ID: 1140857872

View in Genome Browser
Species Human (GRCh38)
Location 16:78993676-78993698
Sequence TGTGGCTGCCACGGGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140857862_1140857872 14 Left 1140857862 16:78993639-78993661 CCATGGCTGTCTCTTAGTTTTGT 0: 1
1: 0
2: 1
3: 36
4: 374
Right 1140857872 16:78993676-78993698 TGTGGCTGCCACGGGGGGACAGG 0: 1
1: 0
2: 1
3: 25
4: 211
1140857860_1140857872 25 Left 1140857860 16:78993628-78993650 CCAGAGTGAGCCCATGGCTGTCT 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1140857872 16:78993676-78993698 TGTGGCTGCCACGGGGGGACAGG 0: 1
1: 0
2: 1
3: 25
4: 211
1140857861_1140857872 15 Left 1140857861 16:78993638-78993660 CCCATGGCTGTCTCTTAGTTTTG 0: 1
1: 0
2: 2
3: 30
4: 261
Right 1140857872 16:78993676-78993698 TGTGGCTGCCACGGGGGGACAGG 0: 1
1: 0
2: 1
3: 25
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140857872 Original CRISPR TGTGGCTGCCACGGGGGGAC AGG Intronic
900213533 1:1468779-1468801 GGTGGCTGCCACGGCGGGGCCGG + Exonic
900479332 1:2890432-2890454 TGTGGGTCCCACGGGGGGCCGGG + Intergenic
901006012 1:6171850-6171872 TGGGGCAGCCACGAGGGGCCAGG - Intronic
901886837 1:12229700-12229722 TGTGGCTGCGAAGTGGGGAACGG + Intergenic
902295443 1:15463620-15463642 TGTGGCTGCCTTGGAGAGACGGG + Intronic
902298333 1:15483498-15483520 TGTGGCTGCCTTGGAGAGACAGG + Intronic
905518578 1:38580132-38580154 CCTGGCTGCCACGTGGAGACTGG + Intergenic
906523312 1:46479708-46479730 TGTAGCTGACACGGGGGGAAAGG + Intergenic
911004051 1:93199406-93199428 TGTGGCTGACACCAGGGAACGGG + Intronic
911755025 1:101544091-101544113 TGTGTCTGCTACAGGGGGCCAGG + Intergenic
914506566 1:148295081-148295103 TGTGACAGCCAGGGGGGGAGAGG - Intergenic
915123915 1:153650066-153650088 TGTGTCTGCCACAGGCTGACTGG - Intergenic
917285624 1:173419006-173419028 TGTGGCCCCCACGGTGGGGCTGG + Intergenic
918220022 1:182428244-182428266 TGTGGCTGGCAGGGTGAGACTGG + Intergenic
920279296 1:204830726-204830748 TGTGGTTGCCACTGTGGAACAGG + Intronic
920877339 1:209849221-209849243 TCTGGCTGCCACGGAGGTAGCGG - Intronic
922110307 1:222549186-222549208 TGTTGCTCCCATGGTGGGACAGG + Intergenic
922236071 1:223723722-223723744 TGAGGCAGCCAGGGTGGGACAGG - Intronic
922718651 1:227889333-227889355 TGTGGCACCCACGGTGGGAAGGG + Intergenic
922767425 1:228163236-228163258 TGGGGCTGCCCGGGGGGTACCGG + Intergenic
924772673 1:247090285-247090307 TATGTCAGCCACTGGGGGACAGG + Intergenic
1063865584 10:10361946-10361968 TGCTGCTGCCACTGGGGGTCTGG - Intergenic
1064267254 10:13835021-13835043 TGAGGCTGCCAGGGGGTGGCCGG + Intronic
1065522054 10:26582659-26582681 TGTGGCTGGCATTGGGGGACAGG - Intergenic
1065956260 10:30696392-30696414 TGTGGCTGCCTCGTGGGGCATGG - Intergenic
1067044245 10:42975433-42975455 TGTGGCTGCAGCGTGGGGCCTGG - Intergenic
1067557496 10:47282960-47282982 TGTGCAGGCCACGGTGGGACTGG + Intergenic
1068209431 10:53901072-53901094 TGTTGCTGCCATGAGGTGACAGG - Intronic
1070790227 10:79184770-79184792 TGCGGCTGGCACAGGGGAACTGG - Intronic
1070807254 10:79277817-79277839 TGAGGCTGGCACAGGTGGACTGG - Intronic
1071399663 10:85256910-85256932 TCTGGCTGCTCCGGAGGGACTGG - Intergenic
1071469895 10:85976591-85976613 GGTGGATGCCACGGGGGCAAGGG - Intronic
1072938165 10:99732802-99732824 TGTAGCTGCCACGGCGGGGACGG + Intronic
1075721582 10:124590646-124590668 TGTTGGTGCCACTGTGGGACAGG - Intronic
1076542918 10:131225496-131225518 TGTGGATGCCACGGAGGCATCGG - Intronic
1077103953 11:833818-833840 TGTGTCTGCCACCGGGGGGCGGG - Intronic
1077108439 11:851760-851782 TGTTTCTGTGACGGGGGGACGGG + Intronic
1077168238 11:1153261-1153283 CTTGGCTACCACGGGGGGTCGGG + Intergenic
1077168822 11:1157464-1157486 TGTGGCTGCCTGGGAGGGAGAGG - Intergenic
1077225799 11:1438634-1438656 TGAGGCTGGCAAGGGGGAACAGG + Intronic
1078546588 11:12251631-12251653 TGTGGGTGCCACGGGGAGAAAGG + Intronic
1079083637 11:17430439-17430461 TGGGGCAGCCACGTGGGGACGGG + Intronic
1080868160 11:36213582-36213604 TGTGGCTGCCACTGTGGCAGAGG + Intronic
1081241670 11:40714105-40714127 TGTGGCTGGCAAGGTGGGGCTGG - Intronic
1084945466 11:72636008-72636030 GGGGGCTGCCACTGGGAGACAGG - Intronic
1085508823 11:77075022-77075044 TGTGGCTGCCACATGGGAAACGG - Intronic
1086955988 11:92934874-92934896 TCTGACTGCCACGTGGGAACAGG - Intergenic
1089056177 11:115586980-115587002 TGTGGCTGCCACAGGAGTCCAGG - Intergenic
1090621255 11:128562878-128562900 TGTGGCTGGCTGGAGGGGACAGG - Intronic
1091696945 12:2633998-2634020 TGTGGCCGCCCCGGGGAGCCGGG - Intronic
1094246878 12:28308409-28308431 AGTGGCTGCAATGGGGGGAATGG - Intronic
1094329159 12:29273443-29273465 TGTGGCTGCCACGGTGTGTAGGG + Intronic
1100726269 12:97412219-97412241 TGTGGCTGGCATGGGGTGACAGG - Intergenic
1101879405 12:108616325-108616347 TGAGGGTGCCACGGGGTGGCTGG - Intergenic
1102222445 12:111203739-111203761 TGTGGCCGCCAAGTGGGGAAGGG + Intronic
1104190749 12:126479946-126479968 TGTGGCTTCCAGGGAGGGGCAGG - Intergenic
1104649652 12:130522424-130522446 TGCGGGTGCCACGTGGGGACGGG + Intronic
1104884855 12:132100761-132100783 TCTGGCTGCCACTGAGGGCCAGG + Intronic
1105546982 13:21357933-21357955 AGTGGTTGCCAAGGGGGGAGCGG + Intergenic
1106462967 13:29989280-29989302 TGTGGCTGCCCCTGGCAGACAGG - Intergenic
1107688123 13:42924581-42924603 TGTGGCTGTCAGGGAGGGAGAGG - Intronic
1108705668 13:52983425-52983447 TGGGTGTGCCACGGGGGGGCGGG - Intergenic
1109484589 13:63002024-63002046 TGTGGCTGCCATGGGGGATGGGG - Intergenic
1110832310 13:80045445-80045467 TGTGGCTGCCACTGGAGGAATGG - Intergenic
1112329776 13:98468472-98468494 TGTGGCAGCGACAGGAGGACAGG + Intronic
1113146368 13:107212507-107212529 AGAGGCTGCCTCAGGGGGACAGG + Intronic
1113605512 13:111602323-111602345 TGTGGCAGCCGCAGGGGCACAGG - Intronic
1117018611 14:51546304-51546326 TGAGGCTGCCACGTGGAGACTGG - Intronic
1121234546 14:92382843-92382865 TGTGCCTGCCACTGGAGGGCAGG - Intronic
1121703204 14:95971889-95971911 CGGGGCCCCCACGGGGGGACTGG + Intergenic
1122140471 14:99660170-99660192 TGGGGCGGCCACGGAGGGAGGGG - Intronic
1122536429 14:102466832-102466854 AGTGGCTGCCATGGGCGGAGGGG - Intronic
1122551199 14:102550937-102550959 TGGGGCTGCCACTGTGGGCCTGG + Intergenic
1122884917 14:104706657-104706679 TTTGGCTGCCACGGCTGGGCAGG + Intronic
1123122681 14:105925327-105925349 TCTGGCTGCCACTCTGGGACGGG + Intronic
1123405328 15:20016753-20016775 TCTGGCTGCCACTCTGGGACGGG + Intergenic
1123514658 15:21023401-21023423 TCTGGCTGCCACTCTGGGACGGG + Intergenic
1124442369 15:29696510-29696532 TGCTGCTGCCCCTGGGGGACAGG - Intergenic
1124612019 15:31215580-31215602 TGTGGCTGACACCAGGGGGCAGG + Intergenic
1125510743 15:40291185-40291207 TGGGGAGGCCACGTGGGGACAGG + Intronic
1126436864 15:48645681-48645703 TGTGGGTGCCACAAGCGGACAGG - Exonic
1128968825 15:72087695-72087717 AATGGCTGCCACTGAGGGACTGG - Intronic
1130979447 15:88803023-88803045 TGAGGCCGCCGCGGCGGGACAGG - Intergenic
1131134706 15:89925017-89925039 GGTGGCTGCCTCTGGGGGACTGG + Intergenic
1132629396 16:909715-909737 CGCAGCTGCCCCGGGGGGACAGG + Intronic
1132703035 16:1230033-1230055 TGGAGCTGGGACGGGGGGACCGG + Intronic
1132705288 16:1240835-1240857 TGGAGCTGGGACGGGGGGACCGG - Intronic
1132708416 16:1256198-1256220 TGGAGCTGGGACGGGGGGACCGG - Exonic
1132749788 16:1452226-1452248 AGTGGGTGCCACGGCGGGAGTGG - Intronic
1132812192 16:1805870-1805892 AGTGGCAGCCACGTGGGCACAGG + Intronic
1133013613 16:2928876-2928898 TGTGGCTGCCTCGGCTGGTCGGG - Intronic
1133347632 16:5081135-5081157 TCTGGAGGCCACTGGGGGACGGG + Intronic
1136055070 16:27682440-27682462 TCTGGCTGCCACGTGGAGCCTGG + Intronic
1138190277 16:55008958-55008980 TGTGGCTGCAAGCGGGGGAGTGG + Intergenic
1138486799 16:57350549-57350571 GGTGGCTGCCAGGGTGGGTCTGG - Intergenic
1138583704 16:57957424-57957446 TGTGGCTGAAACGGGGAGGCTGG - Intronic
1139335618 16:66228882-66228904 TGTGGCTTTCACGGGGCTACAGG + Intergenic
1140857872 16:78993676-78993698 TGTGGCTGCCACGGGGGGACAGG + Intronic
1141606434 16:85156541-85156563 TGTGGCTGCCTCAGAGAGACGGG - Intergenic
1142234376 16:88914991-88915013 TGTGGCTGCCAGCCGGGGGCAGG + Intronic
1142279030 16:89138132-89138154 TGTGGAGGCCAAGTGGGGACCGG + Intronic
1142483006 17:229988-230010 TGTGGCTGTCAGGGGTGGTCAGG - Intronic
1144461005 17:15458622-15458644 CGTGGCTGTCACGGGGATACAGG - Intronic
1145814171 17:27783578-27783600 CGGAGCTGCCACGGAGGGACTGG - Intronic
1145991648 17:29082614-29082636 TGTGGCTGCTGAGTGGGGACAGG - Intronic
1148154370 17:45414261-45414283 TGTGCCTTCCACTGGGGGAGGGG - Intronic
1150249359 17:63697735-63697757 TGGGGCGGGCATGGGGGGACAGG - Exonic
1151124541 17:71830915-71830937 TTTGGCTGCCTCAGGGGGAGGGG - Intergenic
1151821469 17:76499356-76499378 GGTGGCTGGCACGGTGGGAGAGG - Intronic
1153826838 18:8882699-8882721 TGAGGCTGCCACAAGGGGGCGGG + Intergenic
1153999341 18:10470709-10470731 TGAGGCTGCAATGGGGGTACGGG - Intronic
1156886508 18:42141472-42141494 TGTGCCTGCCATTGGTGGACTGG + Intergenic
1158544900 18:58387931-58387953 TTTGGCTGCCACGGTGGGGGTGG - Intronic
1160038510 18:75322321-75322343 GGTGGCTGCCTGGGGGGCACTGG + Intergenic
1161470666 19:4455490-4455512 TGTGGCTGCCCAGGGGGGCAGGG - Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1163157236 19:15446135-15446157 TGTGGCTGCTGAGGGGGGCCAGG - Intronic
1163683884 19:18699834-18699856 ATTGGCTGCCATGTGGGGACAGG + Intronic
1163747710 19:19057949-19057971 TGTGGCAGCCACTGTGGGCCAGG + Exonic
1163782694 19:19258630-19258652 TGCGGCGGCCTGGGGGGGACCGG - Exonic
1163847659 19:19646563-19646585 TGTGGCTGCCATGGGGAGCCTGG - Intronic
1164949645 19:32326462-32326484 GGGGGCTGCCACTGGGGGACAGG + Intergenic
1165090430 19:33384979-33385001 TGTGTCTGTCACAGGGGAACAGG + Intergenic
1166626655 19:44363460-44363482 AGTGGTTGCCACTGGGGGAAGGG - Intronic
1166739342 19:45104603-45104625 TGTGGCTGCTAGGTGGGGAGCGG - Intronic
1167559187 19:50215195-50215217 TGTGGCTGGCAGGAGGGGCCAGG + Intronic
1168103152 19:54151765-54151787 TGTGACTGGCATGGGGTGACTGG - Intronic
925492744 2:4413041-4413063 TGGGGCTGCCGCAGGGGGAGAGG - Intergenic
926113408 2:10196606-10196628 TGTGGATCCCATGGGGGGCCGGG + Intronic
926809293 2:16742149-16742171 TGTGGCTCCCAGGAGGAGACTGG - Intergenic
927496707 2:23555973-23555995 TGTGGCTCTGAAGGGGGGACTGG + Intronic
927887656 2:26728564-26728586 TGTGACTGCCCCGAGGGGCCTGG + Exonic
927937659 2:27084585-27084607 TGGGGCTGCCAGCGGGGGTCAGG - Intronic
928099068 2:28424391-28424413 TTTGGCTGCAAAGTGGGGACTGG - Intergenic
928427436 2:31190876-31190898 TGTGGCCGCCAGGAGGGGTCAGG - Intronic
931213835 2:60223404-60223426 TGTGCCTGCCCCTGGGGGCCCGG + Intergenic
932334952 2:70925222-70925244 TCTGGCTGCCACTTGGGGAAGGG + Intronic
932503976 2:72211008-72211030 TGTGGCTGCCTGGAGGGAACCGG - Intronic
933782432 2:85811700-85811722 TGTGCCTGGCACGTGGGGGCAGG - Intergenic
934067090 2:88350555-88350577 TGGGGCGGCCACCGGGGGAGGGG - Intergenic
934730378 2:96652780-96652802 TCTGGCTGCCACGGGGAGCAGGG + Intergenic
935347243 2:102119949-102119971 GGTGGCTGCCAAGGAGGGAAGGG - Intronic
938546828 2:132340926-132340948 AGTGGTTGCCACTGGGGGAAGGG + Intergenic
940076362 2:149746598-149746620 GGTTGCTGCCACCGAGGGACTGG - Intergenic
946229844 2:218284442-218284464 TGTGGCAGCCACCGGGTGAAAGG + Intronic
947742402 2:232490698-232490720 TGTGGCGGCCACGGCGGCTCCGG - Intergenic
948265404 2:236632181-236632203 TGTGCCTGCTAGGCGGGGACTGG + Intergenic
948957409 2:241304454-241304476 TGTGGCTGCCTTCGGGGGATTGG - Intronic
1169491663 20:6076401-6076423 TGTGGGTGACACAGGGGGACAGG - Exonic
1171725867 20:28620531-28620553 TGGGGCTGGCATTGGGGGACAGG - Intergenic
1171875694 20:30573652-30573674 AGTGGTTGCCACTGGGGGAAGGG + Intergenic
1173736266 20:45363626-45363648 TGTGGCTGGCGCTGGTGGACGGG + Exonic
1174178242 20:48658281-48658303 TGTGGGGGCCACGGTGGGGCTGG - Intronic
1174287168 20:49481904-49481926 TGTGGCTGCCAAGGTGAGTCTGG - Exonic
1176144601 20:63559946-63559968 TGTGGCTGTCACGCGGGCCCAGG - Exonic
1176216163 20:63948915-63948937 TGTGGGTGTCACGGGTGCACGGG - Intronic
1176379565 21:6105335-6105357 TGTGGCTGCCATGCAGGGTCTGG - Intergenic
1176383178 21:6123930-6123952 TGTGGCTGCCGCAGGGGGAGGGG - Intergenic
1178913063 21:36692161-36692183 TTTGGCTTCCACCGGGGGAGCGG + Intergenic
1179719576 21:43307507-43307529 CGTGGCTGCCAGGGTGGGGCAGG + Intergenic
1179740289 21:43414309-43414331 TGTGGCTGCCGCAGGGGGAGGGG + Intergenic
1179743909 21:43432902-43432924 TGTGGCTGCCATGCAGGGTCTGG + Intergenic
1180637099 22:17269956-17269978 TGTGGCTGCCAGGAAGGCACTGG - Intergenic
1180868456 22:19133083-19133105 TGGGGCTGCCCCTGGAGGACAGG - Exonic
1180997438 22:19972442-19972464 TGTGGCAGCCAGGGGGGATCGGG + Intronic
1184372097 22:44089155-44089177 TGTGGCCTGCACGGGGGGCCAGG - Intronic
1184502643 22:44883122-44883144 TGTGGCTGCCACTGAGGGCTTGG + Exonic
1185270704 22:49928304-49928326 TGTGGCTGCCTCTGCGGGCCGGG - Intergenic
952331099 3:32365084-32365106 TCTGGCAGCCTCGGGGTGACAGG - Intronic
954132491 3:48567665-48567687 TGAGGGGGCCACGGGTGGACGGG - Intronic
954636925 3:52076054-52076076 TGAGGCAGCCAAGTGGGGACTGG - Intronic
958681361 3:97335929-97335951 TGTGGCTCCCATGCGGGAACTGG - Intronic
958839392 3:99185871-99185893 TGTGGCTGCTCCTGGGGGACGGG - Intergenic
959361745 3:105402706-105402728 TGTGGCTGCCATGGGGGATGGGG - Intronic
959815202 3:110666416-110666438 TGTGGCAGGCAGGGAGGGACAGG + Intergenic
961582030 3:127891185-127891207 TGAGGCTGCCACAAGGGGGCAGG - Intergenic
962740039 3:138356893-138356915 GGTGGGTGGGACGGGGGGACGGG - Intronic
967390482 3:188949412-188949434 TGTGGCTGCCATGGAAGGAGTGG - Intronic
968081470 3:195849518-195849540 TGGGGCTGCCCCGGGAGGCCCGG - Intergenic
968429643 4:549202-549224 TGTGTCTGCCAGCGGGGGCCGGG + Intergenic
968520022 4:1030991-1031013 TCTGGGTGGCACTGGGGGACTGG - Intergenic
968915048 4:3493652-3493674 TGTGGCTGCCACCGGAGGAAGGG + Exonic
968942291 4:3645082-3645104 TGTGGCAGGCTCGGGGGGAAGGG + Intergenic
969057383 4:4410194-4410216 TGTGGCTCCTGCGGTGGGACAGG - Intronic
970668527 4:18366929-18366951 TGTGTCTGCCATCAGGGGACTGG + Intergenic
974877212 4:67715027-67715049 TGGGGCTGTCACTGGGGGGCTGG - Intergenic
983574849 4:169249658-169249680 TGTGTCTCCAACGGGGGGATTGG - Intronic
986227383 5:5828421-5828443 TGTGGCTGCCATGGGGGTGTGGG - Intergenic
995123086 5:108555925-108555947 TCTGGCTGCCAAGTGGGGAAAGG + Intergenic
995148171 5:108810446-108810468 TCTGCCTGCCACTGGGCGACAGG - Intronic
997836342 5:137196278-137196300 TCTGGCTGCCATGTGGGGAATGG - Intronic
998004853 5:138649982-138650004 TGGGGCTGCCACAGGGGAGCAGG + Intronic
998716329 5:144889098-144889120 TGTGGCAGCCAAGGGAGTACTGG + Intergenic
998939085 5:147261102-147261124 TGAGGCTGCCACAAGGGGACGGG + Intronic
1002185506 5:177452976-177452998 AGTGGCAGCCATGGGGGCACTGG - Intronic
1002270783 5:178070657-178070679 AGTGACTGCCATGGGGTGACCGG + Intergenic
1002917236 6:1539141-1539163 TGTGGCAGCCACGGAGTGAGTGG - Intergenic
1003404705 6:5818784-5818806 AGTGGTTGCCAAGGGGGGAGTGG - Intergenic
1004241498 6:13925844-13925866 TGCGGTTGCCACTGGGGCACTGG + Intronic
1004300058 6:14449561-14449583 TGTGGCAGCCAAGGGGTGGCTGG - Intergenic
1011570003 6:88725194-88725216 TGAGGCTGCCACAAGGGGGCGGG - Intronic
1012769802 6:103417909-103417931 TCTGGCTGCTACGTGGGGAGGGG + Intergenic
1019360421 7:601871-601893 TGTGCCTGACCCGGGGGGGCTGG + Intronic
1020281069 7:6650240-6650262 TGTGGCTGCCAGTCGGGGAAGGG + Intronic
1020596529 7:10213650-10213672 TGTGGCTGCCACCTGGGCCCGGG - Intergenic
1022326585 7:29337608-29337630 CCAGGCTGCCACGGGGTGACAGG + Intronic
1023450528 7:40279377-40279399 TGTGGCTGAGACTGGGGGACAGG + Intronic
1023798115 7:43810732-43810754 TGAGGCTGCCACAAGGGGGCGGG - Intergenic
1024286659 7:47763596-47763618 TGTCGTGGCCACGGGAGGACCGG + Intronic
1024663117 7:51518710-51518732 TGTGACTGCCAATGTGGGACTGG - Intergenic
1029896663 7:103990248-103990270 TGTCGCTGCCGCGAGGGGCCGGG - Intergenic
1033235842 7:139637211-139637233 TGTGGCTGCCATGGAGGAAGTGG - Intronic
1035107681 7:156455867-156455889 TGTGGAGGCCACGGAGGCACAGG - Intergenic
1035556007 8:567748-567770 TGTGGCTGACGCAGGTGGACAGG + Intergenic
1039406749 8:37319342-37319364 TGTGGCTCCCACGTAGGAACTGG - Intergenic
1039455400 8:37702531-37702553 TGTGGCAGCCATGGGAGGAAGGG + Intergenic
1041280813 8:56210403-56210425 TGTGGCTGCGAGGGGGGGTAGGG - Intronic
1046002530 8:108438449-108438471 TGTGCCAGCAAAGGGGGGACTGG + Intergenic
1048328798 8:133458412-133458434 TGGGGCTGTCACTGGGGGTCTGG - Exonic
1049594793 8:143478318-143478340 TGTGGCTGCCCCTGGGGGAGGGG - Intronic
1054913568 9:70476054-70476076 TATGGCTTCCACGTGGGTACAGG - Intergenic
1056415033 9:86367421-86367443 TGAGGCCGCCACAAGGGGACGGG + Intergenic
1060423081 9:123483371-123483393 TCTGGCAGCCAAGGGAGGACTGG - Intronic
1060534757 9:124375939-124375961 TGTCCCTGCCACGGGGGCTCAGG - Intronic
1060656366 9:125375105-125375127 TGTGTCTGCCTCGGGGGGCCTGG - Intergenic
1060965798 9:127711760-127711782 TGTGTCTGCAGCTGGGGGACAGG + Intronic
1060990355 9:127845407-127845429 TCTGGCTGCCACGGGGGCCCAGG + Intronic
1061239794 9:129362920-129362942 AGAGGCTGCCATGGTGGGACGGG + Intergenic
1061590762 9:131596204-131596226 TGTGGCTGCCAGGAGGGGACAGG + Intronic
1062264823 9:135682125-135682147 GGTGGCAGCCACTGGGGGAGAGG - Intergenic
1062355120 9:136158246-136158268 TGTGGCAGCCCCGGGGACACTGG + Intergenic
1062372946 9:136249457-136249479 TGATGCTGCCATGCGGGGACAGG + Intergenic
1062599218 9:137312481-137312503 TGTGGCTGCCTCCTGGGGGCCGG + Intronic
1187325074 X:18278861-18278883 TGTGGCTGCCACTCGAGGAGAGG + Intronic
1187648291 X:21374025-21374047 GGTGGCGGCCACGGCGGGACGGG - Intergenic
1190997430 X:55623969-55623991 CCTGGCTGCCAAGGGGGCACAGG - Exonic
1199637234 X:149825607-149825629 TGAGGCTGCCACAAGGGGGCGGG - Intergenic
1201569092 Y:15395246-15395268 TGCGGCTGCCACCACGGGACAGG + Intergenic