203122029 16_KI270728v1_random:1546943-1546965 TAAAAATACCAAAATCAGCTGGG + Intergenic
1142477219 17:195752-195774 TAAAAATATCAAATGCAGCCTGG - Intergenic
1142477910 17:200570-200592 GAAGAATCACAAATGCTGCCTGG - Intergenic
1142541264 17:661224-661246 GAAAAAAAAAAGTTGCAGCTGGG + Intronic
1142814631 17:2415464-2415486 AAAAAAAAAAAAAAGCAGCTGGG - Intronic
1143187909 17:5021639-5021661 AAAAAATAAAAAATGTAGCCAGG - Intronic
1143311924 17:5999148-5999170 AAAAAAAAAAAAATTCAGCTGGG + Intronic
1143392675 17:6569230-6569252 GAAAAAAAAGAAAAGCAGATGGG + Intergenic
1143436869 17:6935350-6935372 GAAAAATAACAGATGCTGGCCGG - Intronic
1143529048 17:7490516-7490538 TAAAAATATAAAAAGCAGCTGGG + Intronic
1143546827 17:7601928-7601950 AAAAAAAAAGAAATGAAGCTAGG + Intronic
1143581190 17:7827604-7827626 AAAAAATAACAAAATTAGCTGGG - Intronic
1143760714 17:9101830-9101852 AAAAAATAAGAAATGTAGCCAGG + Intronic
1143897952 17:10151703-10151725 AAAAAATAAAAAAAGTAGCTGGG - Intronic
1144198105 17:12915197-12915219 TAAAAATATCAAACTCAGCTGGG - Intronic
1145076800 17:19862255-19862277 TAAAAATAAAAAAATCAGCTGGG - Intronic
1145210552 17:21009980-21010002 AAAAAATCACAAAATCAGCTGGG + Intronic
1145362632 17:22224895-22224917 TGAAAATCTCAAATGCAGCTGGG + Intergenic
1146230889 17:31107970-31107992 AAAAAATAAAAAAAGTAGCTAGG + Intronic
1146527484 17:33579292-33579314 AAAAAAAAAAAAATGCAGGTGGG + Intronic
1146980738 17:37159015-37159037 GAAAAATAATAAAATTAGCTGGG + Intronic
1147044064 17:37740127-37740149 TAAAAATAAAAAATTTAGCTGGG - Intronic
1147113458 17:38280834-38280856 TAAAAATACAAAAAGCAGCTGGG - Intergenic
1147272342 17:39283569-39283591 CAAAAATCCAAAATGCAGCTGGG - Intronic
1147285261 17:39397855-39397877 CAAAAAAAAAAAATGCAGATTGG + Intronic
1147371952 17:39998395-39998417 TAAAAATAAAAAAATCAGCTGGG + Intergenic
1147404129 17:40198825-40198847 AAAAAATAAAAAATGTAGCTGGG + Intergenic
1147630602 17:41928548-41928570 GAAAAAAAAAAAAGGCTGCTGGG + Intronic
1147942161 17:44056700-44056722 GAAAAAAAAAAAATACAGCCTGG + Intronic
1148365994 17:47056390-47056412 GAATAATAAGAATTGTAGCTGGG - Intergenic
1148416159 17:47508354-47508376 TAAAAATACAAAAAGCAGCTGGG + Intergenic
1148566579 17:48636518-48636540 AAAAAAAAAAAAATCCAGCTGGG - Intergenic
1148602474 17:48904890-48904912 TAAAAATATAAAAAGCAGCTGGG + Intergenic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1149106025 17:52966321-52966343 AAAAAATAACAAATGCTGGCAGG - Intergenic
1149144021 17:53468034-53468056 AAAAAAAAAAAAAGGCAGCTTGG + Intergenic
1149202788 17:54207420-54207442 AAAAAATAACAGATGCGGCTGGG + Intergenic
1149288798 17:55195604-55195626 TAAAAATAAAAAATTTAGCTCGG - Intergenic
1149728862 17:58924685-58924707 GAAAAATAGCTAATGCATGTGGG - Intronic
1149752750 17:59161586-59161608 TAAAAATAAAAAAACCAGCTGGG + Intronic
1149789309 17:59463412-59463434 TAAAAATACAAAATGTAGCTGGG + Intergenic
1149963220 17:61135461-61135483 GCTAAATAACAAATGCACATGGG - Intronic
1150068419 17:62131510-62131532 GAAAAATACAAAAAGTAGCTAGG - Intergenic
1150195883 17:63298878-63298900 GACAAATAACTAATGCATGTGGG - Intronic
1150400462 17:64852027-64852049 GAATAATAAGAATTGTAGCTGGG + Intergenic
1150679921 17:67276462-67276484 AAAAAAAAAAAAGTGCAGCTGGG - Intergenic
1150793183 17:68216292-68216314 AAAAAATAAAAAAATCAGCTGGG - Intergenic
1150865672 17:68846922-68846944 GAAAAATACCTAATGCACATAGG + Intergenic
1150892551 17:69170125-69170147 TAAAAATAAAAAATTTAGCTGGG + Intronic
1151050064 17:70967877-70967899 GAATAACAACAAATGCTGTTGGG + Intergenic
1151088308 17:71406425-71406447 GAAAAATACAAAAAGTAGCTGGG - Intergenic
1151111909 17:71688549-71688571 TAAAAATAAAAAATTTAGCTGGG + Intergenic
1151488145 17:74415064-74415086 GAAAAATACATAAAGCAGCTGGG + Intergenic
1151524044 17:74651625-74651647 TAAAAATACCAAAGGTAGCTGGG - Intergenic
1151539155 17:74756100-74756122 GAAAAATACAAAAATCAGCTGGG - Intronic
1151647881 17:75446038-75446060 AAAAAAAAAAAAAAGCAGCTGGG + Intronic
1151717250 17:75837224-75837246 TAAAAATAAAAAATTTAGCTGGG - Intronic
1152096737 17:78277031-78277053 TAAAAATAACAAAATTAGCTGGG - Intergenic
1152128534 17:78461959-78461981 GAAACATATCAACTGCAGCCTGG + Intronic
1152173792 17:78772696-78772718 TAAAAATAAAAAAATCAGCTGGG - Intronic
1152212168 17:79008555-79008577 ATAAAATAAGAAATGGAGCTGGG + Intronic
1152220831 17:79064584-79064606 TAAAAATACAAAATTCAGCTGGG + Intergenic
1152388155 17:79987405-79987427 AAAAAATAAAAAATTTAGCTGGG - Intronic
1152440075 17:80302558-80302580 TAAAAATAATAAAAGCAGCTGGG + Intronic
1152447847 17:80356160-80356182 TAAAAATACCAAAAGTAGCTGGG - Intronic
1152603063 17:81274891-81274913 GAAAAATAAAAAGTGAGGCTGGG - Intronic
1152734194 17:81989045-81989067 TAAAAATACAAAAAGCAGCTGGG + Intronic
1152794503 17:82300501-82300523 TAAAAATACAAAATGTAGCTGGG + Intergenic
1153032592 18:728817-728839 CAAAAATCCGAAATGCAGCTGGG - Intronic
1153171826 18:2325498-2325520 GAAAACAAAAAAATGGAGCTGGG + Intergenic
1153280570 18:3410791-3410813 GAAAAAAAACAAAATTAGCTGGG - Intergenic
1153310677 18:3674457-3674479 AAAAAATAAAAAAATCAGCTGGG + Intronic
1153524809 18:5984907-5984929 GGAAAATAAAAACTGCTGCTTGG + Intronic
1153649886 18:7230462-7230484 AAAAGATAACAAAAGCAGCCCGG - Intergenic
1153850266 18:9087711-9087733 TAAAAAAAATAAAAGCAGCTGGG + Intergenic
1154061549 18:11065718-11065740 CATAAATATCAAATGCTGCTCGG + Intronic
1154511309 18:15105461-15105483 GAAAAATAACTAATCCATGTTGG + Intergenic
1154516808 18:15177864-15177886 TAAAGATAATAAATGCATCTTGG - Intergenic
1155047423 18:22114956-22114978 AAAAAATAAAAAAATCAGCTGGG - Intergenic
1155136164 18:22994884-22994906 AAAAAATAAAAAAATCAGCTGGG - Intronic
1155147749 18:23098007-23098029 TAAAAATACAAAAAGCAGCTGGG + Intergenic
1155423988 18:25686641-25686663 TAAAAATAAAAAAATCAGCTGGG + Intergenic
1155514456 18:26610415-26610437 TAAAAATAAAAAATTTAGCTGGG + Intronic
1155598823 18:27519193-27519215 TTAAAATAACACAAGCAGCTGGG - Intergenic
1155913065 18:31527351-31527373 GAGAAATGAGAAATGCAGTTAGG - Intronic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156175082 18:34534601-34534623 GACAAATACCAAATGCATATGGG - Intronic
1156964559 18:43074925-43074947 GAAAAATAGCTAATGCATATTGG + Intronic
1157001265 18:43528509-43528531 TAAAAAAAAAAAAAGCAGCTGGG + Intergenic
1157055161 18:44219418-44219440 AAAAAATAACAGATGCTGCAAGG + Intergenic
1157279209 18:46334566-46334588 AAAAAATAAAAAATGGGGCTGGG - Intronic
1157353374 18:46911509-46911531 GAAATATAACAAAGTCAGCCGGG - Intronic
1157976163 18:52329490-52329512 TAAAAATAACAAAAGGAGGTAGG - Intergenic
1158330223 18:56354309-56354331 GAAAAATAACCAATGGTACTAGG - Intergenic
1158330971 18:56361498-56361520 AAAATATAAGAAATGCAGCATGG - Intergenic
1158356560 18:56626971-56626993 AAAAAAAAAAAAATGTAGCTTGG - Intronic
1158488919 18:57892849-57892871 CAAAAATACAAAAAGCAGCTGGG - Intergenic
1158494745 18:57944424-57944446 AAAAAATAACATTTGCAGCTGGG - Intergenic
1158686883 18:59622638-59622660 TAAAAATACAAAATGTAGCTGGG + Intronic
1158739863 18:60128137-60128159 GAAAAATGAGAAATGGAGGTAGG + Intergenic
1158977955 18:62729399-62729421 GTAAAATACTAAATGAAGCTGGG + Intronic
1159048503 18:63394030-63394052 GAAAAAAACTAAAAGCAGCTGGG - Intronic
1159380160 18:67645986-67646008 AAAAAATAACAGATGCTGCAAGG + Intergenic
1159686288 18:71424530-71424552 GAAAAATAACTAATGCATGCTGG + Intergenic
1159688033 18:71447814-71447836 GAAAAATAGCTAATGCATGTTGG + Intergenic
1159901731 18:74053345-74053367 GAAAAAAAACTCCTGCAGCTAGG - Intergenic
1160221313 18:76979962-76979984 AAAAAAAAACAAAGGAAGCTTGG + Intronic
1160410051 18:78669099-78669121 AAAAAATAAAAAACGTAGCTGGG + Intergenic
1160590134 18:79939717-79939739 AAAAAATAACAGATGCTGGTGGG + Intronic
1160680437 19:409513-409535 CAACAGTAATAAATGCAGCTGGG + Intergenic
1160903950 19:1443570-1443592 TAAAAAAAACAAATGGAGCCGGG + Intergenic
1161378621 19:3952773-3952795 TAAAAATAAAAAATTTAGCTGGG - Intergenic
1161498674 19:4601136-4601158 AAAAAATAAAGAATGCAGCCTGG - Intergenic
1161533616 19:4805022-4805044 AAAAAAAAAAAAAAGCAGCTGGG + Intergenic
1161607642 19:5223544-5223566 AAAAAATCACAACCGCAGCTGGG - Intronic
1161949376 19:7459379-7459401 CAAAAATAAAAAATCTAGCTGGG - Intronic
1161951039 19:7468254-7468276 AAAAAAAAAAAAATGAAGCTGGG + Intronic
1162347228 19:10126163-10126185 GAAAAAAAAAAAAAACAGCTGGG + Intergenic
1162669126 19:12239559-12239581 AAAAAAAAAAAAATGCAACTTGG - Intronic
1162838107 19:13334871-13334893 GAAAAATAAAAAATGTAGCTGGG + Intronic
1162845866 19:13392048-13392070 GAAAAAAAAGAAAATCAGCTGGG + Intronic
1162882097 19:13667334-13667356 AAAAAAAAAAAAATGCTGCTGGG + Intergenic
1162884699 19:13687929-13687951 GAAAAATACAAAATTTAGCTGGG - Intergenic
1162900533 19:13793090-13793112 AAAAAATAAGAAAATCAGCTGGG - Intergenic
1163024743 19:14504216-14504238 GAAAAATACCAAAATTAGCTGGG - Intergenic
1163071693 19:14847960-14847982 TAAAAATACCAAATTTAGCTGGG + Intergenic
1163489777 19:17610303-17610325 GAAAAATACAAAAATCAGCTGGG + Intronic
1163531377 19:17851027-17851049 TAAAAATACAAAACGCAGCTGGG + Intergenic
1163789801 19:19300071-19300093 AAAAAATAAAAAATGAGGCTGGG - Intronic
1163802805 19:19377518-19377540 AAAAAATAAAAAATTTAGCTGGG - Intergenic
1163840446 19:19605253-19605275 TAAAAATACAAAATTCAGCTGGG + Intronic
1163842875 19:19622044-19622066 TAAAAATAAAAAATTTAGCTGGG + Intergenic
1163958792 19:20667763-20667785 TAAAAAAAACCGATGCAGCTGGG - Intronic
1164185335 19:22862177-22862199 GAAAAATAGAAAAAGTAGCTGGG - Intergenic
1164677141 19:30109130-30109152 GTACAATGACAAATGCAGCCAGG + Intergenic
1164784933 19:30922739-30922761 GGAAAAAAACAAATGCAAATTGG - Intergenic
1164808797 19:31139809-31139831 GAAACTTAACAAATGCATCCTGG - Intergenic
1164979377 19:32602239-32602261 AAATAATTACAAATGGAGCTTGG + Intronic
1164990803 19:32681861-32681883 AAAAAAAAAAAAAAGCAGCTAGG - Intergenic
1165201715 19:34150248-34150270 GAAAAATTAGAATTGTAGCTGGG - Intergenic
1165232866 19:34398207-34398229 TAAAAATAAAAAAATCAGCTGGG - Intronic
1165613213 19:37175130-37175152 GAAAAATAGCTAATGCATCCTGG + Intronic
1165702179 19:37947031-37947053 AAAAAATAAAAAATCTAGCTGGG + Intronic
1165710954 19:38010548-38010570 TAAAAATAACAAAATTAGCTGGG + Intronic
1165807772 19:38591974-38591996 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1166012635 19:39954143-39954165 GAAAAATACAAAAATCAGCTGGG - Intergenic
1166066803 19:40364801-40364823 AAAAAAAAAAAAAAGCAGCTGGG + Intronic
1166196398 19:41208579-41208601 TAAAAATAAGAAATTTAGCTGGG - Intergenic
1166530261 19:43538386-43538408 AACATATAACAGATGCAGCTGGG - Intergenic
1166549225 19:43654127-43654149 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1166610815 19:44194245-44194267 GAATAATAATAAATGCCACTAGG - Intergenic
1167230873 19:48282348-48282370 CTAAAATAACACATGCAGTTTGG - Intronic
1167273513 19:48520532-48520554 AAAAAAAAAAAAAAGCAGCTTGG - Intergenic
1167472140 19:49681208-49681230 GAAAAATAAGAACATCAGCTGGG - Intronic
1168111289 19:54192557-54192579 CAAAAAAGAAAAATGCAGCTGGG - Intronic
925464275 2:4092319-4092341 AAAAAATAACAAATGCTTATGGG - Intergenic
926058610 2:9791415-9791437 GAAAAATACAAAATTTAGCTGGG + Intergenic
926160533 2:10486002-10486024 GAAAAATCACACATGCATGTGGG - Intergenic
926412487 2:12618754-12618776 TAACAGTAAAAAATGCAGCTGGG - Intergenic
926466667 2:13198596-13198618 GAAAAATAAAGAATTCAGTTTGG - Intergenic
926663991 2:15499645-15499667 GAAAAATAACTAATGGGACTAGG + Intronic
926841391 2:17084523-17084545 GAAAAATAAGATAGGCACCTAGG - Intergenic
926897132 2:17704959-17704981 AAAAAAAAAAAATTGCAGCTGGG + Intronic
927443536 2:23137826-23137848 GATAAATAACTAATGCATTTGGG - Intergenic
927491422 2:23523643-23523665 GAATAATGGCAAAGGCAGCTGGG - Intronic
927525040 2:23731813-23731835 GAAAAATAAAAAAATTAGCTGGG + Intergenic
927614122 2:24572668-24572690 GTAAAATAGCAGGTGCAGCTCGG - Intronic
927907664 2:26872527-26872549 TAAAAATACAAAATTCAGCTGGG + Intronic
928472455 2:31587780-31587802 GACAAATACCAAATGCATGTGGG + Intergenic
928740105 2:34341565-34341587 GAAAAATAACAAACACTGGTAGG + Intergenic
928961977 2:36936039-36936061 GCAAAGTAACAAAAGCAGATAGG + Intronic
929182793 2:39061545-39061567 TAAAAATAACAAAATTAGCTGGG - Intronic
929350938 2:40954138-40954160 TAAAAATATTAAAAGCAGCTAGG + Intergenic
929352870 2:40981506-40981528 AAAAAATTACAAAATCAGCTGGG + Intergenic
930125606 2:47793889-47793911 GAAAAATACAAAAATCAGCTGGG - Intronic
930155256 2:48100372-48100394 GAAAAATAAAAAAAGTAGCTGGG + Intergenic
930324157 2:49893044-49893066 GAAAAGCAACAAATCCAGGTGGG - Intergenic
930685008 2:54298910-54298932 AAAAAATAAAAAAAGTAGCTGGG - Intronic
930695310 2:54405998-54406020 GAAAAATAGCAAATGCTATTAGG - Intergenic
930756661 2:54981173-54981195 TAAAAATAAGAGATGCGGCTGGG + Intronic
931289004 2:60856129-60856151 GAAAGAGAAGTAATGCAGCTAGG + Intergenic
931561167 2:63562401-63562423 GATAAATAACTAATGCATGTGGG + Intronic
931596312 2:63948559-63948581 GAAAAATAAAAAAATTAGCTGGG - Intronic
931787448 2:65632871-65632893 AAGAAATTACAAATGCAGCTAGG - Intergenic
932149342 2:69355236-69355258 AAAAAATAAAAAATTTAGCTGGG - Intronic
932150791 2:69369788-69369810 GAAAAATAATCATTGCAACTAGG - Intronic
932259543 2:70315514-70315536 TAAAAATAAAAAATGTAGATGGG - Intergenic
932527263 2:72484404-72484426 AAAAAAAAAAAAATTCAGCTGGG + Intronic
933168937 2:79103904-79103926 AACAAATAACAAATGCAGCAAGG + Intergenic
933660513 2:84923965-84923987 AAAAAAAAAAAAAAGCAGCTGGG + Intergenic
934072461 2:88397041-88397063 GAAAAATAAAAAAGTCAGCCAGG + Intergenic
934458905 2:94199912-94199934 TAAAAATACCAAAATCAGCTGGG + Intergenic
934584471 2:95478525-95478547 GAAAAATAAAACATGCAGAAGGG - Intergenic
934594981 2:95598190-95598212 GAAAAATAAAACATGCAGAAGGG + Intronic
934732914 2:96670623-96670645 CAAAAAAAAAAAATGTAGCTGGG + Intergenic
934787785 2:97027332-97027354 GAAAAATAAAACATGCAGAAGGG - Intergenic
935175759 2:100647539-100647561 GAAAAATGAAAAAAGCAGCCTGG + Intergenic
935460744 2:103330591-103330613 GATAAATAGCAAATGCACGTGGG - Intergenic
935689227 2:105715387-105715409 AAAAAAAAAAAAATGCAGCATGG + Intergenic
935850194 2:107210741-107210763 GAAAAATACAAAAATCAGCTGGG + Intergenic
935942621 2:108256872-108256894 GAAAAATAGCAAATCTAGATAGG + Intronic
935949789 2:108318151-108318173 AAAAAATAAAAAATTTAGCTGGG - Intergenic
935953019 2:108348068-108348090 AAAAAATAACAAATGCTGGCGGG - Intergenic
935974894 2:108568671-108568693 AAAGAATAACAAATGTAGGTGGG - Intronic
936768047 2:115877430-115877452 GACAAATACCAAATGCATGTGGG + Intergenic
936850200 2:116886871-116886893 GAAAAATACCTAATGCATGTGGG + Intergenic
937328848 2:121009522-121009544 GAGAAATCACAAATGCAATTTGG - Intergenic
937424553 2:121787966-121787988 AAAAAAAAAAAAAAGCAGCTGGG - Intergenic
937676987 2:124602179-124602201 GAAAAATACAAAAAGTAGCTGGG + Intronic
937838787 2:126503551-126503573 GAAAAATATCAAATACCGCAAGG + Intergenic
937873925 2:126806043-126806065 TAAAAATACAAAATGTAGCTGGG - Intergenic
938016051 2:127868033-127868055 CAAAAAATACAAATTCAGCTGGG - Intronic
938304073 2:130238623-130238645 TAAAAATACAAAATTCAGCTGGG - Intergenic
938344090 2:130554665-130554687 GAAAAATACAAAATATAGCTGGG - Intergenic
938345743 2:130566057-130566079 GAAAAATACAAAATATAGCTGGG + Intergenic
938452611 2:131435663-131435685 TAAAAATACAAAATTCAGCTGGG + Intergenic
938506523 2:131889918-131889940 GAAAAATAACTAATGCATGTTGG + Intergenic
938675547 2:133630013-133630035 GAAAAATAGCTAATGCATGTGGG + Intergenic
938773919 2:134524488-134524510 GATAAATAGCAAATGCATGTGGG - Intronic
939313112 2:140510252-140510274 GAAATATAACAATTATAGCTAGG - Intronic
939351966 2:141050456-141050478 GACAAATACCAAATGCATGTGGG - Intronic
939529946 2:143346083-143346105 GATTCATAAAAAATGCAGCTTGG - Intronic
939946574 2:148418133-148418155 GAAAAATAATAAATAAGGCTGGG - Intronic
940210853 2:151255252-151255274 TAAAAATAAAAAATTTAGCTGGG + Intronic
940211000 2:151256656-151256678 TAAAAATACAAAAAGCAGCTGGG + Intronic
940314227 2:152310423-152310445 GAAAAAAAAAAAAAGCAGCCAGG + Intergenic
940570033 2:155419624-155419646 TAAAAAAAAAAAATTCAGCTGGG + Intergenic
940710147 2:157153127-157153149 GAGTAATAACAAATGTAGCCAGG - Intergenic
940730287 2:157381548-157381570 GATAAACAACAAATGCTGCAAGG + Intergenic
940741530 2:157515056-157515078 GAAAGAAAAGAAATGCAGATTGG - Intergenic
941190954 2:162381057-162381079 GAAAAAATACAACTGGAGCTGGG + Intronic
941235100 2:162961877-162961899 GAAAAATAGCTAATGCATGTGGG + Intergenic
941345339 2:164361739-164361761 CAAATATACCAAGTGCAGCTTGG + Intergenic
941368211 2:164632942-164632964 TAAAATTAACAAATGCTCCTGGG + Intergenic
941497135 2:166219602-166219624 GAAAAATAACCAATGCATACTGG + Intronic
941833729 2:169992919-169992941 TAAAAATAAAAAATTTAGCTGGG - Intronic
941945978 2:171097761-171097783 TAAAAATAACAAAATTAGCTGGG + Intronic
942269370 2:174258617-174258639 GAAAAATAAAATATGCAGGGAGG + Intergenic
942282754 2:174383422-174383444 TAAAAATATCAAAATCAGCTGGG + Intronic
942286032 2:174417155-174417177 GAAAAATAGCTAATGCATGTGGG + Intronic
942313309 2:174676205-174676227 TAAAAATAATAAAAGCAGCCAGG - Intronic
942341213 2:174949659-174949681 GAAACATAAAAATTGCAGCCAGG - Intronic
942594789 2:177582747-177582769 AAAAAAAAAAAAAAGCAGCTAGG + Intergenic
942679838 2:178465676-178465698 GAAAAATAGCAAATACAACTTGG + Exonic
942746461 2:179239646-179239668 GGTAAACAACATATGCAGCTAGG + Intronic
943012909 2:182473599-182473621 GAAAAATAACTAATGATACTAGG - Intronic
943066537 2:183092348-183092370 GAAAAATAACTAATGCATGCTGG - Intronic
943109042 2:183583121-183583143 GACAAATAACTAATGCATTTGGG - Intergenic
943226253 2:185182480-185182502 GAAGAGTAGAAAATGCAGCTTGG + Intergenic
943510746 2:188824006-188824028 AAAAAATAACAAATGAAGCCAGG - Intergenic
943646759 2:190414151-190414173 GATAAATAACTAATGCATGTGGG + Intronic
943708541 2:191062213-191062235 GAAAAATAAAAAATGTATCCAGG - Intronic
943731775 2:191309595-191309617 GAGAAGTAACAAATGCAGTCAGG - Intronic
943936383 2:193921278-193921300 GAAAAATAACAAATGAATACTGG + Intergenic
944116037 2:196187158-196187180 GAAAAATAGCTAATGCATGTTGG - Intergenic
944299393 2:198105695-198105717 GAATAATGACAAATGCTTCTGGG + Intronic
944579609 2:201120179-201120201 AAAAAAAAAAAAATGTAGCTGGG - Intronic
944639351 2:201707424-201707446 AAAAAAAAAAAAATGTAGCTGGG - Intronic
944695649 2:202198011-202198033 TAAAAATACAAAAAGCAGCTGGG + Intergenic
944732540 2:202531921-202531943 AAAAAAAAAAAAATACAGCTGGG - Intronic
944752575 2:202725612-202725634 GAAAAATAATAAATGTGGCCAGG - Intronic
944778951 2:202997951-202997973 AAAAAATAAGAAATTTAGCTGGG - Intronic
944996983 2:205304638-205304660 AAAAAAAAAAAAATTCAGCTAGG + Intronic
945480972 2:210345395-210345417 GAAAAATACCTAATGCATGTGGG - Intergenic
945841165 2:214889750-214889772 AAAAAAAAAAAAATCCAGCTGGG + Intergenic
945991194 2:216396629-216396651 AAAAAAAAAAAAATGTAGCTGGG + Intergenic
946088444 2:217197861-217197883 TAAAAATACAAAATGTAGCTGGG + Intergenic
946204624 2:218094809-218094831 TAAGAATAACTAATTCAGCTGGG + Intergenic
946212040 2:218154994-218155016 GAAAAAGAGCAAATGCCCCTGGG - Intergenic
946509334 2:220337331-220337353 AAAAAAAAACAAATCCTGCTGGG + Intergenic
946530180 2:220562246-220562268 GAAAAATTACTAATGCACATGGG + Intergenic
946559119 2:220892664-220892686 GAAAAATAAAAAAATTAGCTGGG - Intergenic
946605937 2:221404799-221404821 AAAAAATAACAAATACAACGGGG - Intergenic
946878366 2:224152862-224152884 AAAAAATAACAGATGCTGGTGGG - Intergenic
947137195 2:226987209-226987231 GACAAATACCCAATGCATCTGGG + Intronic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
947505398 2:230704669-230704691 GAAAAATAAAAAAACTAGCTGGG - Intergenic
947822873 2:233084212-233084234 GAAAAATACAAAATTTAGCTGGG - Intronic
947852903 2:233302973-233302995 GAAAAATACAAAAATCAGCTGGG - Intergenic
948093946 2:235318669-235318691 AAAAAAAAAAAAATGTAGCTAGG + Intergenic
948245196 2:236476860-236476882 GAAAAATAGCTAATGCATGTGGG - Intronic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
948410056 2:237752406-237752428 AAAAAAGAAAAAATGCTGCTGGG + Intronic
948937488 2:241176933-241176955 TAAAAATACCACATGCAGCTGGG + Intronic
1168738974 20:172109-172131 GAAAAATAAAAAAATTAGCTGGG - Intergenic
1168744634 20:227810-227832 GAAAAATAGCTAATGCATCCTGG - Intronic
1168833729 20:862506-862528 TAAAAATAAAAAATTGAGCTGGG + Intergenic
1169286825 20:4315350-4315372 AAAAAAGAGCAAATGCAACTGGG + Intergenic
1169418449 20:5438713-5438735 GAAAAATAGCTGATGCAGCTGGG - Intergenic
1169492327 20:6081788-6081810 GAAAAGTGACATATTCAGCTAGG - Intronic
1169567204 20:6868240-6868262 GAAAAACAACTCATGTAGCTTGG - Intergenic
1169570468 20:6900130-6900152 TAAAAATACAAAATGTAGCTGGG - Intergenic
1170005160 20:11660283-11660305 CATAAGTAACAAATTCAGCTAGG + Intergenic
1170011980 20:11734055-11734077 GAAAAATAGCTAATGCAGGCTGG + Intergenic
1170187103 20:13603068-13603090 TAAAAATACAAAAAGCAGCTGGG + Intronic
1170644528 20:18185494-18185516 CAAAAATAAAATATGTAGCTAGG - Intronic
1170717485 20:18844527-18844549 AAAAAATAAGAAATGTAGTTTGG + Intergenic
1170988781 20:21283172-21283194 GAAAAAGAACAAATGGAGAAAGG - Intergenic
1171165027 20:22962241-22962263 GAAAAATCAGAAATGAGGCTGGG - Intergenic
1171397280 20:24844250-24844272 GACAAATACCTAATGCAGGTGGG - Intergenic
1172044230 20:32068628-32068650 GAAAAATCACACTTTCAGCTGGG + Intronic
1172074879 20:32288041-32288063 TAAAAATACCAAAATCAGCTGGG - Intronic
1172170007 20:32924357-32924379 TAAAAACAACACATGTAGCTGGG - Intronic
1172207226 20:33172271-33172293 GACAAATACCTAATGCAGGTGGG + Intronic
1172415521 20:34764077-34764099 CAAAAAAAAAAAATGTAGCTGGG - Intronic
1172638152 20:36423797-36423819 CAAAAATACAAAATGTAGCTGGG + Intronic
1172649846 20:36495150-36495172 TAAAAATAAAACATGCAGCTGGG - Intronic
1172660618 20:36565875-36565897 GAAAAATAAAAAATTAAGCCAGG - Intergenic
1172737170 20:37135591-37135613 AAAAAATAAAAAATTTAGCTGGG + Intronic
1172907784 20:38381815-38381837 AAGAAAGAAGAAATGCAGCTGGG - Intergenic
1173366423 20:42389692-42389714 AAAAATTAAGAAATACAGCTGGG + Intronic
1173416185 20:42858269-42858291 CAAATATAACAAAGACAGCTGGG + Intronic
1173477057 20:43367343-43367365 GAAAAATACAAAAATCAGCTGGG - Intergenic
1173512986 20:43644944-43644966 TAAAAATAAAAAAATCAGCTGGG + Intronic
1173655376 20:44696821-44696843 GAAAAAAAATGAATGGAGCTGGG + Intergenic
1173874385 20:46360842-46360864 AAAAATCAACAAATGCAGCCGGG - Intronic
1173881617 20:46417486-46417508 AAAAAATAAAAAATGCATCGAGG + Intronic
1174659151 20:52195573-52195595 GAAAAATAAGAAATGAAAATAGG - Intronic
1175082186 20:56429818-56429840 GAAAAATTATAAGTGCAGTTGGG - Intronic
1175207701 20:57324117-57324139 CAAACATAACAAATGCCGCATGG + Intergenic
1177495540 21:21885327-21885349 TAAAAAAAGAAAATGCAGCTGGG - Intergenic
1177692065 21:24523297-24523319 GATAAATAACTAATGCACGTGGG - Intergenic
1177879329 21:26673456-26673478 GAAAATTTAAAAATGTAGCTGGG - Intergenic
1177943858 21:27443554-27443576 AATAACTATCAAATGCAGCTGGG + Intergenic
1177985716 21:27972459-27972481 GAAAAATAACTAATGCATGTTGG - Intergenic
1178365875 21:31988356-31988378 GGAAAATGTCAAATCCAGCTAGG + Intronic
1178616726 21:34141066-34141088 GAAAAGGAACAAATTCAGCAAGG - Intronic
1178802436 21:35808597-35808619 GAAAAATAACAGATGCAGGGAGG + Intronic
1178870867 21:36374248-36374270 TAAAAATACAAAATGTAGCTGGG - Intronic
1178875459 21:36410819-36410841 TAAAAATAAAAAAAGTAGCTGGG - Intronic
1178951816 21:36991411-36991433 AAAAAATGACAAATAGAGCTGGG + Intergenic
1178982585 21:37277363-37277385 GAAAAATACAAAAATCAGCTGGG + Intergenic
1178999277 21:37440430-37440452 GAAAAAGAGCAAATGAAGCTGGG - Intronic
1179543525 21:42099839-42099861 GAAAAATAAAAAATTTAGCCTGG - Intronic
1179787211 21:43736791-43736813 GAAAAATAGCAAAATTAGCTCGG - Intronic
1180747189 22:18097834-18097856 GAAAAATAAAAAAATCATCTGGG - Exonic
1181357306 22:22306544-22306566 TAAAAATACCAAAATCAGCTGGG - Intergenic
1181682577 22:24506012-24506034 AAAAAAAAAAAAATGCAGTTAGG - Intronic
1181739281 22:24907506-24907528 AACAAAAAACAAAGGCAGCTGGG - Intronic
1181817628 22:25450577-25450599 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
1182251133 22:29001630-29001652 GAAAAATAAAAAAATTAGCTGGG - Intronic
1182298462 22:29324765-29324787 AAAAAAAAAAAAAGGCAGCTGGG + Intergenic
1182533884 22:30985430-30985452 GAAAAAAAAAAAAATCAGCTGGG - Intergenic
1182833129 22:33319899-33319921 GAACATTTCCAAATGCAGCTTGG + Intronic
1183122075 22:35737913-35737935 GAAACGAAACAAATGCAGCAAGG + Intergenic
1183161981 22:36120506-36120528 AAAAATTAAAAAATTCAGCTGGG + Intergenic
1183168864 22:36169657-36169679 TAAAAATACAAAAAGCAGCTTGG + Intergenic
1183396675 22:37575617-37575639 GAAAAAAAAAAAAATCAGCTGGG - Intronic
1183488084 22:38100363-38100385 TAAAAATAAAAAAATCAGCTGGG + Intronic
1183523851 22:38312247-38312269 GAAAAATATAAAAAGTAGCTGGG - Intronic
1183536794 22:38406644-38406666 GAAAAAAGAGAAATACAGCTGGG - Intergenic
1183560893 22:38571494-38571516 GAAATATAACATATGTAGTTTGG + Intergenic
1184017451 22:41796784-41796806 GAAAAATACCAAAATTAGCTGGG + Intronic
1184083700 22:42244920-42244942 AAAAAATACCAAAATCAGCTGGG + Intronic
1184213743 22:43052578-43052600 AAAAAATAAAAAATTTAGCTGGG + Intronic
1184327350 22:43799025-43799047 TAAAAATACACAATGCAGCTGGG + Intronic
1184461982 22:44643516-44643538 GAAAAAAAAAAAAAGCAGCCGGG + Intergenic
1184582602 22:45427793-45427815 AAAAAATACAAAAAGCAGCTGGG - Intronic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
1184882652 22:47320482-47320504 CATAAAAAACAAATGCACCTAGG - Intergenic
1185096721 22:48810964-48810986 GAAAAATATAAAATTTAGCTGGG + Intronic
1185118463 22:48951519-48951541 AAAAAAAAACAAATGTAGCCAGG + Intergenic
1185120594 22:48966660-48966682 GAAAGAAAACAAATACAGATTGG + Intergenic
1185407199 22:50659632-50659654 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
949393753 3:3592565-3592587 AAAAAATAACAGATGCAGTGAGG + Intergenic
949990651 3:9576302-9576324 TAAAAATACAAAATGTAGCTGGG + Intergenic
950085674 3:10255779-10255801 CAAAAATACGAAATGTAGCTGGG + Intronic
950293664 3:11808880-11808902 CAAAAATTACAAAAGTAGCTGGG - Intronic
950352768 3:12373392-12373414 GAAAAATAAGAAAACCATCTAGG + Intronic
950733716 3:14987241-14987263 AAAAAATAAAAAAACCAGCTGGG - Intronic
950866609 3:16194857-16194879 GATAAATAACTAATGCATGTGGG + Intronic
951205238 3:19919356-19919378 AAAAAAAAAAAAAAGCAGCTGGG - Intronic
951548501 3:23853186-23853208 GAAAAAGAAATAAGGCAGCTGGG - Intronic
951574459 3:24099710-24099732 TAAAAATACCAAAGTCAGCTGGG - Intergenic
951657103 3:25021599-25021621 GAAAAATAAACAATTCATCTTGG + Intergenic
951783697 3:26393645-26393667 GACAAATACCAAATGCATGTGGG + Intergenic
951805419 3:26638569-26638591 GAAAAATAAGACCTGCAGATGGG + Intronic
952060974 3:29509667-29509689 GAAGGATACCAAAGGCAGCTTGG - Intronic
952102354 3:30029184-30029206 GAAAAATAAAAAAGGTAGCTAGG - Intergenic
952446539 3:33386262-33386284 GACCAAAAACAAAAGCAGCTCGG + Exonic
953301551 3:41781776-41781798 TAAAAATACAAAATTCAGCTAGG + Intronic
953751786 3:45614560-45614582 GAAAAATAAAAAAATTAGCTGGG + Intronic
954557395 3:51528959-51528981 GAAATATAACAAATCCAAATTGG - Intergenic
954585635 3:51733834-51733856 GAAAAATAGCTAATGCATGTGGG - Intergenic
954653520 3:52179595-52179617 GAAAAAAAACAAAATTAGCTGGG - Intergenic
955276318 3:57550671-57550693 GAAAAAAAAAAAATTTAGCTGGG - Intergenic
955324781 3:58001561-58001583 GAAAAATAACTAATGCATACTGG + Intergenic
955741982 3:62100894-62100916 GAAAAAGAACAAAAGAAGCGTGG - Intronic
955799688 3:62672778-62672800 GAAAAATACAAAAATCAGCTGGG - Intronic
956049981 3:65237444-65237466 GAAAAATAACTAATGCATGCTGG - Intergenic
956150395 3:66236070-66236092 AAAAAATAAAAAATTAAGCTGGG - Intronic
956477814 3:69641872-69641894 AAAAAATAACAAATGCTGCAAGG + Intergenic
956492609 3:69789693-69789715 TAAAAATAAAAAATTTAGCTGGG + Intronic
956599946 3:71009907-71009929 AAAAAAAAAAAAATTCAGCTGGG - Intronic
956694715 3:71908414-71908436 AAAAAAAAAAAAGTGCAGCTGGG - Intergenic
956727913 3:72171761-72171783 AAAAAAAAAAAAATGCTGCTTGG + Intergenic
957019629 3:75110977-75110999 GAAAAATACTAAATACAGCTAGG - Intergenic
957134220 3:76264102-76264124 GAAAAATATCTAATGCATGTGGG + Intronic
957158797 3:76581475-76581497 CAAAAATAAAAAAATCAGCTAGG + Intronic
957175144 3:76798730-76798752 GAAAAATACAAAAAGTAGCTAGG + Intronic
957377773 3:79381061-79381083 GTAAAATAAGAAATGCGGCTGGG + Intronic
957390535 3:79560926-79560948 GAACAATGATAAATGCAGTTGGG - Intronic
957936110 3:86944739-86944761 GGAAAATAAGAAATGGAGCTAGG + Exonic
958267995 3:91462600-91462622 AAAAAATAAAAAAATCAGCTGGG - Intergenic
958484203 3:94682552-94682574 GAAAAATAACTAATGCATGCTGG + Intergenic
958747312 3:98152682-98152704 GACAAATAACTAATGCATGTGGG + Intergenic
958821219 3:98975942-98975964 GAAAAATAGCTAATGCATCTTGG + Intergenic
958841999 3:99217405-99217427 GAAAAATAAAAAAATCATCTTGG - Intergenic
959174459 3:102888830-102888852 GAAAAAAAAAAAATCCAGCAAGG + Intergenic
959235433 3:103715995-103716017 GAAAAATAGCTAATGCATGTTGG - Intergenic
959430742 3:106251977-106251999 TAGAAATAAGAAATGCAGCCGGG + Intergenic
959821122 3:110736831-110736853 AAAAAATAAAAAATTTAGCTGGG - Intergenic
960112468 3:113858385-113858407 AAAAAAAAAAAAATGTAGCTGGG - Intronic
960120287 3:113942207-113942229 AAAAAAAAAAAATTGCAGCTGGG - Intronic
960490246 3:118308688-118308710 GAAAGATATAAAATGAAGCTGGG + Intergenic
960514572 3:118589529-118589551 AAAAAAAAAAAAAAGCAGCTTGG + Intergenic
960573725 3:119209325-119209347 GAAAAATTACAGATGGAGTTGGG + Intergenic
960779880 3:121308132-121308154 GATAAATAACTAATGCATGTGGG + Intronic
960782635 3:121336600-121336622 AAAAAATAACAGATGCTGCAAGG + Intronic
961107128 3:124251528-124251550 AAAAAATACCAAAAGTAGCTGGG - Intronic
961137173 3:124522035-124522057 GAAAAATAAGAAAGGAAGGTAGG + Intronic
962168092 3:133071550-133071572 GAAAAATATTAAATGAATCTGGG - Intronic
962299329 3:134224120-134224142 GAAATAGAAAAAAGGCAGCTGGG + Intronic
962505474 3:136042369-136042391 GAAAAATAGCTAATGCATATTGG + Intronic
962542303 3:136394949-136394971 AAAAAAAAAAAAATGTAGCTAGG + Intronic
962543661 3:136409780-136409802 GAAAAAAGATAAATTCAGCTGGG + Intronic
962586864 3:136850696-136850718 AAAAAAAAAATAATGCAGCTGGG + Intronic
962994099 3:140607832-140607854 GAAAAATAACAAATATATTTGGG + Intergenic
963053185 3:141159854-141159876 GAAAAATGTTAAAGGCAGCTAGG + Intergenic
963132793 3:141874242-141874264 GAAAAATAAAAAAATTAGCTGGG + Intergenic
963395096 3:144722106-144722128 GAAATAAAATAAATCCAGCTTGG - Intergenic
963554854 3:146774113-146774135 GCAAAATAACAGATGGGGCTAGG - Intergenic
963658335 3:148089224-148089246 AAAAAAAAAAAAGTGCAGCTAGG - Intergenic
964412265 3:156410194-156410216 GACAAATAAAAAATGCAGTAAGG - Intronic
964486992 3:157196261-157196283 GAAAAATAGCTAATGCATGTGGG + Intergenic
964589566 3:158345065-158345087 AAAAAAAAAAAAATGTAGCTGGG + Intronic
964774333 3:160258945-160258967 AAAAAATAAAAAAAGTAGCTGGG + Intronic
964774555 3:160261638-160261660 AAAAAATAAAAAATTTAGCTGGG + Intronic
964800968 3:160556974-160556996 AAAAAATAAAAAATTTAGCTGGG - Intronic
965350432 3:167605487-167605509 GAAAAAAAACAGATGCAGTCTGG + Intronic
965468410 3:169060701-169060723 GAATAATAACAGAAGCAGCATGG + Intergenic
965597846 3:170425524-170425546 AAAGAAAAACAAATTCAGCTAGG - Intronic
965844241 3:172943577-172943599 TAAAAATACAAAATGTAGCTGGG + Intronic
966010344 3:175067584-175067606 AAAAAATAACAGATGCTGCAGGG + Intronic
966481372 3:180412665-180412687 TAAAAATAAAAAAATCAGCTGGG + Intergenic
966566695 3:181390614-181390636 GAAAAATAACTAATGCATGCTGG - Intergenic
966611874 3:181875634-181875656 TAAAAATAAAAAAATCAGCTGGG + Intergenic
966648690 3:182274693-182274715 AAAAATTAACAAAATCAGCTGGG + Intergenic
966721884 3:183071860-183071882 AAAAAAAAAAAAATTCAGCTGGG - Intronic
966832268 3:184019883-184019905 GAAAAATACAAAAATCAGCTGGG - Intergenic
966893900 3:184428036-184428058 TAAAAATAAAAAAATCAGCTGGG + Intronic
967227453 3:187305627-187305649 AAAAAAAAATAAATCCAGCTTGG + Intergenic
967310749 3:188103852-188103874 TTAAAACAACAAATGCAGCTGGG - Intergenic
967433246 3:189413622-189413644 GAAAGGTAACAAATGTTGCTAGG - Intergenic
967670831 3:192233202-192233224 AAAAAATAACAGATGCTGGTGGG - Intronic
968188347 3:196649293-196649315 GAAAAAGAGCAATTGCACCTGGG - Intronic
968328911 3:197846558-197846580 CAAAAAAAACAAAGACAGCTGGG + Intronic
968498149 4:930297-930319 TAAAAATAACCAATGCAATTAGG - Intronic
968638545 4:1696903-1696925 AAAAAAAAACAAACGCTGCTGGG + Intronic
969139844 4:5059044-5059066 AAAAAAAAAAAAAAGCAGCTGGG - Intronic
969267674 4:6075500-6075522 GAAAAAGAAAAAATGCTGGTGGG + Intronic
969451990 4:7279262-7279284 GAAAAACATCAGATGGAGCTAGG + Intronic
969841359 4:9885050-9885072 GAAAAATAGCTAATGCAGGCTGG + Intronic
970008639 4:11434425-11434447 GAAAAATAGCTAATGCATGTGGG - Intergenic
970124348 4:12792519-12792541 GAAAAATACCTAATGCAGGTTGG + Intergenic
970335873 4:15041561-15041583 TAAAAATAAAAAATTTAGCTGGG - Intronic
970640593 4:18061459-18061481 AAAAAAAAAAAAAGGCAGCTAGG + Intergenic
970647888 4:18144261-18144283 TAAAAATACAAAAAGCAGCTGGG - Intergenic
970649548 4:18161133-18161155 GAAAAATACCAAATTCAGTTAGG + Intergenic
971038647 4:22725027-22725049 GAAAAATAGCTAATGCATGTGGG - Intergenic
971138795 4:23900927-23900949 AAGAAATAAAAAATCCAGCTGGG + Intronic
971208914 4:24597380-24597402 GAAAAAGAAAAAATGAAGCAGGG - Intergenic
971399563 4:26263481-26263503 GGAAAATAACAATTGTAGCAAGG - Intronic
972028762 4:34424148-34424170 GAAAAATACCTAATGCATTTGGG + Intergenic
972167959 4:36310648-36310670 AAAAAAGAACCAATGAAGCTTGG - Intronic
972541084 4:40039895-40039917 GAAAAATACAAAATTTAGCTGGG + Intergenic
972601747 4:40579125-40579147 AAAAAAAAAAAAATGCAGCCAGG + Intronic
972683755 4:41331949-41331971 AAAAAATAAAAAATTTAGCTGGG + Intergenic
972774763 4:42230615-42230637 GAAAAAAAAAAAAAGCACCTAGG + Intergenic
972798513 4:42447341-42447363 TAAAAATAACAAAATTAGCTGGG - Intronic
972858899 4:43142531-43142553 GAAAAATAACTAATGCATGCTGG + Intergenic
972863154 4:43196792-43196814 GAAAACTCAGAAATGCAGATAGG + Intergenic
973022722 4:45223891-45223913 AAAAAATAACAAATGCTACCAGG + Intergenic
973081298 4:45997197-45997219 GAGAAAGAACAAATACAGCAGGG - Intergenic
973238531 4:47932334-47932356 AAAAAAAAAAAAATGTAGCTAGG + Intronic
973657589 4:53065509-53065531 GAAAAATAACAAATTCTTTTAGG - Intronic
974052907 4:56957778-56957800 CAAAAATAAAAAATTTAGCTGGG + Intergenic
974058878 4:57012242-57012264 TAAAAATAAAAAAATCAGCTGGG + Intronic
974363284 4:60911922-60911944 GGAAAATAATAAAAGCAGCAGGG + Intergenic
974454606 4:62110782-62110804 AAAAAGAAACAAATCCAGCTGGG - Intergenic
975889120 4:79003637-79003659 GAAAAATAGCTAATGCATGTTGG + Intergenic
976181677 4:82405335-82405357 TAAAAATAACAAAATTAGCTGGG - Intergenic
976199687 4:82565966-82565988 GATAAACAACAAAATCAGCTGGG + Intergenic
976302491 4:83528497-83528519 GAAAAATTAAAAATTTAGCTGGG + Intergenic
976308332 4:83583685-83583707 AAAAAAAAAAAAATGAAGCTGGG + Intronic
976598595 4:86917117-86917139 AAAAAATAACAAAATTAGCTGGG + Intronic
976606215 4:86985513-86985535 AAAAAAAAAAAAATGTAGCTCGG + Intronic
976845229 4:89481401-89481423 GACAAATAACTAATGCATGTGGG + Intergenic
977141417 4:93376850-93376872 GAAAAATAACTAATGCATACTGG + Intronic
977192996 4:94023567-94023589 GAAAAATAACTAATGCATGCTGG + Intergenic
977398318 4:96499409-96499431 GAAAAATACCTAATGCATGTGGG - Intergenic
977407922 4:96623598-96623620 GAAAAATAAAAAATGAGTCTGGG - Intergenic
977645671 4:99408856-99408878 GACAAATACCTAATGCATCTGGG - Intergenic
977650651 4:99464714-99464736 GAAAAAAAACAAATCAAGCCTGG - Intergenic
977984867 4:103371171-103371193 GACAAATAACTAATGCACGTGGG - Intergenic
978125128 4:105126004-105126026 GAAAAATTAAAAAAGTAGCTGGG - Intergenic
978388812 4:108203231-108203253 TAAGAATAACAAATCCAGCCTGG - Intergenic
978597648 4:110395674-110395696 GAAAGTTCAGAAATGCAGCTTGG - Intronic
978821981 4:112977689-112977711 GAAAAATACCTAATGCATGTGGG - Intronic
978840457 4:113206208-113206230 GAAAACTAACTAATGCATTTTGG - Intronic
978845131 4:113264559-113264581 GAAAAATACAAAAATCAGCTGGG + Intronic
978887563 4:113783318-113783340 GAAAAATAAGAAAATTAGCTGGG + Intergenic
979012295 4:115387339-115387361 GAAAAGTAACTCCTGCAGCTAGG - Intergenic
979373018 4:119912058-119912080 GAAAAATAACTAATGGTACTAGG - Intergenic
979534819 4:121807645-121807667 CCAAAATTACAAATGCAGCTAGG + Intronic
979650023 4:123117714-123117736 GAGAAAAAAAAAATGCAGGTTGG + Intronic
979701258 4:123670295-123670317 GAAAAAAAGAAAATGCAGATTGG - Intergenic
979798652 4:124877846-124877868 AAAAAAGAACACAGGCAGCTGGG - Intergenic
979804476 4:124953978-124954000 GAAATATAACACTTGCAACTTGG - Intergenic
979872974 4:125849904-125849926 GGAAAATATCAAAATCAGCTGGG - Intergenic
980105241 4:128582116-128582138 AAAAAATAAAAAATTTAGCTGGG - Intergenic
980140292 4:128907542-128907564 TAAAAATAAAAACTTCAGCTAGG + Intronic
980300343 4:130983146-130983168 TAAAAATAAAAAAAGTAGCTAGG + Intergenic
980326021 4:131347507-131347529 CAAAAACAAAAAATGTAGCTTGG - Intergenic
980379814 4:131998385-131998407 GAAAAACAACAAATTATGCTGGG + Intergenic
980712063 4:136581972-136581994 TAAAAATAAGAAATTTAGCTGGG - Intergenic
980820824 4:138014442-138014464 GAGAAACAAAAAATGCAGTTAGG + Intergenic
981338852 4:143596938-143596960 AAAAAATAAAAAATCAAGCTAGG + Intronic
981465674 4:145068747-145068769 TAAAAATACAAAATGTAGCTGGG + Intronic
981519703 4:145648823-145648845 GAAAAATAAAAAAATTAGCTGGG + Intronic
981765201 4:148241008-148241030 GAAAAAAATAAAATCCAGCTGGG + Intronic
981950903 4:150405892-150405914 GAAAAATAAAAAACTTAGCTGGG + Intronic
982030389 4:151294711-151294733 TAAATATAACAAATCAAGCTGGG + Intronic
982038948 4:151375965-151375987 TAAAAATAACAAAATTAGCTGGG - Intergenic
982284347 4:153719074-153719096 GAAAAATAGCTAATGCATGTGGG - Intronic
982646607 4:158031844-158031866 AAAAAATAACAGATGCTGGTAGG + Intergenic
982728517 4:158930650-158930672 TAAAAATAAAAAATTTAGCTGGG - Intronic
982778927 4:159470017-159470039 GAAAAATAGCGAATGCTGCTGGG - Intergenic
982974539 4:162037450-162037472 GAAGAATCACACATACAGCTTGG + Intronic
983028253 4:162764641-162764663 GAAAAATAACTAATGGTACTAGG + Intergenic
983261413 4:165460962-165460984 TAAAAATAACAAACCCAGCCTGG + Intronic
983468161 4:168122001-168122023 GAAAAATACCAAAAGTAGCCGGG - Intronic
983664737 4:170168276-170168298 CAAAAATATCAAAAGAAGCTAGG - Intergenic
983749312 4:171245508-171245530 GATAAATAACTAATGCATGTGGG - Intergenic
984682033 4:182622063-182622085 GAAAAATAATAATTGCGGCAGGG + Intronic
984979173 4:185261335-185261357 TAAAAATACAAAATGTAGCTGGG - Intronic
985140299 4:186832663-186832685 GCAAAAAAACAAAAGCAGATGGG - Intergenic
985254942 4:188060674-188060696 GAAAACCAACAACTGAAGCTTGG + Intergenic
986365776 5:7029121-7029143 GAAAAATAGCTAATGCATGTTGG + Intergenic
986583184 5:9286775-9286797 GAAAAATGGCAAATTCATCTTGG + Intronic
986678303 5:10209584-10209606 TAAAAATCACAAAGACAGCTTGG + Intergenic
986927552 5:12775569-12775591 GAAAACTAACATATTCATCTTGG - Intergenic
986991768 5:13561958-13561980 GAAAAATAGCTAATGCATCCTGG + Intergenic
987085950 5:14467813-14467835 AAAAAATAAAAAAAGGAGCTTGG + Intronic
987189221 5:15456915-15456937 GAAAAATAGCTAATGCATGTGGG - Intergenic
987256496 5:16158821-16158843 GAAAAATAACGAATGCATGCTGG - Intronic
987290478 5:16504016-16504038 GAAAAATAACTAATGCATGCTGG - Intronic
987444191 5:17996684-17996706 GAAACAAAACAAGTGCATCTTGG + Intergenic
987451067 5:18084644-18084666 GAACAATAAGAACTGCTGCTTGG + Intergenic
987484729 5:18510637-18510659 GAAAAATAGCTAATGCATGTCGG + Intergenic
987738360 5:21873748-21873770 GAAAAATAGCTAATGCATGTTGG - Intronic
987965113 5:24862812-24862834 AGAAAAAAGCAAATGCAGCTTGG + Intergenic
988237632 5:28566018-28566040 GAAAAATTACAGATGCTGCAAGG + Intergenic
988537891 5:32085245-32085267 AAAAAAAAAAAAAGGCAGCTGGG - Intronic
988594851 5:32582073-32582095 GAAAAAGAAAAAAATCAGCTGGG - Intronic
989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG + Intronic
989227420 5:39046201-39046223 AAAAAAAAACAAAAACAGCTGGG + Intronic
989366563 5:40662517-40662539 GACAAATACCAAATGCATGTGGG + Intergenic
990020926 5:51126901-51126923 AAAAAATAACAAATGTAGACGGG - Intergenic
990129118 5:52557745-52557767 GGAAGATAATAAATTCAGCTTGG + Intergenic
990164641 5:52981208-52981230 GAAAAATTACACATGCAGCAGGG + Intergenic
990354215 5:54949912-54949934 AAAAAAAAAAAAATTCAGCTTGG + Intergenic
990464825 5:56061842-56061864 GAAAAATAAAAAAATCAGCCAGG - Intergenic
990666780 5:58081445-58081467 GAAAAAGAAGAAATGCACGTGGG + Intergenic
990877306 5:60500142-60500164 GAAAAATAAAAAAATTAGCTGGG + Intronic
991070305 5:62471122-62471144 AAAAAAAAAGAAATGCAACTAGG - Intronic
991163038 5:63527484-63527506 GAAAAATATCTAATGCATGTAGG + Intergenic
991293297 5:65054542-65054564 AAAAAAAAAAAAAAGCAGCTGGG - Intergenic
991385573 5:66085124-66085146 TAAAAATAACAAAATTAGCTGGG - Intergenic
991627101 5:68614620-68614642 TAAAAATAAAAAAAGTAGCTGGG + Intergenic
991708381 5:69382283-69382305 CAAAAATAAAAAAATCAGCTAGG + Intronic
992633776 5:78707755-78707777 GAAAAATAAAAAAATTAGCTGGG - Intronic
992657893 5:78928609-78928631 CAAAAATAGCAAAAGCAGCCGGG - Intronic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
993384684 5:87251003-87251025 GATAAATAACTAATGCATATGGG - Intergenic
993556670 5:89348104-89348126 AAAAAATAACAGATGCTGGTGGG + Intergenic
993971529 5:94425763-94425785 AAAAAATAACAAATGCTGTGAGG - Intronic
994143937 5:96371910-96371932 GAATGATAACAAAGGCAGCCTGG - Intergenic
994705608 5:103202223-103202245 AAAATATTACATATGCAGCTGGG + Exonic
995026828 5:107433466-107433488 CAAAAGTAACAACTGAAGCTGGG + Intronic
995230226 5:109752858-109752880 GATTATTAACAAATGGAGCTGGG + Intronic
995315670 5:110769487-110769509 AAAAAAAATGAAATGCAGCTGGG - Intergenic
995607606 5:113874094-113874116 GAAAAATAAAAAATGCAGGAAGG + Intergenic
995765949 5:115619054-115619076 GAAAAATAAAAAATGTAGCATGG + Intronic
995864754 5:116679044-116679066 AAAAAAGAATAAATTCAGCTGGG - Intergenic
995875459 5:116784555-116784577 GAAATATAACACATGAGGCTTGG - Intergenic
995894340 5:116994904-116994926 GAAAAATAGCTAATGCATGTGGG + Intergenic
995992631 5:118261287-118261309 CAAGTATAAAAAATGCAGCTAGG - Intergenic
996363747 5:122678046-122678068 AAAAAATCCCAAATTCAGCTGGG - Intergenic
996664443 5:126042501-126042523 AAATAAAAACAAATGCTGCTTGG + Intergenic
997100758 5:130966339-130966361 GAGAAATTAAAGATGCAGCTGGG + Intergenic
997248104 5:132369097-132369119 GAAAAAAAAAAAAAGCAGCGAGG - Intergenic
997321397 5:132981924-132981946 TAAAAATAAAAAAATCAGCTGGG - Intergenic
997496396 5:134330552-134330574 AAAAAATACAAAATGTAGCTGGG + Intronic
997540253 5:134655747-134655769 CAAAGGTATCAAATGCAGCTCGG - Intronic
997953550 5:138260766-138260788 GAAAAAAAAAAAATGCAACTGGG + Intronic
998118379 5:139556451-139556473 GAAAAATAACAAATTAAAGTAGG + Intronic
998218463 5:140255476-140255498 CAAAAATAAAAAAATCAGCTGGG + Intronic
998232394 5:140369160-140369182 AAAAAATAAAAAAGGTAGCTGGG + Intronic
998259062 5:140614211-140614233 AAAAAACAACAAATGCGGCCAGG + Intergenic
998277662 5:140773527-140773549 GAAAAATAGCTAATGCATGTGGG - Intergenic
998301085 5:141021113-141021135 GAAAACTTAGAAATGCAGGTAGG + Intergenic
998632298 5:143912600-143912622 AAAAGAAAACAAAAGCAGCTAGG + Intergenic
998691006 5:144588407-144588429 GGAAAACTACAAATGCAGTTTGG + Intergenic
998870500 5:146546897-146546919 AAAAAAGAACAAAGGCAGCCAGG - Intergenic
999057263 5:148591791-148591813 AAAAAATAACAGATGCTGCAAGG + Intronic
999529456 5:152446372-152446394 GAAAAATAGCTAATGCATGTTGG - Intergenic
999802646 5:155052136-155052158 AAAAAATACAAAATGTAGCTGGG + Intergenic
999963278 5:156780086-156780108 GAAAAAGAAAAATTCCAGCTGGG + Intergenic
1000091868 5:157936755-157936777 GAAAAATAGCTAATGCATGTGGG - Intergenic
1000317012 5:160102116-160102138 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1000317056 5:160102409-160102431 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1000886360 5:166752248-166752270 GAAAAATAGCAAATGCATGCTGG - Intergenic
1001090124 5:168733661-168733683 GACAAATACCTAATGCATCTAGG + Intronic
1002191544 5:177480642-177480664 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
1002320639 5:178373574-178373596 TAAAAATAAAAAAAGTAGCTGGG - Intronic
1002514187 5:179744764-179744786 GAAAGAGAGCAAAAGCAGCTGGG - Intronic
1002825963 6:774617-774639 GAAAAAGGAAAAATGCAGGTGGG - Intergenic
1003021943 6:2517441-2517463 GAAAAATAACAAAAGGAATTGGG - Intergenic
1003200196 6:3952410-3952432 AAAAAATAACAAATGCTGGCAGG - Intergenic
1003216683 6:4119614-4119636 TAAAAATAACACATGAAGCCAGG - Intronic
1003638399 6:7855687-7855709 AAAAAATAAAAAATTTAGCTGGG - Intronic
1003895236 6:10601168-10601190 CATAAATAACAGAAGCAGCTGGG + Intronic
1004175458 6:13335898-13335920 AAAAAATAAAAAATTTAGCTGGG + Intergenic
1004385956 6:15172902-15172924 TAAAATTAAAAAATACAGCTGGG + Intergenic
1004542979 6:16569363-16569385 AAAAAATAAAAAATTTAGCTGGG + Intronic
1004703779 6:18103971-18103993 GAAAAATAAAAAATGGCACTGGG + Intergenic
1005362733 6:25046990-25047012 GAGAACTGACAAATACAGCTAGG - Intergenic
1005702732 6:28418825-28418847 AAAAAAAAAAAGATGCAGCTAGG + Intergenic
1005956587 6:30668353-30668375 GAAAAAGAAAAATTACAGCTGGG + Intronic
1005973161 6:30777365-30777387 AAAAAATAAAAAAATCAGCTGGG - Intergenic
1006005608 6:30999544-30999566 AAAAAATAACAAAATTAGCTGGG + Intergenic
1006075865 6:31531976-31531998 AAAAAATAAAAAAAGTAGCTGGG - Intronic
1006200506 6:32284675-32284697 GACAAATACCTAATGCAGGTGGG + Intergenic
1006656486 6:35598381-35598403 TAAAAATAACAAAATTAGCTGGG - Intronic
1006702899 6:35991062-35991084 CAAAAATAATAACTGCTGCTAGG + Intronic
1006728018 6:36214047-36214069 GAAAAATCACCACTGCAGCTAGG + Exonic
1006738016 6:36288774-36288796 AAAAAATAAAAAAATCAGCTGGG + Intronic
1006777459 6:36606693-36606715 TAAAAATACAAAAAGCAGCTGGG - Intergenic
1006822616 6:36910248-36910270 TAAAAATAACTAAAGGAGCTGGG - Intronic
1007091430 6:39187215-39187237 GAAAAATACAAAATTTAGCTGGG + Intergenic
1007150817 6:39689207-39689229 TAAAAATGCAAAATGCAGCTGGG + Intronic
1007553891 6:42750319-42750341 AAAAAATACCAAATTTAGCTGGG - Intronic
1007698005 6:43746025-43746047 GAAAAATAGCAAATGCATTCAGG + Intergenic
1008349100 6:50467701-50467723 AAAAAATAAATAATGCACCTGGG - Intergenic
1008351306 6:50494069-50494091 GAAAAATAAAGAATGCATTTTGG - Intergenic
1008376764 6:50801044-50801066 GAAAAATAGCTAATGCATTTGGG - Intergenic
1008499400 6:52165701-52165723 AAAAAATAAAAAATTTAGCTGGG - Intergenic
1008934697 6:56977794-56977816 GAAAAATAAAAAAATTAGCTGGG + Intronic
1009691909 6:67045944-67045966 CAAAAATAACAAATAGAGGTGGG + Intergenic
1009831846 6:68947888-68947910 CAAGAGTAACAAATTCAGCTAGG - Intronic
1010176883 6:73038339-73038361 GAAAAAAAAAACATGCAGTTTGG - Intronic
1010241520 6:73620216-73620238 TAAAAATAGCAAATCCAGCCGGG - Intronic
1010273791 6:73945848-73945870 AAAAAATAACAAATGCTGGTGGG - Intergenic
1010817604 6:80376660-80376682 GAAAAATAGAAAATGGAGTTTGG - Intergenic
1011077468 6:83452554-83452576 AAAAAATAAAAAAATCAGCTGGG + Intergenic
1011103369 6:83749577-83749599 GAAAAATAAAAAAATTAGCTGGG + Intergenic
1011141668 6:84164728-84164750 GACAAATACCTAATGCAGGTGGG + Intronic
1011237615 6:85234789-85234811 CAAAAATAATAAATGAAGGTGGG - Intergenic
1011251183 6:85374048-85374070 GAAAAATGATAAATCCAGCCAGG + Intergenic
1012589576 6:100963931-100963953 GAAAAATAAGAAATTTAGCTAGG + Intergenic
1012854209 6:104482282-104482304 TAAAAATACCAAAAGTAGCTGGG - Intergenic
1012919044 6:105201927-105201949 GAAAAATAGCTAATGCATGTCGG + Intergenic
1012979302 6:105812899-105812921 GAAAAATAGCTAATGCATGTTGG + Intergenic
1013068541 6:106706813-106706835 GAAAAATACCTAATGCATGTGGG - Intergenic
1013069933 6:106719530-106719552 TAAAAATAAAATATACAGCTGGG + Intergenic
1013236925 6:108205288-108205310 AAAAAATAACAAAAACACCTAGG - Intergenic
1013244563 6:108274325-108274347 TTAAAATAACATAAGCAGCTGGG - Intergenic
1013313299 6:108917806-108917828 TAAAAATACAAAATGTAGCTGGG - Intronic
1013493848 6:110678005-110678027 AAAAAATAAAAAAATCAGCTGGG - Intronic
1013515786 6:110884592-110884614 TAAAAAGAAAAAAGGCAGCTGGG - Intronic
1013629937 6:111976597-111976619 GAAAAATGACAATTGCATTTGGG - Intergenic
1013872079 6:114776375-114776397 GAAATAAAAGAAATACAGCTGGG - Intergenic
1013913955 6:115311671-115311693 AAAAAAAAAAAAATTCAGCTTGG - Intergenic
1014077514 6:117253074-117253096 AAAAAAAAAAAAATTCAGCTAGG + Intergenic
1014334882 6:120120802-120120824 AAAAAATAACAGATGCTGGTGGG - Intergenic
1014430095 6:121360071-121360093 AAAAAATAAAAAATATAGCTGGG - Intergenic
1014782762 6:125583744-125583766 TAAAAATAAAAAAAGGAGCTGGG - Intergenic
1015159261 6:130133744-130133766 GAGAAATAACTAATGCATATGGG + Intronic
1015245140 6:131066256-131066278 GAACAAAAACAAATGCTGCAAGG + Intergenic
1015334816 6:132024833-132024855 GAAAAATAGCTAATGCATGTTGG + Intergenic
1015341450 6:132105689-132105711 AAAAAAAAAAAAATACAGCTGGG - Intergenic
1015488003 6:133793586-133793608 AAAAATTAACAAATGCTGGTGGG - Intergenic
1015601070 6:134911115-134911137 GAAAAAGAAAAAATGGAACTGGG - Intergenic
1016233986 6:141839157-141839179 GAAGAATAACAAAAGGAACTTGG + Intergenic
1016251212 6:142045213-142045235 GAAAAATAGCTAATGCATGTTGG - Intergenic
1016311747 6:142740611-142740633 CAATAAAAACAAATGCTGCTGGG - Intergenic
1016644095 6:146384062-146384084 GAGAGAAAACAAATGGAGCTTGG + Intronic
1016837989 6:148498248-148498270 CAAAAAAAACAAATTTAGCTGGG + Intronic
1017053666 6:150418861-150418883 GACAAATGACAAATAAAGCTGGG - Intergenic
1017147427 6:151247238-151247260 AAAAAATAAAAAATTTAGCTGGG + Intronic
1017163472 6:151388180-151388202 ATAAAATACCAAATGCACCTGGG - Intronic
1017204182 6:151787102-151787124 CAAAAATAAGCAATGCAGCCAGG - Intronic
1017212908 6:151876606-151876628 GAAAAAGAACAAGGGAAGCTTGG + Intronic
1017217062 6:151921046-151921068 GAAAAACAACTAATGCATGTTGG - Intronic
1017475985 6:154793652-154793674 TAAAAATAAAAAAATCAGCTGGG + Intronic
1017650953 6:156582160-156582182 AAAAAAAAAAAAAAGCAGCTGGG - Intergenic
1017762165 6:157577845-157577867 AAAAAATAACAGATGCAGGCTGG - Intronic
1017830319 6:158121892-158121914 GAAAAATATCAAATGCCCTTTGG + Intronic
1017998980 6:159561410-159561432 GAAAAATTACAAACACAGTTAGG + Intergenic
1018273152 6:162102149-162102171 GAATAATAACAAATGCAAGCTGG - Intronic
1018324164 6:162646577-162646599 TAAAAACAATAAATTCAGCTGGG - Intronic
1018578785 6:165288811-165288833 GAAAAATAGCTAATGCATGTTGG + Intronic
1019289669 7:244093-244115 GAAAAATAAAAAAATCAGCTGGG - Intronic
1019946460 7:4333400-4333422 GAAAAATAAAAAAATTAGCTGGG - Intergenic
1020038020 7:4977187-4977209 GAAAATTAACAAATGTGGCCAGG - Intergenic
1020142029 7:5617432-5617454 TAAAAATACAAAATGGAGCTGGG - Intergenic
1020331802 7:7025854-7025876 GAAGGATAACAAATGCTGATGGG - Intergenic
1020436922 7:8174632-8174654 AAAAAATAAAAAAATCAGCTGGG + Intronic
1020640845 7:10751953-10751975 GAAAAACAAGAAATGCAGAAAGG + Intergenic
1020884318 7:13803496-13803518 TAAAAAAAACACCTGCAGCTAGG - Intergenic
1020928933 7:14369029-14369051 GAGAAATACCAAATGTAGATGGG - Intronic
1021042596 7:15881783-15881805 GACAAATACCTAATGCATCTGGG - Intergenic
1021228635 7:18058706-18058728 GAAAAATAACTAATGCATGCAGG + Intergenic
1021247571 7:18282713-18282735 GAAAAATAATAAATGAGTCTGGG + Intronic
1021364223 7:19756478-19756500 GAAAAATAACTAATGAATCTAGG - Intronic
1021367424 7:19797054-19797076 AAAAAATAAGAAATGCTGGTGGG - Intergenic
1021476052 7:21062007-21062029 GAAATAAAACACATGCAGATTGG + Intergenic
1022313502 7:29220352-29220374 GAAAATTAACAAAAACAACTGGG + Intronic
1022684093 7:32578510-32578532 TAAAAATAACAAATGTGGCCAGG + Intronic
1023334098 7:39150453-39150475 AAAAAAAAAAAAATGTAGCTTGG - Intronic
1023413181 7:39908269-39908291 GAAAAATACAAAATTTAGCTGGG + Intergenic
1024114947 7:46183706-46183728 GAAAAAGAACAAAGGAGGCTGGG - Intergenic
1024412865 7:49066979-49067001 AATACATAACAAATGCTGCTAGG - Intergenic
1024590602 7:50879459-50879481 GAAAAATAGCTAATGCATGTGGG + Intergenic
1025249488 7:57342468-57342490 GAAAAATAGCAAATGCTTGTCGG - Intergenic
1025278280 7:57604305-57604327 AAAAAAAAACAAAAGTAGCTGGG - Intergenic
1025771689 7:64513804-64513826 TAAAAATAAAAAAAGTAGCTGGG - Intergenic
1025980057 7:66398041-66398063 AAAAAATAATAAATTTAGCTGGG - Intronic
1026050033 7:66938666-66938688 GAAAAATACAAAAAGTAGCTGGG - Intronic
1026156835 7:67833784-67833806 TAAAAATACAAAATGTAGCTGGG - Intergenic
1026244798 7:68610388-68610410 GAAAAAATACAAGTGCAGCAAGG + Intergenic
1026368130 7:69670578-69670600 AAAAAAAAAAAAAAGCAGCTGGG + Intronic
1026611910 7:71867593-71867615 TAAAAATAACAAAATTAGCTGGG - Intronic
1026721202 7:72832161-72832183 TAAAAATAACAAAATTAGCTGGG - Intergenic
1026797067 7:73373044-73373066 AAAAAAAAAAAAAGGCAGCTGGG + Intergenic
1026974039 7:74485624-74485646 AAAAAAAAATAGATGCAGCTGGG + Intronic
1026975242 7:74493877-74493899 AAAAAATAAAAAAATCAGCTGGG - Intronic
1027204937 7:76090402-76090424 AAAAAATAATAAATTTAGCTGGG - Intergenic
1027217799 7:76195255-76195277 TAAAAATACAAAATGTAGCTGGG - Intergenic
1027284324 7:76632853-76632875 GAAAAATACCAAATGGAAATCGG + Intergenic
1027603384 7:80268648-80268670 AAAAAATAACAAATGCAGGAAGG + Intergenic
1027854083 7:83486681-83486703 ACAAAATAAGAAATGCAGGTGGG + Intronic
1028120621 7:87052955-87052977 AAAAAATAAAAAAATCAGCTGGG - Intronic
1028316924 7:89414277-89414299 GAAAAATAACTAATGGTACTAGG - Intergenic
1028435663 7:90800553-90800575 GAAAAACAACAAAAACAGATAGG - Intronic
1028468559 7:91179505-91179527 TAAAAAAAAAAAATGCAGCCCGG + Intronic
1028565443 7:92225466-92225488 GAAAAATACAAAAATCAGCTGGG - Intronic
1028593329 7:92521730-92521752 TAAAAATAAAAAATTCAGCTGGG - Intronic
1028606325 7:92660339-92660361 GAAAGATGACAGAGGCAGCTGGG + Intronic
1028791912 7:94862928-94862950 TAAAAATAAAAAAATCAGCTGGG + Intergenic
1029140925 7:98409538-98409560 TAAAAATTAGTAATGCAGCTGGG + Intergenic
1029182102 7:98710207-98710229 GAAAAAAAACAAACATAGCTGGG + Intergenic
1029214604 7:98937877-98937899 TAAAAATAAATAATGCAGCTGGG + Intronic
1029368196 7:100129915-100129937 AAAAAAAAAAAAATGTAGCTGGG - Intergenic
1029572613 7:101380283-101380305 AAAAAAAAAAAAATGTAGCTGGG - Intronic
1029605485 7:101597182-101597204 AAAACATAAAAAATGTAGCTGGG - Intergenic
1030266344 7:107625970-107625992 TAAAAAAGAAAAATGCAGCTAGG + Intronic
1030300005 7:107965282-107965304 TAAATATAAGAAATGCGGCTGGG + Intronic
1030463612 7:109872317-109872339 GTAAAATAAAAAAGGCACCTGGG - Intergenic
1030498890 7:110334324-110334346 GAAAAATAACTAATGCATGCTGG - Intergenic
1030668274 7:112306373-112306395 TAAAAATATAAAAAGCAGCTGGG - Intronic
1030712305 7:112764659-112764681 TAAAAATAAAAAAATCAGCTGGG - Exonic
1030794228 7:113768185-113768207 AAAAAAAAACTAATCCAGCTAGG - Intergenic
1030937633 7:115605214-115605236 GAAAAATACAAAAACCAGCTGGG - Intergenic
1031033008 7:116755087-116755109 GACAAAGAGCAGATGCAGCTTGG - Intronic
1031173703 7:118322520-118322542 GAAAAACAAAAAATCTAGCTGGG - Intergenic
1031204402 7:118737016-118737038 AAAAAATAACAAATGCTTATGGG + Intergenic
1031346809 7:120676842-120676864 GAAAAAGAAAAAAGGCATCTGGG + Intronic
1031395920 7:121273526-121273548 GAAAAAAAAAAAATCCATCTTGG + Intronic
1031638559 7:124132955-124132977 GACTAATAACAAATGAAACTAGG - Intergenic
1031813495 7:126402630-126402652 CAAAAACAAAAAATGCAGATTGG + Intergenic
1031949157 7:127873804-127873826 GAATAATAAAAAGTCCAGCTGGG - Intronic
1032063584 7:128746451-128746473 AAAAAATAAAAAAAGCAGCCAGG - Intronic
1032104425 7:129014360-129014382 AAAAAATAAAAAATTTAGCTGGG + Intronic
1032331485 7:130985039-130985061 GAGAAAGAACAATGGCAGCTTGG - Intergenic
1032530040 7:132612501-132612523 AAAAAATACAAAAAGCAGCTAGG + Intronic
1032579559 7:133091745-133091767 AAAAAAAAACTAATGGAGCTGGG + Intergenic
1032806167 7:135356511-135356533 GAAAAATACAAAAATCAGCTGGG + Intergenic
1032995701 7:137443889-137443911 GAAAGATATCAAATTCAGCTAGG + Intronic
1033111672 7:138584266-138584288 TAAAAATAAGAAATACAGGTGGG - Intronic
1033305450 7:140222319-140222341 AAAAAACAACAAATTCGGCTGGG + Intergenic
1033423834 7:141225689-141225711 TAAAAATGACAGATGTAGCTGGG - Intronic
1033601730 7:142893495-142893517 GAAGAATAAGAAGTGCAGGTGGG - Intergenic
1033629570 7:143143310-143143332 AAAAAATAACAAATTCAGCCAGG + Intergenic
1033792117 7:144803025-144803047 GAAAAATAGCTAATGCAGGCTGG + Intronic
1033921727 7:146401393-146401415 GGAAAAGAACAAAGGCAGCTAGG + Intronic
1034151870 7:148923077-148923099 CAAAAATAACAAAATTAGCTGGG + Intergenic
1034206749 7:149323147-149323169 AAAAAATAACAAAATTAGCTGGG - Intergenic
1034271410 7:149805032-149805054 AAAAAATTAAAAATGTAGCTGGG + Intergenic
1034389812 7:150777100-150777122 CAATAATAACAACAGCAGCTAGG - Intergenic
1034501067 7:151451474-151451496 GAAAAATACAAAAGTCAGCTGGG + Intergenic
1034704953 7:153133096-153133118 GAAAAATAGCTAATGCATGTTGG - Intergenic
1034743403 7:153499489-153499511 GAAAAATAACTAATGCATGCTGG - Intergenic
1034761456 7:153675735-153675757 AGAAACTAACAAATGCCGCTGGG + Intergenic
1034835391 7:154346796-154346818 GCAAAATAACAAATGCTTTTTGG + Intronic
1035371159 7:158379756-158379778 GAAAAAGGACTAATACAGCTAGG - Intronic
1035999715 8:4588034-4588056 GAAAACTAACAAAAGGAGCAAGG + Intronic
1036010851 8:4721111-4721133 GGAAACTTACAAATGCAACTCGG + Intronic
1036164117 8:6415843-6415865 CAAAAACAAAAAAGGCAGCTGGG + Intronic
1036555369 8:9855027-9855049 AAAAAAAAAAAAATTCAGCTGGG + Intergenic
1036624161 8:10452479-10452501 GAAAAATACAAAAATCAGCTGGG - Intergenic
1036792298 8:11729272-11729294 CAAAAAGAAAAAATGCAGCTGGG + Intronic
1037271776 8:17137875-17137897 GAAAAATACAAAATTTAGCTGGG - Intergenic
1037422232 8:18715155-18715177 GAAAAATAGCTAATGCAGGCTGG + Intronic
1037497473 8:19453749-19453771 TAAAAGTACCAAAAGCAGCTGGG + Intronic
1037536067 8:19826061-19826083 AAAAATTTAAAAATGCAGCTAGG - Intronic
1037554655 8:20010472-20010494 GAAAAATAACTAATGGTACTGGG - Intergenic
1037872903 8:22516097-22516119 AGAAAATAAAAAAAGCAGCTGGG - Intronic
1038102406 8:24393160-24393182 GAACAATTACAAATGCATATAGG - Intronic
1038318987 8:26511612-26511634 GAAAAATAAAAAAATTAGCTGGG + Intronic
1038319009 8:26511784-26511806 CAAAAATAAAAAAACCAGCTGGG + Intronic
1038573093 8:28679993-28680015 AAAAAAGAACTAATGCTGCTTGG - Intronic
1038624053 8:29173073-29173095 TAAAAATAACAAAATTAGCTGGG - Intronic
1038855210 8:31323762-31323784 GAAAAATAATAAATGCATGCGGG - Intergenic
1039294979 8:36140587-36140609 TAAAAATAACAACTGCCGCCCGG - Intergenic
1039314985 8:36361124-36361146 GAAAAATAGCTAATGCATGTGGG + Intergenic
1039329980 8:36526394-36526416 GAAAGATATCACATGCAGCAAGG + Intergenic
1039440684 8:37593203-37593225 AAAAAAAAGCAAATGCACCTGGG + Intergenic
1039581342 8:38669251-38669273 GAAAAATAGCTAATGCATGTGGG + Intergenic
1039961291 8:42249920-42249942 TAAAAAAAAAAAATTCAGCTGGG + Intergenic
1040653893 8:49482105-49482127 AAAAAACAACAAATCCAGTTTGG - Intergenic
1040767761 8:50935660-50935682 GAAAACTAACAAATAAATCTTGG + Intergenic
1041038193 8:53817240-53817262 AAAAAAAAAAAAATCCAGCTGGG + Intronic
1041141746 8:54827623-54827645 TAAAAATAAAAAATGTAGCCTGG - Intergenic
1041185071 8:55290539-55290561 GAAAAATAGCTAATGCATGTTGG - Intronic
1041480225 8:58311949-58311971 GATAAATAACTAATGCATGTCGG - Intergenic
1041502913 8:58558569-58558591 CAAAGATATCAAATGTAGCTGGG - Intronic
1041545430 8:59037159-59037181 GAAAAAAAAAAAAAGGAGCTTGG - Intronic
1041631399 8:60091994-60092016 GAACAATAGCAAATTCAGATAGG + Intergenic
1042220221 8:66466227-66466249 AAAAAAAAAAAAATTCAGCTGGG - Intronic
1042339403 8:67663483-67663505 GAAAAATAGCTAATGCATGTTGG - Intronic
1042429512 8:68688858-68688880 GACAAATAGCTAATGCAGTTGGG + Intronic
1042460483 8:69059921-69059943 TAAAAATAAGGGATGCAGCTGGG + Intergenic
1042994459 8:74680192-74680214 TAAAACTAACAAATGCATCTAGG + Intronic
1043422077 8:80108133-80108155 GAAAAATAACAAATGCAGGGAGG - Intronic
1043458944 8:80440006-80440028 GAAAAATAAAAAAAATAGCTAGG - Intergenic
1043493805 8:80778347-80778369 AAAAAATAACAGATGCTGGTTGG + Intronic
1043619275 8:82168710-82168732 GAGAAATAACTAATGCATGTGGG - Intergenic
1043923663 8:86012277-86012299 GAAAAAAAAAAACTTCAGCTTGG + Intronic
1044415110 8:91929607-91929629 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
1044664408 8:94621022-94621044 GAAAAATAAGAAAAGGGGCTGGG - Intergenic
1044835986 8:96296431-96296453 GAAAAAGAACACATGGGGCTGGG - Intronic
1045052278 8:98338154-98338176 TAAAATAAAGAAATGCAGCTGGG + Intergenic
1045062068 8:98419198-98419220 GAAAAATAAAAAAATTAGCTGGG + Intronic
1045369657 8:101510155-101510177 AAAAAATACAAAATTCAGCTGGG - Intronic
1045626444 8:104057225-104057247 AAAAAATAAAAAATTTAGCTGGG - Intronic
1045679863 8:104647019-104647041 CAAAAAAAAAAAATGCAGCCAGG + Intronic
1045949647 8:107837422-107837444 GACAAATAACTAATGCATGTGGG - Intergenic
1045982301 8:108204881-108204903 GAAAAATACAAAATGCAGATTGG - Intronic
1046848035 8:118940526-118940548 GAAATATAACAATTGCAGTGAGG - Intronic
1047075020 8:121391644-121391666 GCAAAATAGCAAATGAAGCCAGG - Intergenic
1047121815 8:121913193-121913215 GACAAATAACTAATGCATGTGGG + Intergenic
1047406767 8:124591939-124591961 AAAAAATAAAAAAATCAGCTGGG - Intronic
1047460300 8:125057538-125057560 GAAAAGTAAGAAATGCATCAGGG - Exonic
1047603559 8:126451510-126451532 GAAGAATAACAAATGAAACTTGG - Intergenic
1047603773 8:126453634-126453656 TAAAAATAAAAAAATCAGCTGGG + Intergenic
1048142614 8:131809261-131809283 AAAAAACAACAAATGCATATGGG + Intergenic
1048213017 8:132472102-132472124 AAAAAATAACAGATGCTGATGGG + Intronic
1048929242 8:139297958-139297980 GAAAAATACCTAATGCATGTGGG + Intergenic
1049036822 8:140083030-140083052 TAAAAATAAAAAAATCAGCTGGG + Intronic
1049270930 8:141695911-141695933 GAAAAGTAACAAGTACAGCACGG - Intergenic
1049618310 8:143586155-143586177 GAAAAATCAGACATGCTGCTTGG + Intronic
1049743960 8:144255185-144255207 GAAAAAAAATAAACCCAGCTTGG + Intronic
1050341518 9:4644207-4644229 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1050351349 9:4743056-4743078 GAAAAATATAAAAATCAGCTGGG - Intergenic
1050705409 9:8391172-8391194 GAAATATAACAATTTGAGCTTGG - Intronic
1051266061 9:15309348-15309370 TAAAAATACAAAAAGCAGCTGGG + Intergenic
1051415775 9:16838398-16838420 GAAAAAATACAAAATCAGCTGGG + Intronic
1051647696 9:19286027-19286049 AAGAAAAAACAAAAGCAGCTGGG + Intronic
1051654241 9:19363350-19363372 TAAAAATACAAAATTCAGCTGGG + Intronic
1051657400 9:19396251-19396273 AAAAAAAAAAAAATGCAGCTTGG - Intergenic
1051908277 9:22122044-22122066 AAAAAATAACAAATGCTGGCAGG - Intergenic
1051946692 9:22577798-22577820 GAAAAATAACTAATGCATGCTGG + Intergenic
1051994097 9:23193168-23193190 TAACAAAAACAAATGCAGATAGG + Intergenic
1052146208 9:25052293-25052315 GAAAAATAAGAAATGGGGCCGGG - Intergenic
1052153578 9:25152658-25152680 GACAAATACCTAATGCAGGTGGG - Intergenic
1052422030 9:28254876-28254898 GAAAAATAACTAATGCATACTGG - Intronic
1052864617 9:33457446-33457468 TAAAAATACCAAAAGTAGCTGGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053270729 9:36747711-36747733 AGAAAATAACAACTGCAGCTGGG + Intergenic
1053339879 9:37316218-37316240 TAAAAATACAAAAAGCAGCTGGG - Intronic
1053339912 9:37316483-37316505 TAAAAATAGAAAAAGCAGCTGGG - Intronic
1053493742 9:38533251-38533273 AAAAAATAAAAAAGTCAGCTGGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053689398 9:40575698-40575720 TAAAAATACCAAAATCAGCTGGG + Intergenic
1054274633 9:63055358-63055380 TAAAAATACCAAAATCAGCTGGG - Intergenic
1054300642 9:63376638-63376660 TAAAAATACCAAAATCAGCTGGG + Intergenic
1054400191 9:64709571-64709593 TAAAAATACCAAAATCAGCTGGG + Intergenic
1054433781 9:65193829-65193851 TAAAAATACCAAAATCAGCTGGG + Intergenic
1054496605 9:65827841-65827863 TAAAAATACCAAAATCAGCTGGG - Intergenic
1055079834 9:72258150-72258172 AAAAAATAAAAAATGTAGCTGGG + Intergenic
1055402963 9:75944000-75944022 AAAAAATAAAAAAATCAGCTGGG + Intronic
1056421365 9:86430483-86430505 GATAAATAACTAATGCATGTGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056929038 9:90859280-90859302 GAAAAATAACAAAAAAAGCAAGG - Intronic
1057017879 9:91669754-91669776 GACAAATAACTAATGCATGTGGG - Intronic
1057500242 9:95591356-95591378 AAAAAAGAAAAAAGGCAGCTGGG - Intergenic
1057633196 9:96737534-96737556 GAAAAACAACACAGGAAGCTGGG - Intergenic
1057674471 9:97128085-97128107 AAAAAATAAAAAAGTCAGCTGGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057713482 9:97468424-97468446 GAAGAATAAAAAAGGTAGCTCGG + Intronic
1057818943 9:98316445-98316467 GAAAAATAACAAAAGTGGCCGGG - Intronic
1058005514 9:99909935-99909957 AAAAAAGAAGAAATGCAGCTGGG + Intronic
1058173848 9:101715009-101715031 GAAAAATAACAAAGACAGGCTGG + Intronic
1058236510 9:102497463-102497485 GAAAAAATAAAAATTCAGCTGGG + Intergenic
1058327048 9:103711357-103711379 AAAAAATAACAGATGCTGGTGGG - Intergenic
1058350148 9:104011599-104011621 AAAAAATAACTAATGCATGTTGG + Intergenic
1058486224 9:105445786-105445808 GAGGAATAACAAGTGCAGCCAGG - Intergenic
1058554518 9:106152708-106152730 GAAAAATAACTAATGAATATTGG + Intergenic
1059070924 9:111135120-111135142 TAAGAACAAAAAATGCAGCTGGG - Intergenic
1059088814 9:111334390-111334412 GAAAAAAAACTCCTGCAGCTAGG - Intergenic
1059099355 9:111454862-111454884 AAAAAATAAAAAAATCAGCTGGG - Intronic
1059129650 9:111733159-111733181 GAAAAAAAACAAATGCCTATAGG + Intronic
1059485452 9:114623439-114623461 ATGAAATAACAAATCCAGCTGGG - Intronic
1059793684 9:117667889-117667911 TAAAAATAAAAAAAGTAGCTGGG - Intergenic
1059842075 9:118228996-118229018 GAAAAATAAAATATGCATCTAGG - Intergenic
1059936305 9:119314524-119314546 GAAAAATACAAAAATCAGCTGGG - Intronic
1060095391 9:120784622-120784644 GAAAAAAAAAAAATGCGGCTGGG + Intronic
1060246799 9:121953335-121953357 GAAAATTAACCAAAGCAGCCAGG + Intronic
1060460980 9:123854398-123854420 AAAAAATAAAAAATGAAGCTGGG + Intronic
1060639401 9:125225987-125226009 GAAAAAAAAAAAATTTAGCTGGG + Intronic
1061066456 9:128280810-128280832 GAAAAAGAACAAATGCGACCGGG - Intronic
1061129547 9:128701119-128701141 AAAAAATTAAAAAGGCAGCTGGG - Intergenic
1061427801 9:130511275-130511297 GAAAAATACAAAACGTAGCTGGG - Intergenic
1061951125 9:133936401-133936423 TAAAAATACAAAAAGCAGCTGGG - Intronic
1061976827 9:134072656-134072678 GAAAAATCAAAAATGTAGCTGGG + Intergenic
1062131765 9:134899003-134899025 GAAAAGTAACAAAGACAGATTGG + Intergenic
1203447630 Un_GL000219v1:74656-74678 GAAAAAAAAAAAATTTAGCTGGG - Intergenic
1185665961 X:1765873-1765895 TTAAAAAAAAAAATGCAGCTGGG + Intergenic
1185712871 X:2318197-2318219 AAAAAAAAAAAAAAGCAGCTGGG + Intronic
1185717738 X:2356212-2356234 TAAAAATACAAAATACAGCTGGG + Intronic
1185722111 X:2390431-2390453 TAAAAAAAAAAAATGCAGCTGGG - Intronic
1185746342 X:2576533-2576555 TAAAAATAAAAAAAGTAGCTGGG + Intergenic
1186037757 X:5443261-5443283 CAAAAATATATAATGCAGCTCGG - Intergenic
1186318111 X:8392963-8392985 GAAAAATAGCTAATGCATGTGGG + Intergenic
1187161875 X:16772854-16772876 TAAAAATAAAAAATTTAGCTGGG + Intergenic
1187596466 X:20778013-20778035 ACAAAATAACAAATGCTGGTGGG + Intergenic
1187596764 X:20781693-20781715 GAAAAATAATAAAGTCACCTTGG + Intergenic
1187634964 X:21217434-21217456 GACAAATAACTAATGCATGTGGG + Intergenic
1187881926 X:23855183-23855205 AAAAAATAAAAAATTTAGCTGGG - Intronic
1187889455 X:23920594-23920616 GAAAATTATCAAATGAAGCCAGG + Intronic
1188218772 X:27513882-27513904 AAATAATAACAAATGCTGGTGGG + Intergenic
1188495740 X:30781271-30781293 GAAAAAAGACAACTGCACCTGGG + Intergenic
1188635551 X:32426471-32426493 AAAAAATAACAGATGCTGTTGGG + Intronic
1188713037 X:33425436-33425458 AAAAAATAACAGATGCTGGTGGG - Intergenic
1188831301 X:34900960-34900982 GAAAAATTACTAAAGGAGCTGGG - Intergenic
1188888332 X:35578490-35578512 AAAAAATAACAGATGCTGTTGGG + Intergenic
1189631793 X:42961863-42961885 GAAAAGAAACAAATGCAGAGAGG + Intergenic
1189817009 X:44834087-44834109 GACAAATGACAAATTGAGCTGGG - Intergenic
1190012703 X:46798912-46798934 CAAAAATAACAAAGTTAGCTGGG + Intergenic
1190286466 X:48964726-48964748 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1190880347 X:54487652-54487674 TAAAAAGAACAAAGCCAGCTGGG + Intronic
1190993070 X:55572538-55572560 GAAAAATAGCTAATGCATCCTGG + Intergenic
1191115092 X:56844171-56844193 GACAAATACCTAATGCAGGTGGG - Intergenic
1191780804 X:64863167-64863189 GAAAAATAGCTAATGCATCCTGG - Intergenic
1191944697 X:66519381-66519403 AAAAAATAACAGATGCTGGTGGG - Intergenic
1192000422 X:67144441-67144463 GAAAAATAGCTAATGCATGTGGG - Intergenic
1192416894 X:70988979-70989001 AAAAAAAAAAAAAAGCAGCTAGG + Intergenic
1192867672 X:75152818-75152840 TAAAAATACAAAAAGCAGCTGGG - Intronic
1193193758 X:78605316-78605338 GAAAAATAACAAATGCTGACAGG + Intergenic
1193207585 X:78766751-78766773 AAAAAATAACAAATGCTGGTGGG - Intergenic
1193227546 X:79001689-79001711 GAAAAATAGCTAATGCATGTGGG + Intergenic
1193893488 X:87081363-87081385 GAAAAATAGCTAATGCATGTTGG - Intergenic
1194013167 X:88586138-88586160 GAAAAATACTAATGGCAGCTAGG + Intergenic
1194491290 X:94553016-94553038 GAAAAATATCAAATTCCACTAGG - Intergenic
1194709673 X:97220100-97220122 ATTATATAACAAATGCAGCTTGG - Intronic
1195044092 X:101040301-101040323 AAAAAAAAAGAATTGCAGCTTGG + Intronic
1195072658 X:101295535-101295557 AAAAAATAACAAATGCTGACAGG + Intergenic
1195082283 X:101382867-101382889 TCAAAATAACACACGCAGCTGGG + Intronic
1195310003 X:103623249-103623271 AAAAAAAAAGAAATGCAGATAGG + Intronic
1195791136 X:108587768-108587790 AAAAAATAACAGATGCTGCAAGG - Intronic
1195809324 X:108812763-108812785 GAAAAATAGCTAATGCATCCTGG - Intergenic
1196019073 X:110970629-110970651 GAAAAATACCTAATGCATGTGGG + Intronic
1196037827 X:111166458-111166480 AAAAAATAAAAAATTTAGCTGGG - Intronic
1196432732 X:115644299-115644321 AAAAATTAAGAAATGCAGCCAGG + Intronic
1196437699 X:115689818-115689840 TTAAAAAAACAAAAGCAGCTGGG - Intergenic
1196530347 X:116779105-116779127 CAAAAATAAAAAAAGTAGCTGGG - Intergenic
1197107220 X:122731233-122731255 AAAAAATAACAGATGCTGGTAGG + Intergenic
1197116694 X:122842192-122842214 GAAAAATAATAAAGGGAACTTGG - Intergenic
1197259216 X:124299172-124299194 AAAAAATAACAGATGCTACTGGG + Intronic
1197284653 X:124582002-124582024 GAAAAATAGCTAATGCATGTGGG - Intronic
1197566914 X:128099543-128099565 GACAAATACCAAATGCATGTGGG - Intergenic
1197907886 X:131445683-131445705 TAAAAATACAAAAAGCAGCTGGG - Intergenic
1197984915 X:132256915-132256937 GGAAAAGAAGAAATGCAGCAGGG - Intergenic
1198141140 X:133804754-133804776 GAAAAATGGCAAATGCAGAGTGG - Intronic
1198470464 X:136941414-136941436 TAAAAATAAAAAAATCAGCTGGG + Intergenic
1198535489 X:137582113-137582135 AAAAAATTAGAAATGTAGCTAGG - Intergenic
1198752624 X:139950708-139950730 AAAAAAGAACATATGTAGCTGGG + Intergenic
1198774904 X:140169301-140169323 AAAAAATATCAAATGAGGCTGGG + Intergenic
1198789835 X:140332492-140332514 CAAAAATAACAAGTGCTGTTGGG - Intergenic
1198890860 X:141394790-141394812 GAAAACCACCAAATGCAGCTGGG - Intergenic
1199307834 X:146288533-146288555 GATAAATAGCTAATGCAGGTGGG - Intergenic
1199340010 X:146666530-146666552 GACAAATACCTAATGCATCTGGG + Intergenic
1199503689 X:148537687-148537709 GAAAAGTAACACATGCAGCCAGG - Intronic
1199640342 X:149854502-149854524 GAAAAATAACTAATGGTACTAGG + Intergenic
1199878201 X:151951928-151951950 GAAAAACAAGAAATAAAGCTAGG - Intergenic
1200061779 X:153487012-153487034 TGAACATAATAAATGCAGCTTGG + Exonic
1200738986 Y:6832606-6832628 TAAAAATAAAGAATACAGCTGGG + Intergenic
1201378575 Y:13347559-13347581 GAAATATAAAAAAATCAGCTGGG + Intronic
1201767710 Y:17588061-17588083 AAAAAAAAAAAAATGAAGCTGGG + Intergenic
1201833843 Y:18317924-18317946 AAAAAAAAAAAAATGAAGCTGGG - Intergenic
1202017428 Y:20425289-20425311 GAAAAATACCTAATGCATGTTGG + Intergenic