ID: 1140853252

View in Genome Browser
Species Human (GRCh38)
Location 16:78954301-78954323
Sequence CTGAGTGGATAGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 398}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140853252 Original CRISPR CTGAGTGGATAGAAGGTGGA TGG Intronic
900433522 1:2614432-2614454 GTAAGTGGATAGCAGGTGGCTGG + Intronic
900498155 1:2985958-2985980 GTGAATGGATGGATGGTGGATGG - Intergenic
900573469 1:3371461-3371483 ATGGATGGATAGATGGTGGATGG - Intronic
900573486 1:3371516-3371538 ATGGATGGATAGATGGTGGATGG - Intronic
900599453 1:3496876-3496898 CTGAGGGGGTGGAAGATGGAGGG - Intronic
900869345 1:5290828-5290850 ATGGGTGGATGGATGGTGGATGG + Intergenic
901134482 1:6984118-6984140 ATGAGTGGATAGAAGGTAGATGG + Intronic
901134487 1:6984149-6984171 ATGAGTGGATAGAAGGTAGATGG + Intronic
901138238 1:7011463-7011485 CAGAGTGGATAGGAGGGCGAAGG - Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901700270 1:11041584-11041606 GTGGGTGGATGGATGGTGGATGG + Intronic
901884266 1:12211736-12211758 CTGAGTGAATAGGAGCTGGTAGG - Intergenic
902168642 1:14593021-14593043 CTGAAGGGATAAGAGGTGGAAGG + Intergenic
902722826 1:18315534-18315556 ATGAGTGGATGGATGATGGATGG + Intronic
903578432 1:24353501-24353523 ATGGGTGGGTAGATGGTGGATGG + Intronic
904216824 1:28927646-28927668 ATGAGAGGAAAGAAGGGGGAGGG - Intronic
904438514 1:30514932-30514954 CTGAGTGGATGGAAGGTTGGGGG - Intergenic
904487818 1:30839309-30839331 ATGAGTGAATGGAAGATGGAAGG + Intergenic
905362645 1:37431086-37431108 CAGAGTGGATAGGAGAAGGAGGG + Intergenic
907313393 1:53552635-53552657 CTGGGAGGATGGATGGTGGAGGG - Intronic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
910545755 1:88415683-88415705 TTGAGTGGCCAGAAGGTGGTGGG + Intergenic
911445161 1:97983578-97983600 CTGAGTGTACAGTAGGTAGATGG + Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913666165 1:121050810-121050832 CTAAGTGAAAGGAAGGTGGATGG - Intergenic
914017565 1:143834086-143834108 CTAAGTGAAAGGAAGGTGGATGG - Intergenic
914656176 1:149742618-149742640 CTAAGTGAAAGGAAGGTGGATGG - Intergenic
914751513 1:150538057-150538079 CTCAGTGGACAAAGGGTGGACGG - Intergenic
915471510 1:156128499-156128521 CTGAGCTGAAAGAAGCTGGAAGG - Intronic
916901310 1:169227071-169227093 CTGAGTGAATAGTATGTGCAAGG - Intronic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
918196591 1:182228235-182228257 CTCAGTGGATCGTAAGTGGATGG - Intergenic
919599958 1:199610417-199610439 CTGAGTGAATAAAAGGAGGTAGG - Intergenic
922648513 1:227317668-227317690 CAGAATGCATAGAAGGGGGAGGG + Exonic
922790891 1:228310379-228310401 GTGAATGGATGGATGGTGGATGG - Intronic
922792850 1:228319704-228319726 ATGGGTGGATGGCAGGTGGATGG - Intronic
922792933 1:228320339-228320361 ATGGATGGATAGATGGTGGATGG - Intronic
923152869 1:231249908-231249930 CTGGTTGGATAGAAGCTGAATGG + Intronic
923260826 1:232266310-232266332 CTGCTTGGAGAGAAGGTGCAAGG + Intergenic
923516474 1:234702015-234702037 GTGAGTGGCTAGAAGGGAGAAGG + Intergenic
924134475 1:240949365-240949387 ATGAGTGGATAGCAGATGGGTGG - Intronic
924802026 1:247334673-247334695 TTGAGTGGAGAGCAGGTGGGGGG + Intergenic
1062940234 10:1415256-1415278 ATGAGTGGTTAGATGCTGGATGG + Intronic
1063563969 10:7155842-7155864 TTGAGTGCACAGCAGGTGGAAGG - Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063950213 10:11215023-11215045 CTTAGTGAAAAGAAGGTGGGTGG - Intronic
1064680153 10:17803195-17803217 CTGAGTGGGTAGGAGGTGGCTGG + Intergenic
1065860727 10:29870546-29870568 ATGAGTGGATGGTAGATGGATGG - Intergenic
1065937080 10:30530124-30530146 ATCAGAGGATGGAAGGTGGAAGG - Intergenic
1066229330 10:33416895-33416917 ATGAATGGATGGATGGTGGATGG + Intergenic
1067808236 10:49407907-49407929 GTGGGTGGATGGAAGGAGGAAGG + Intergenic
1068620791 10:59179285-59179307 TTGAGTGGAAAGAAAGTGAAAGG - Intronic
1069775433 10:70924468-70924490 CTGCCTGGGTTGAAGGTGGATGG - Intergenic
1070891359 10:79944166-79944188 GTGAGTGAATGGAAGCTGGAAGG - Intronic
1071556147 10:86603479-86603501 CAGAGTGGATTGAATGTCGAAGG + Intergenic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1072439892 10:95445056-95445078 CTGAGAGGGTAGAAGGAGAATGG + Intronic
1072594617 10:96859889-96859911 CTGAGTGGATAGAAGGACATTGG + Intronic
1073467232 10:103701265-103701287 ATGAATGGATAGATGATGGATGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073467289 10:103701552-103701574 ATGAATGGATAGATGATGGATGG - Intronic
1076371024 10:129953736-129953758 CTGGGTGGATGGAAGGTGCAAGG - Intronic
1076845121 10:133066046-133066068 ATGGGTGGATAGATGGTGGATGG + Intergenic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077009151 11:372555-372577 CTGTGTGGATACATGTTGGAAGG + Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1078408238 11:11089824-11089846 AGGGGTGGATGGAAGGTGGAAGG + Intergenic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1079280698 11:19084404-19084426 ATGAGTGGATGAAAGATGGATGG - Intergenic
1079280704 11:19084435-19084457 ATGAGTGGATGAAAGATGGATGG - Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080695743 11:34601586-34601608 CTCAGAGGGCAGAAGGTGGAAGG - Intergenic
1081655669 11:44855812-44855834 ATGAGAGGATGGAAGGAGGATGG - Intronic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1083293668 11:61703652-61703674 GTGAGTGGGTAGATGGAGGATGG + Intronic
1084114630 11:67034879-67034901 CTGAGTGGATGGTAGGGGCATGG - Intronic
1084430218 11:69106796-69106818 CTGAGTGGGAAGATGGTGGAGGG - Intergenic
1084857015 11:71995945-71995967 CTGAATGCAGAGAAGGTGGGAGG - Intronic
1085023479 11:73223265-73223287 TTGGGAGGAAAGAAGGTGGATGG - Intronic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086774244 11:90810143-90810165 CTGAGTACATTGAAGTTGGAAGG - Intergenic
1087209608 11:95433361-95433383 TTGAGTGGACAGAATGTGTATGG - Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1088619128 11:111664073-111664095 CTTACTGGCTGGAAGGTGGAAGG - Intronic
1088871835 11:113896980-113897002 CTGAGTGGGGAGAGGGTGAACGG - Intergenic
1089129171 11:116198948-116198970 CTGGGTAGAAAGAAGTTGGAGGG + Intergenic
1089303299 11:117511652-117511674 CAGAGAGGAGAGAGGGTGGAGGG - Intronic
1090618740 11:128542120-128542142 CTCTGTGAATAGAAGGTGTAGGG - Intronic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091020128 11:132092006-132092028 TTAAGAGGATTGAAGGTGGAAGG - Intronic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091838803 12:3604719-3604741 CTGAGTGGGAAGAAGTTGCAAGG + Intergenic
1091844109 12:3642024-3642046 CTGACTGGAAAGGAGATGGAGGG - Intronic
1091957653 12:4660962-4660984 CTGAGAGGATAGAAGCTGGAGGG + Intronic
1095282705 12:40374605-40374627 GTCAGTGAGTAGAAGGTGGACGG - Intergenic
1096599441 12:52718902-52718924 CTGAGTGGTTTGAGAGTGGAGGG - Intergenic
1096819846 12:54225442-54225464 CTGTGTGTATATAAGTTGGAAGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1099118581 12:78659755-78659777 CTGACTGGATAGAATTTTGAAGG - Intergenic
1099815602 12:87643179-87643201 GTAAGTGGCAAGAAGGTGGAGGG + Intergenic
1100384306 12:94091553-94091575 CTGAGTGGAGGGGAGGGGGATGG + Intergenic
1100960625 12:99958776-99958798 CTGAGTGGACAGAAGTAGTAAGG + Intronic
1102014111 12:109636622-109636644 CTGAGTGGAGAACAGATGGAGGG + Intergenic
1102192391 12:110998568-110998590 CTGAGTGGTTAGAAAGGGCATGG - Intergenic
1103064171 12:117883084-117883106 CTGAATGGATGGATGGTTGAAGG - Intronic
1103515254 12:121503653-121503675 CTGAGAGGTGAGAAGGGGGAAGG + Intronic
1103739389 12:123081208-123081230 CTAAAAGGAGAGAAGGTGGATGG + Intronic
1103992527 12:124808637-124808659 ATGAATGGATGGAGGGTGGATGG - Intronic
1104896219 12:132166301-132166323 CTGGGTGGATGGATGATGGATGG - Intergenic
1104896270 12:132166519-132166541 CTGGGTGGATGGATGATGGATGG - Intergenic
1105792041 13:23811343-23811365 CTGAGAGGTTAGAAGCAGGATGG - Intronic
1112684459 13:101807726-101807748 GTGAGTGGAAAGGAGGTGGCTGG + Intronic
1113146600 13:107215008-107215030 CTGAGAGGACAGAAAGTGAAGGG + Intronic
1113224753 13:108147450-108147472 CTGAATAGATGGAAGATGGAGGG - Intergenic
1113780280 13:112972814-112972836 ATGGATGGATGGAAGGTGGATGG + Intronic
1116233441 14:42247790-42247812 CTGAGTGGATCAAAGATGGCAGG - Intergenic
1117769032 14:59113494-59113516 CAGAGTGGATACAAGGTTAAGGG - Intergenic
1118280117 14:64420643-64420665 CTGAGTGGGAAGCAGCTGGAGGG - Intronic
1118401250 14:65381574-65381596 CTGAGAGCAAAGAAGGTAGAAGG - Intergenic
1120708612 14:87770825-87770847 CTTAGTGGATATAAGATTGAAGG - Intergenic
1121696590 14:95918231-95918253 CTCAGTGGATAGATGCTTGAGGG - Intergenic
1121936717 14:98026383-98026405 ATGAGTGGATGGTAGGTGGATGG + Intergenic
1122600704 14:102920301-102920323 GTGGATGGATAGATGGTGGATGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122958524 14:105083822-105083844 ATGGGTGGATGGAGGGTGGAGGG - Intergenic
1124592442 15:31065268-31065290 CAGAGTGGGTAGAATGGGGATGG - Intronic
1124698373 15:31887670-31887692 ATGAGTAGACAGAAGGGGGATGG + Intergenic
1125303900 15:38288481-38288503 AATAGTGGAGAGAAGGTGGATGG + Intronic
1126974237 15:54156737-54156759 CTGAGAGTAGAGAAGCTGGACGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128320204 15:66688122-66688144 CTTACTTGACAGAAGGTGGAGGG + Intergenic
1128773701 15:70302735-70302757 GTGGGTGGATAGGAAGTGGATGG + Intergenic
1128781402 15:70361205-70361227 ATGAGTGGAAGGCAGGTGGAAGG - Intergenic
1128793684 15:70450134-70450156 ATGAGTGGATAGAAGGATGGAGG + Intergenic
1129701879 15:77772965-77772987 CTGAGTGGGTAGTAGCTTGACGG - Intronic
1132019070 15:98344857-98344879 ATGAATGGATGGATGGTGGATGG + Intergenic
1132653782 16:1033169-1033191 ATGGGTGGATGGATGGTGGATGG - Intergenic
1133921417 16:10156631-10156653 CTGAGTGCATAGGAGGCAGAAGG + Intronic
1134746649 16:16593873-16593895 GTGAATGGAGAGTAGGTGGATGG - Intergenic
1134998827 16:18759807-18759829 GTGAGTGGAGAGTAGGTGGATGG + Intergenic
1135102009 16:19614019-19614041 CTGAGTGGGTAGAGCGTGGGGGG + Intronic
1135777130 16:25266648-25266670 CTGAGTGGGTAGTTGGTGAAGGG + Intergenic
1136071367 16:27789484-27789506 ATGAATGGATAGATAGTGGATGG + Exonic
1136071391 16:27789677-27789699 ATGAATGGATAGATGATGGATGG + Exonic
1136071450 16:27790064-27790086 ATGAATGGATAGATGATGGATGG + Exonic
1137444272 16:48522309-48522331 ATGTGTGGAGAGAAGGTGTATGG + Intergenic
1137811183 16:51354318-51354340 ATGAATGGATAGAGGATGGATGG - Intergenic
1139134101 16:64180381-64180403 CTCAGAAGATAGAAGGTGGGAGG + Intergenic
1139239567 16:65377258-65377280 TTGAGTGAATAGAAGGGTGATGG + Intergenic
1140067641 16:71625228-71625250 GTGAGTGGATGAATGGTGGATGG + Intergenic
1140067682 16:71625367-71625389 GTGGGTGGATGGATGGTGGATGG + Intergenic
1140067784 16:71625713-71625735 ATGGGTGGATGGATGGTGGATGG + Intergenic
1140106828 16:71968267-71968289 CTAAGTGGGAAGGAGGTGGAAGG - Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1141110129 16:81265418-81265440 ATGAATGGATGGATGGTGGATGG - Intronic
1141110140 16:81265456-81265478 GTGGGTAGATAGATGGTGGATGG - Intronic
1141110182 16:81265620-81265642 ATGAATGGATGGATGGTGGATGG - Intronic
1141110255 16:81265956-81265978 GTGGATGGATAGATGGTGGATGG - Intronic
1141421535 16:83921001-83921023 ATGGGTGGATGGATGGTGGAGGG + Exonic
1141693169 16:85607739-85607761 CTGATTGGATAAAGGCTGGAGGG - Intergenic
1142032340 16:87844783-87844805 CAGAGTGGTTGGAAGGCGGAAGG - Intronic
1142124138 16:88401821-88401843 TTGGGTGGATGGATGGTGGATGG + Intergenic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1142244740 16:88964889-88964911 ATAAGTGGATAGATGGTGGATGG - Intronic
1142255623 16:89012411-89012433 ATGGGTGGATGGATGGTGGATGG - Intergenic
1142960525 17:3549688-3549710 ATGAGTGGATGGATGATGGATGG + Intronic
1142960568 17:3549974-3549996 ATGAGTGGATAGATGATGGATGG + Intronic
1143116974 17:4586675-4586697 CGGGGTGGATGGAAGGTGGAGGG + Intronic
1143236401 17:5404871-5404893 CTAAGTGGAAAGAAGTTAGAAGG - Intronic
1143301239 17:5912079-5912101 ATGAATGGATGGAAGATGGATGG - Intronic
1143301245 17:5912114-5912136 ATGAATGGATGGAAGATGGATGG - Intronic
1143693329 17:8589644-8589666 CTGAGTGGAAAGAAAGTTGAAGG + Intronic
1143804638 17:9416281-9416303 CTGAGAGGCTAGAAGCAGGATGG - Intronic
1144573538 17:16415504-16415526 CTTAGTGGCTAGAAGGGGGAGGG + Intergenic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1145415329 17:22709930-22709952 ATGAGGGGATGGAAGATGGAGGG + Intergenic
1146482187 17:33213705-33213727 CTGGGTGGAAAGAAGGGGAAAGG - Intronic
1146535036 17:33642604-33642626 CTGACAGGATAGAAGGTTGATGG - Intronic
1146623610 17:34419395-34419417 CTGAGAGGGTAGGAGGAGGAAGG + Intergenic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1147170780 17:38617555-38617577 CTGAGTGGAAAAGAGGAGGAGGG + Intergenic
1147390614 17:40106980-40107002 CTGAGTGGAAAGAAGGAACAAGG + Intergenic
1147573706 17:41586871-41586893 CTGAGTGAAGAGAAGGTGCTCGG + Exonic
1148134802 17:45285263-45285285 CTCAGGAGCTAGAAGGTGGAGGG + Intronic
1148402826 17:47382451-47382473 CTGAATGGACAAAAGCTGGAAGG - Intronic
1149442657 17:56688009-56688031 ATTAGTGGACAGAGGGTGGATGG + Intergenic
1149566529 17:57644374-57644396 GAGAGTGGAAAAAAGGTGGATGG - Intronic
1149666395 17:58367695-58367717 GTGACTGGACAGAGGGTGGAGGG + Intronic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1151978659 17:77496799-77496821 CTGAGCGCACACAAGGTGGATGG + Intronic
1152193994 17:78905480-78905502 CTGAGAGGATAAAAGATGTAGGG - Intronic
1152223135 17:79080219-79080241 CGGAGTGGAATGAAGGGGGAAGG + Exonic
1152337343 17:79706338-79706360 CTGCTTGGACGGAAGGTGGATGG - Intergenic
1152361977 17:79837040-79837062 CGGAGAGGGTAGAAGGGGGAAGG - Intronic
1152767419 17:82148780-82148802 GTGGGTGGATAGATGGTAGATGG + Intronic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1154307984 18:13244227-13244249 GTGAGTGGACAGGAGGTAGATGG - Intronic
1156512873 18:37655753-37655775 CTGAGTTGAGAGAAGGAGAAGGG - Intergenic
1156913140 18:42435000-42435022 ATGAGTGCATGGGAGGTGGAAGG + Intergenic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158396976 18:57087052-57087074 CTGAGAGGATAGAAGCAAGATGG - Intergenic
1158488321 18:57888103-57888125 CTGAGTGGGTAGATGGGGGTGGG - Intergenic
1158828044 18:61246537-61246559 ATGAGTGGATAGTAGGTGGATGG + Intergenic
1158959177 18:62574467-62574489 CTGTGTGGAAGGAAGGTTGATGG - Exonic
1160226833 18:77018411-77018433 ATGAGTGGATAGATGGTGGGTGG - Intronic
1160687608 19:443950-443972 GTGGGTGGATGGAGGGTGGATGG + Intronic
1160692131 19:465040-465062 ATGGGTGGATAGATGATGGATGG + Intronic
1160965315 19:1744738-1744760 CTCAGAGGACAGAAGCTGGAGGG - Intergenic
1161347732 19:3776551-3776573 GTGAGTGGATGGTAGGTGGATGG + Intergenic
1161347764 19:3776673-3776695 ATGAGTGGATGGTGGGTGGATGG + Intergenic
1161347775 19:3776716-3776738 ATGAGTGGATAGTGGGTAGATGG + Intergenic
1161347787 19:3776770-3776792 ATGAGTGGATAGTGGGTGGGTGG + Intergenic
1161449120 19:4334802-4334824 ATGAGTGGATGGATGATGGAGGG - Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1163609862 19:18295226-18295248 ATGAATGGGTAGATGGTGGATGG - Intergenic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164462584 19:28461705-28461727 CTGGCTGGATAGAAGGTTGGGGG - Intergenic
1164774998 19:30845967-30845989 CTGACTGGGTAGGGGGTGGATGG + Intergenic
1165144421 19:33722231-33722253 ATGGGTGGATGGAAGGTGGGAGG + Intronic
1166938588 19:46349820-46349842 CTGCCTGGAGAGAGGGTGGACGG + Intronic
1167494763 19:49811257-49811279 CTGAGAGGATAGGAGGAGGTTGG + Intronic
1167634158 19:50644237-50644259 ATGACTGGATAGATGCTGGAAGG + Intronic
1167634213 19:50644616-50644638 TTGAATGGATAGAAGATGGATGG + Intronic
1168508273 19:56954608-56954630 ATGGGTGGATAGATGGAGGATGG - Intergenic
925622080 2:5803955-5803977 CTGAATGGATAAAATGTGAATGG + Intergenic
926647272 2:15303257-15303279 GTGGGTTGATAGAAGCTGGATGG + Intronic
927102975 2:19802161-19802183 CTGAGAGGAAAGAAGCTGCATGG - Intergenic
927201764 2:20582636-20582658 CCGAGTGGAAAGAGGGTGGGTGG - Intronic
930164442 2:48190368-48190390 CTGAGAGGCTAGAAGCAGGATGG + Intergenic
930262955 2:49168950-49168972 CTGAGTGAAGACAAGTTGGAGGG - Intergenic
930358030 2:50346006-50346028 CAGAGTGGATGGAAGGGGAATGG + Intronic
930919036 2:56728805-56728827 GTGAGGGGAGAGAAGGAGGAGGG - Intergenic
932019889 2:68073688-68073710 CTGCAAGGATAGAAGATGGAAGG - Intronic
932813493 2:74843605-74843627 CTGAGTGGGCAGGAGGTGGGTGG - Intronic
934613945 2:95759946-95759968 AGGAATGGATAGATGGTGGATGG + Intergenic
935309027 2:101764709-101764731 ATGAGTGGCAAGAAGGTGCAGGG - Intronic
938146726 2:128840609-128840631 CTGAGTTGACAGAAGGGGCATGG + Intergenic
938783204 2:134603807-134603829 GTGAGTGTATATAAGGTGGAAGG + Intronic
940284424 2:152019531-152019553 ATGAGTGGGTGGATGGTGGATGG + Intronic
941897196 2:170641103-170641125 GTGAGTGGATGTAAAGTGGACGG - Intronic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942494737 2:176527905-176527927 CTGAAGGGATATAAGGTTGATGG - Intergenic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
947811873 2:233009870-233009892 TGGAGTGGAGGGAAGGTGGAGGG - Intronic
947812719 2:233014688-233014710 ATGGGTGGATGGATGGTGGATGG - Intronic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948137572 2:235648218-235648240 CTGAGGGCACAGGAGGTGGAGGG - Intronic
949065812 2:241989834-241989856 GTGGGTGGATGGATGGTGGATGG - Intergenic
949065961 2:241990448-241990470 ATGGGTGGATGGATGGTGGATGG - Intergenic
1169219732 20:3815076-3815098 CTATGTGAATAGAAAGTGGAAGG + Intergenic
1169417921 20:5433311-5433333 CGGAGTGGTTAGAAGGGTGAAGG - Intergenic
1169834419 20:9862009-9862031 GTTAGTAGATAGAATGTGGAAGG + Intergenic
1170371065 20:15648704-15648726 ATGGGTGGATGGATGGTGGATGG + Intronic
1172820037 20:37724500-37724522 CTGAGTGATTCAAAGGTGGAGGG + Intronic
1173350086 20:42236888-42236910 CTGTGTGAATAGAATGTGGTAGG + Intronic
1173408078 20:42784511-42784533 CTTAGTGGAGAGAAGTGGGATGG + Intronic
1174296499 20:49548956-49548978 TTGATTGGATGGAAGTTGGAAGG + Intronic
1174410253 20:50330549-50330571 GTGGGTGGATAGATGGTGGGCGG + Intergenic
1174577331 20:51545755-51545777 AGGAGTGGATGGAGGGTGGATGG + Intronic
1175165302 20:57039282-57039304 ATGATTGGATAGAAGATGGATGG + Intergenic
1175165308 20:57039329-57039351 ATGATTGGATAGATGATGGATGG + Intergenic
1175245016 20:57577008-57577030 GTGGGTGGATAGACGGTGGGTGG - Intergenic
1175779208 20:61671691-61671713 GTGGGTGGATAGATGGTAGATGG + Intronic
1175781016 20:61682132-61682154 ATGGGTGGATAGAGGGTAGATGG + Intronic
1175817234 20:61889604-61889626 ATGGGTGGATAGATGATGGATGG + Intronic
1176258364 20:64165884-64165906 CTGAGTGCACAAAAGGTGGGAGG + Intronic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1177228915 21:18293617-18293639 CAGAGTGGATGGAAGGGGGTGGG - Intronic
1178444235 21:32623973-32623995 GATAGTGGATAGAAGGGGGATGG + Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1180024906 21:45155579-45155601 GTGAGTGGATGGATGATGGATGG - Intronic
1180182413 21:46123907-46123929 GTGGGTGGATAGAGGATGGATGG + Intronic
1180182487 21:46124210-46124232 CTGGGTGGATGGATGATGGATGG + Intronic
1181265194 22:21627010-21627032 ATGAGTGGGTAGAAGCAGGAAGG + Intergenic
1181536951 22:23551269-23551291 ATGAGAGGATGGATGGTGGATGG - Intergenic
1181737415 22:24892590-24892612 TTGAGTGGATAGGTGGGGGAAGG + Intronic
1182810945 22:33116185-33116207 CTGCGGGAAAAGAAGGTGGATGG - Intergenic
1183100012 22:35578237-35578259 CTGGCTGGATGGATGGTGGATGG + Intergenic
1183100052 22:35578396-35578418 CTGGATGGATGGATGGTGGATGG + Intergenic
1183226167 22:36551346-36551368 TTGAATGGATGGAAGGTGGGTGG - Intergenic
1183271829 22:36867210-36867232 CTGAGAGGATGAAAGTTGGATGG + Intronic
1183303944 22:37072028-37072050 ATGAATGGATGGATGGTGGATGG + Intronic
1183701303 22:39452729-39452751 CTGGGAGGGTAGAGGGTGGAGGG + Intergenic
1184640842 22:45869172-45869194 CTGAGTGAATAGCACATGGACGG + Intergenic
1184731217 22:46372146-46372168 GTGAGTGGGTAGATGATGGATGG - Intronic
1184744621 22:46449125-46449147 GTGAGTGGATGGAAGCTGGGTGG - Intronic
1184996808 22:48213205-48213227 ATGGGTGGATAGGTGGTGGATGG - Intergenic
1185053533 22:48566168-48566190 ATGGGTGGATGGATGGTGGATGG + Intronic
1185108523 22:48887690-48887712 ATGAATGGATGGATGGTGGATGG - Intergenic
1185193379 22:49452813-49452835 GTGAGTCGATGGATGGTGGAAGG + Intronic
1185196831 22:49476927-49476949 GTGGGTGGATGGATGGTGGATGG + Intronic
951840819 3:27032211-27032233 CTGAGTGGAGAAAAGGTGGGGGG - Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952960293 3:38585091-38585113 GTGAGTGGACAGATGGTTGATGG + Intronic
953201651 3:40783264-40783286 TTGAGAGGATAGAAGGGGAAGGG - Intergenic
953341464 3:42137766-42137788 CTGAGAGGAGAGAAAGTGGTTGG + Intronic
957246801 3:77725846-77725868 CTAAGAGGAAAGCAGGTGGAAGG + Intergenic
958813610 3:98891794-98891816 CTAGGTGGATAAAAGGAGGAGGG - Intronic
959454451 3:106541433-106541455 CTGAGTGGATCAAAGGTGAGGGG + Intergenic
959702675 3:109312779-109312801 CTGAGAAGACAGTAGGTGGATGG + Intronic
960634085 3:119766562-119766584 CTGATGGGATAGAAGGTGGGAGG + Exonic
960960860 3:123069094-123069116 CTTAGCGGGTAGGAGGTGGAGGG + Intronic
961084126 3:124052013-124052035 CTGAATGGATAGCAGGTGGGGGG + Intergenic
962183387 3:133232354-133232376 GTGAGTGGATGCAAGGTAGAGGG - Intronic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962436688 3:135373519-135373541 CTGAGAGGATAGAAGGTGTACGG - Intergenic
966081744 3:176012909-176012931 TTCAGTGGATAGAATGTGGGAGG + Intergenic
968707218 4:2085374-2085396 TTGAGTGACTAGATGGTGGATGG - Intronic
968768024 4:2484742-2484764 CTGACGGGATGGAAGCTGGAAGG - Intronic
968935819 4:3609891-3609913 ATGAGTGGATGGAGGATGGATGG - Intergenic
969088602 4:4675333-4675355 ATGGGTGGATAGATGATGGATGG - Intergenic
969500414 4:7549266-7549288 CTGAGTTGAAAGAAGCAGGAAGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
970032223 4:11689240-11689262 CTGAGTGAAAAGAAAGTGGTTGG + Intergenic
970228639 4:13885858-13885880 CTGAGGCAATAGAATGTGGAAGG - Intergenic
970796056 4:19914775-19914797 GTCAGTGGCTAGAAGGGGGATGG + Intergenic
971642707 4:29156449-29156471 CTGATTGAATAGAAAGAGGATGG + Intergenic
972833714 4:42843321-42843343 CAGAGAGGACAGGAGGTGGAGGG - Intergenic
974342420 4:60631541-60631563 CTGAATGGGTAAAAGCTGGAAGG - Intergenic
974810545 4:66940307-66940329 CTGGGTGGAAAGAAGCTAGAAGG + Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
976350701 4:84056788-84056810 CACAGTGGCTAGAAGTTGGAGGG - Intergenic
978891625 4:113835216-113835238 TTGAGTGGATTCAGGGTGGAAGG + Intergenic
981085727 4:140681430-140681452 CTGAGTGGATGGCAGGAGAAAGG + Intronic
983618251 4:169731668-169731690 GGCAGTGGGTAGAAGGTGGAGGG + Intronic
985426408 4:189835645-189835667 GTGTGTTGATAGAGGGTGGAGGG - Intergenic
985712940 5:1440230-1440252 ATGAATAGATAGAAGATGGATGG + Intronic
985957654 5:3276876-3276898 TTGAGTTGATAGCAGGAGGAAGG - Intergenic
986303940 5:6501557-6501579 ATGAATGGATAGATGTTGGATGG + Intergenic
986770886 5:10972168-10972190 CTGAGGGGATAAAATGTGTAAGG + Exonic
987236829 5:15951010-15951032 CTGAGTGGATAACATGTAGAAGG + Intergenic
992096518 5:73367963-73367985 AGCAGTGGATAGAATGTGGAGGG - Intergenic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
995642147 5:114268964-114268986 CTGAGAGAATGGAAGGTGCACGG + Intergenic
996135316 5:119834310-119834332 CAGAGTGGAGAGAAGATGGGAGG - Intergenic
996876258 5:128243597-128243619 ATGAGTGGATAGATGGATGATGG + Intergenic
999305990 5:150519950-150519972 CTGGGTGGACAGAAGGTCCAGGG + Intronic
1000332852 5:160219526-160219548 ATGGGTGGATGGAAGGTGGAGGG + Intronic
1001422578 5:171598961-171598983 GTGAGTGGATAAGAGGAGGATGG + Intergenic
1001423966 5:171611406-171611428 CTGAGTGGATGGAAGGGATATGG - Intergenic
1002437322 5:179239575-179239597 CAGAGAGCATGGAAGGTGGAGGG + Intronic
1002606381 5:180385296-180385318 CGGAGTGGAGAGAAGGCGGTGGG + Intergenic
1003972583 6:11313327-11313349 ATGGGTGGATAGATAGTGGATGG + Intronic
1003972588 6:11313354-11313376 CTGAGTAGATGGATGGTGGATGG + Intronic
1004127159 6:12885061-12885083 CTGAGTGGGTTGAAGAGGGATGG - Intronic
1004191710 6:13470041-13470063 CTGAGTGGCTACAATGTGTAAGG - Intronic
1007769258 6:44180090-44180112 CTGTGTGGCTCAAAGGTGGAGGG - Exonic
1008610327 6:53179588-53179610 CTGAAATGATAGAAGGTGGGAGG - Intergenic
1008624283 6:53302369-53302391 CCAAGTGGAAAGGAGGTGGAGGG - Intronic
1010329030 6:74600351-74600373 TTCAGTGGATAAAAGGAGGAGGG - Intergenic
1011233958 6:85194513-85194535 CTGAGTTGATAGAGGTAGGAAGG + Intergenic
1011988076 6:93475268-93475290 CTGAGTGGATTGTTGTTGGATGG + Intergenic
1012603668 6:101130889-101130911 CTGGGTGGCAAGAAGGGGGAAGG + Intergenic
1015385641 6:132619962-132619984 CAGAGAGAATACAAGGTGGAGGG + Intronic
1016279494 6:142399150-142399172 CTGAGTGTAGAGAAGGCGAAGGG - Intronic
1019335977 7:483055-483077 ATGGATGGATAGAAGATGGATGG + Intergenic
1019616373 7:1964727-1964749 GTGCGTGGAAAGCAGGTGGAGGG + Intronic
1019921723 7:4167534-4167556 CTGTGTGGAGAGAAGCTTGAAGG - Intronic
1019944557 7:4316319-4316341 CTGAGTGAGTAGCAGGTGGTGGG - Intergenic
1021433929 7:20592891-20592913 ATGGGAGGATAGAGGGTGGAAGG + Intergenic
1023861455 7:44219793-44219815 CTGGGTGGGTTGCAGGTGGATGG - Intronic
1024313187 7:47989075-47989097 CTAAAAGGATAGAAGATGGATGG + Intronic
1026203538 7:68235740-68235762 ATGAATGGATGGAAGGTGGATGG + Intergenic
1026743604 7:72994360-72994382 CTGAGTGGCTGGAAGGCGAAGGG + Intergenic
1026907813 7:74072793-74072815 CTGAGTGGAGAGAAGGCCGAAGG - Intergenic
1027233438 7:76284662-76284684 CTGAGTGGGTGCCAGGTGGAAGG - Intronic
1028045431 7:86111462-86111484 CTGAGGGAATAGAAGTTGCAGGG + Intergenic
1029604820 7:101592212-101592234 ATGAGTGGATGGATGGTGGATGG - Intergenic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1031660377 7:124416912-124416934 CGGGGCGGATAGAGGGTGGAAGG - Intergenic
1033208794 7:139445021-139445043 CTTAGTGGAAAGGAGGAGGAAGG - Intergenic
1034595880 7:152191401-152191423 CTGAATGGATATAAGGTGTGAGG - Intronic
1035278874 7:157765105-157765127 GTGAGTGGATGGATGGGGGAAGG - Intronic
1035288587 7:157822445-157822467 ATGAGTGGATAGATGGATGATGG - Intronic
1037094299 8:14964974-14964996 CTGAGTGGGTAAAAGGTAAATGG - Intronic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039611872 8:38926015-38926037 CTGAGAGGACAGAAGTGGGAGGG - Intronic
1042112618 8:65396746-65396768 CTGAGTTAATAGAAGATGGTTGG - Intergenic
1042164509 8:65932859-65932881 GTGGGTGGATAGGAGGTAGATGG + Intergenic
1042964324 8:74334560-74334582 ATGAGTGGATAGATGGTGGGTGG - Intronic
1043418027 8:80071501-80071523 CTTAGTGGAAGGGAGGTGGAAGG - Intronic
1044020319 8:87097920-87097942 CTAAGTGGTTTGAAGATGGATGG + Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045496604 8:102714686-102714708 CTGACTGGATATGAGGTAGAGGG - Intergenic
1047306871 8:123659547-123659569 ATGAATGGATAGATGATGGATGG - Intergenic
1047306905 8:123659779-123659801 ATGAATGGATAGATGATGGATGG - Intergenic
1048151668 8:131900901-131900923 CAGAGGGGATAGAAAGGGGAAGG + Intergenic
1049320626 8:141994448-141994470 ATGAGTGGATAGTGGGTGGATGG - Intergenic
1049364290 8:142229244-142229266 ATGAATGGATGGATGGTGGATGG + Intronic
1049372011 8:142272445-142272467 ATGGGTGGATGGAAGGAGGAAGG - Intronic
1049372043 8:142272581-142272603 GTGGGTGGATGGAAGGAGGAAGG - Intronic
1049405153 8:142449102-142449124 GTGGGTGGATGGACGGTGGACGG - Intergenic
1049464417 8:142744451-142744473 ATGGGTGGATAGATGGGGGATGG + Intergenic
1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG + Intergenic
1051696336 9:19771914-19771936 ATTGGGGGATAGAAGGTGGATGG + Intronic
1052350550 9:27454325-27454347 CTGAGTGTCTACAAGGTGGCAGG + Intronic
1052395675 9:27935197-27935219 CTTAGTGGAAAGAAGGGGTAAGG + Intergenic
1052617527 9:30860812-30860834 CTGGGTGGATAGATGGGTGATGG + Intergenic
1053198806 9:36138986-36139008 ATGGATGGAGAGAAGGTGGAGGG + Intronic
1053291474 9:36882312-36882334 CTGAGTGGAGCGAGGGTGGCTGG - Intronic
1053477001 9:38389634-38389656 CTGTGTGGATTGAAGGGGAAAGG - Intergenic
1054454364 9:65421975-65421997 ATGAGTGGATGGAAGATGGATGG + Intergenic
1059571218 9:115438260-115438282 CTCAGTGTAGATAAGGTGGAAGG + Intergenic
1060217489 9:121747010-121747032 CTGAGTGGAGAGATGGGGGAGGG + Intronic
1060298952 9:122362820-122362842 CTGGATGGAGAGAAGGGGGAGGG - Intergenic
1060824354 9:126679477-126679499 ATGGGTGGATAGATGGTTGAAGG + Intronic
1061672062 9:132194371-132194393 CTGAGTGGGTAGCAGGTGCTGGG - Intronic
1061783075 9:133007193-133007215 TTGGGTGGATGGATGGTGGATGG + Intergenic
1061848259 9:133400286-133400308 GTGGGTGAATAGAAGGGGGAAGG - Intronic
1061980952 9:134103380-134103402 CTGGATGGATGGATGGTGGATGG - Intergenic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062092354 9:134685095-134685117 ATGAATGGATGGATGGTGGATGG - Intronic
1062092368 9:134685157-134685179 ATGAATGGATGGATGGTGGATGG - Intronic
1062092387 9:134685247-134685269 CTTAATGGATGGATGGTGGATGG - Intronic
1062092399 9:134685301-134685323 ATGAATGGATGGATGGTGGATGG - Intronic
1062092448 9:134685526-134685548 CTGGATGGATGGATGGTGGATGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062201320 9:135304333-135304355 ATGAGTGGATAGATGGATGATGG + Intergenic
1062201393 9:135304644-135304666 ATGAGTGGATAGATGGATGATGG + Intergenic
1062247722 9:135578049-135578071 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247791 9:135578395-135578417 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247860 9:135578741-135578763 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247967 9:135579329-135579351 ATGGGTGGATAGATGGTGGATGG - Intergenic
1062281291 9:135752904-135752926 ATGAGTGGATGGATGATGGATGG + Intronic
1062311459 9:135939888-135939910 CTGTGAGGAAAGAACGTGGACGG - Intronic
1062384507 9:136303841-136303863 CTGAGGGGAGAGCAGGTGCAAGG + Exonic
1062649860 9:137569898-137569920 GTGAGTGGATGGATGGTGGGTGG - Intronic
1185825710 X:3247266-3247288 CTCAGTGGAAAGCAGGTGAAGGG + Intergenic
1186762810 X:12740956-12740978 GTGATTGGAAAGTAGGTGGAAGG + Intergenic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1188605017 X:32017480-32017502 CTAAGTGGAAATAAGGGGGATGG + Intronic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189323632 X:40100384-40100406 GGGAGGGGATAGAAGGTGGCTGG - Intronic
1189853100 X:45196282-45196304 ATGGGTGGATGGATGGTGGATGG + Intronic
1191121786 X:56913907-56913929 CTGAATGGAGAAAAGCTGGAAGG - Intergenic
1192221615 X:69201068-69201090 GAGAGTGGATTGAAGGAGGACGG - Intergenic
1192234521 X:69287200-69287222 CAGAGTGGATGGAAAGTGCAAGG + Intergenic
1192316242 X:70053936-70053958 TAGAGTGGAGAGATGGTGGAGGG - Intergenic
1194187538 X:90791853-90791875 TTGGGTGGAGAGAAGGTGAAAGG - Intergenic
1194359317 X:92929340-92929362 CTGGCTGTAAAGAAGGTGGAAGG - Intergenic
1197149721 X:123206970-123206992 CTGAGTACATAGAAAGTGAAGGG - Intronic
1197979650 X:132201935-132201957 TTTAGTGGAAAAAAGGTGGAAGG + Intergenic
1199595727 X:149504690-149504712 ATGAATGGATAGAAGGTAAAAGG + Intronic
1200419824 Y:2952861-2952883 CTGAGGGGAGAGAATGGGGAGGG + Intronic
1200534128 Y:4373807-4373829 TTGGGTGGAGAGAAGGTGAAAGG - Intergenic
1200667512 Y:6045175-6045197 CTGGCTGTAAAGAAGGTGGAAGG - Intergenic