ID: 1140863500

View in Genome Browser
Species Human (GRCh38)
Location 16:79039836-79039858
Sequence CTGACTCATCTCTACCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140863499_1140863500 16 Left 1140863499 16:79039797-79039819 CCTTTTTGCGTGCTCTTCTGTCT 0: 1
1: 0
2: 6
3: 89
4: 368
Right 1140863500 16:79039836-79039858 CTGACTCATCTCTACCAGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 108
1140863498_1140863500 27 Left 1140863498 16:79039786-79039808 CCTTCTCTGAACCTTTTTGCGTG 0: 1
1: 0
2: 2
3: 8
4: 177
Right 1140863500 16:79039836-79039858 CTGACTCATCTCTACCAGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 108
1140863497_1140863500 28 Left 1140863497 16:79039785-79039807 CCCTTCTCTGAACCTTTTTGCGT 0: 1
1: 0
2: 0
3: 16
4: 224
Right 1140863500 16:79039836-79039858 CTGACTCATCTCTACCAGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140863500 Original CRISPR CTGACTCATCTCTACCAGTC AGG Intronic
905397092 1:37673892-37673914 CTGACTCAGCTGTGCCACTCCGG - Intergenic
906606782 1:47178234-47178256 CAGACCCATCTGTACCAGCCTGG - Intergenic
907290838 1:53411886-53411908 CTGACCCATCTCCACCATCCAGG - Intergenic
907489825 1:54801623-54801645 CTGACTCAGCTCAAGCAGACAGG - Intergenic
909026400 1:70486965-70486987 CTTACCCATCTCTTGCAGTCTGG + Intergenic
910391425 1:86749065-86749087 CTGGCTCATTTTTTCCAGTCAGG + Intergenic
911096918 1:94062381-94062403 CTGACTCATCTGTGCCTGCCTGG + Intronic
915915072 1:159936072-159936094 GAGACTCATCTCTACCTCTCAGG - Intronic
1068600017 10:58946863-58946885 CTGACTTCTCTCTTCCAGTTTGG + Intergenic
1070314456 10:75296595-75296617 CTCATTCATCTCCACCAGGCTGG - Intergenic
1070809162 10:79288946-79288968 CTGCCTCCTCTCTACCAACCCGG - Intronic
1073082424 10:100868463-100868485 CTGACCCTTCTCCACCAGCCTGG - Intergenic
1075815545 10:125261940-125261962 CTTGCTCCTCTCAACCAGTCCGG + Intergenic
1081579056 11:44339508-44339530 CTGACTCCTCTCTCACAGTTAGG + Intergenic
1083540079 11:63506379-63506401 CTGACTCATCTGCCCCAGTCAGG - Exonic
1083603199 11:63961560-63961582 CAGACTCACCCCTACCAGGCTGG - Intergenic
1083763316 11:64830392-64830414 CTGACCCTTCTCTCCCAGTCTGG + Intronic
1083858152 11:65404140-65404162 CTGACCCAGCCCCACCAGTCAGG + Intronic
1084909458 11:72376154-72376176 CTTACCCATCCCTACAAGTCAGG + Intronic
1085726149 11:78956279-78956301 CTCACTCCTCCCTAACAGTCTGG - Intronic
1086435958 11:86781525-86781547 CTGACTCACCTCTACCCATAAGG - Intergenic
1088332326 11:108666448-108666470 CTCACTCATGTCACCCAGTCTGG - Intronic
1088345088 11:108814932-108814954 CTGCCTCATCTCTAACAAGCTGG - Intronic
1089075616 11:115736201-115736223 CTGACTAATGTCTACCCCTCAGG - Intergenic
1089969569 11:122681962-122681984 CTGACTCATCACTGCCACCCAGG + Intronic
1096694611 12:53340581-53340603 CTGACTCATCTCTCCCTCTGTGG + Intronic
1096717168 12:53498671-53498693 CTAACCCATCTCCCCCAGTCAGG - Intronic
1097083990 12:56454170-56454192 CTGATTCACCTGCACCAGTCAGG + Intronic
1098603789 12:72365373-72365395 CTGAATCATCTCTCCCAGGCAGG - Intronic
1100347641 12:93748094-93748116 CTGAATCTTCTCTACCATTCTGG - Intronic
1100800329 12:98224048-98224070 ATGCCCCATCTCTAACAGTCAGG + Intergenic
1101321343 12:103675846-103675868 CTGGCTCATCTCTAGCTGGCTGG + Intronic
1101462134 12:104906876-104906898 CTGACTCACCTTTACTACTCAGG + Intronic
1101498654 12:105280310-105280332 ATGACTTACCTCTGCCAGTCAGG - Intronic
1102460571 12:113097263-113097285 CTGTCTCTTCTCTTCCAGCCTGG - Exonic
1103359529 12:120345725-120345747 CTGACCTCTCTCTACCTGTCCGG + Intronic
1105223622 13:18357773-18357795 CTGACTCATCTTTTCCAGGTTGG + Intergenic
1110666041 13:78118524-78118546 CTGAGTCCTCTCTACCACTCTGG - Intergenic
1113793027 13:113040764-113040786 CTGGCTCCTCTCTACCAGTGGGG - Intronic
1118447851 14:65867981-65868003 CAGTCTCATCTCTACCACTCTGG - Intergenic
1118458320 14:65965061-65965083 CTGCCCCATCTGTACTAGTCAGG - Intronic
1118807928 14:69253877-69253899 CTTTCTCATCTCTACCTGACTGG + Intergenic
1119571326 14:75676050-75676072 GTGTCCCATCTCAACCAGTCAGG + Intronic
1120027902 14:79606511-79606533 CTGACTCATTTCAACCAGGATGG + Intronic
1121330577 14:93047046-93047068 CTGATTCTTCTCTCCCAGTTCGG - Intronic
1128739436 15:70073478-70073500 CTGATTCAACTCTAACATTCTGG - Intronic
1129603569 15:77013948-77013970 GTGACTCATTTCTTCCAGCCTGG + Intronic
1129877308 15:78984138-78984160 CTGTCTCATCTGGACCACTCTGG - Intronic
1137802961 16:51277874-51277896 CTGCTTCCTCTCTCCCAGTCTGG + Intergenic
1138405049 16:56785484-56785506 CTGACTCTTCACTATCAGCCAGG - Intronic
1140863500 16:79039836-79039858 CTGACTCATCTCTACCAGTCAGG + Intronic
1142088951 16:88199927-88199949 ATGACCCTTCTCTACCAGGCAGG + Intergenic
1143006997 17:3843514-3843536 GTGAGTCATCACAACCAGTCTGG + Intronic
1146072775 17:29699477-29699499 CTGCCTCATCTGTTCCGGTCTGG + Intronic
1146560655 17:33866703-33866725 CTGACTGATCTCTATATGTCAGG + Intronic
1147381613 17:40059708-40059730 CTTACACATCTCTAGCAGTTTGG - Intronic
1151509701 17:74550680-74550702 CTGGCCCAGCTCTACCAGACAGG - Intergenic
1153330117 18:3865089-3865111 CTGACTTATCTCTGTAAGTCTGG + Intronic
1154941105 18:21113619-21113641 TTCACTCTTGTCTACCAGTCTGG + Intergenic
1164542589 19:29132018-29132040 CTGACTCTTCTCAGGCAGTCAGG - Intergenic
1164710880 19:30356403-30356425 CTCACTCATCTGTACCAGGACGG - Intronic
1165410147 19:35654845-35654867 CTGATGCCTCTCAACCAGTCAGG + Intronic
1167634477 19:50646512-50646534 CTGACTCATCTCTGGCTCTCTGG - Intronic
927324262 2:21785081-21785103 CTGACCCACCTCTCCCAGTCTGG + Intergenic
929289928 2:40178394-40178416 CTCACTCATCTCCACCAGGCGGG + Exonic
931219936 2:60279975-60279997 CTGTTTCATCTTTACCACTCAGG - Intergenic
932216136 2:69967172-69967194 CTGATTCATCTCTCCAAGTGAGG - Intergenic
934780817 2:96968614-96968636 ATGACCCATGTCTACCAGCCAGG + Intronic
948535972 2:238647075-238647097 CTTACACATCTCCACCAGTCAGG + Intergenic
1175393433 20:58642212-58642234 CTGACTGATCTGTACGAGCCTGG - Intergenic
1176091546 20:63320618-63320640 CTGACTCATCTGCACCTGGCTGG - Intronic
1176732165 21:10510154-10510176 CTGACTCATCTTTTCCAGGTTGG + Intergenic
1179600393 21:42474004-42474026 CGGCCCCATCTCTCCCAGTCCGG + Intronic
1181346963 22:22226421-22226443 CTGACTTTTCTCCAGCAGTCTGG + Intergenic
1181589001 22:23871376-23871398 CTCACTCTTGTCTACCAGGCTGG - Intronic
1184963981 22:47953478-47953500 CTCACTCAACTCTACCATTTGGG + Intergenic
953790260 3:45942064-45942086 CTCACTCATTTGTACCAGTTTGG + Intronic
955272662 3:57517090-57517112 CTGGCTCCTTTCTACCATTCAGG + Intronic
957391953 3:79586422-79586444 CTGACTCATGTCAACAAGCCTGG - Intronic
960007183 3:112792230-112792252 CTGCTACATCTTTACCAGTCTGG - Intronic
960175700 3:114515266-114515288 CAGTTTCTTCTCTACCAGTCTGG + Intronic
965690688 3:171353616-171353638 CTGAGTCATCTCTTGTAGTCAGG - Intronic
980220974 4:129914527-129914549 CTGACTTATCTCTGCCAATATGG - Intergenic
981454529 4:144938048-144938070 CAGACACATCTCTATCAGTGAGG + Intergenic
981704572 4:147645837-147645859 ATGACTTATCTTTATCAGTCTGG - Intronic
982033814 4:151325930-151325952 CTGTCCCATCTCTCCCAGTTCGG - Intergenic
989107282 5:37875472-37875494 TGGACTCATTTCTACCATTCTGG + Intergenic
994278798 5:97874678-97874700 CTGACTCATCTGTACAACTTGGG - Intergenic
995480959 5:112592236-112592258 CTGCTTAATCTCTACCAGCCTGG + Intergenic
996654953 5:125924722-125924744 TTGACTCTTCTCTACCAGCAGGG - Intergenic
997841896 5:137248663-137248685 CTCACTCATCTCTATCTGTGCGG - Intronic
1006087228 6:31604724-31604746 CTGCCTCAGCTCTGCCAGGCTGG + Intergenic
1007776582 6:44227444-44227466 CTGACTCATAGCTACCTGGCTGG - Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020397223 7:7729946-7729968 CTGACTTCTCTCACCCAGTCTGG + Intronic
1021856647 7:24863559-24863581 CTGGCTCATTTCTACCAGGTAGG + Exonic
1027437718 7:78182585-78182607 CTGATTCATTCCTGCCAGTCTGG + Intronic
1028070768 7:86447306-86447328 CTGACTCATCTATGCTACTCAGG - Intergenic
1030855819 7:114555949-114555971 CTCCCTCATCTCTACCTGTCAGG + Intronic
1034597418 7:152211250-152211272 CTGACTCATCTTTTCCAGGTTGG - Intronic
1036210058 8:6834520-6834542 CTGTCTCAGCCCTTCCAGTCCGG + Intronic
1036747484 8:11420216-11420238 CTGACTCTGCCCTACCAGGCTGG + Intronic
1037449623 8:19003719-19003741 ATGACACATCTCTACCACACTGG + Intronic
1041075942 8:54169861-54169883 CTCACTCATGTCTCCCAGGCTGG - Intergenic
1041089010 8:54284559-54284581 CTCACTCATCTCTCCTAGGCTGG + Intergenic
1041745696 8:61207002-61207024 CTGGCCCATCTCTATCAGTCAGG + Intronic
1046235826 8:111423325-111423347 CTAAATCATCTCTACCAATGAGG - Intergenic
1046275572 8:111955628-111955650 CTGAGTTCTCTCTACCATTCAGG - Intergenic
1047797626 8:128274032-128274054 CTGACTCATCTCGAAAATTCAGG - Intergenic
1048153081 8:131913062-131913084 ATGACTCATCTCAACCTTTCAGG - Intronic
1049024593 8:139979878-139979900 CTGACTCCTCTCTGCCAGCTGGG + Intronic
1049062225 8:140285580-140285602 CTGTCTCATCTCTGCCACCCTGG + Intronic
1050317008 9:4412764-4412786 TTGACCATTCTCTACCAGTCAGG - Intergenic
1058154001 9:101491542-101491564 CTGATTCACATCTACCAGACAGG + Intronic
1058966446 9:110043345-110043367 CTGACTCCTCCCCACCACTCTGG + Intronic
1187358600 X:18602546-18602568 CTCACTAATCTCTTCCAGTTAGG - Intronic
1187559013 X:20382368-20382390 CTGACCCGTCTCTTCCAGCCAGG - Intergenic
1198891721 X:141403798-141403820 CTCACTCATTTGTACCATTCGGG + Intergenic
1199385154 X:147214800-147214822 CTGACTCTTCTCTAGTAGTTTGG - Intergenic
1200023229 X:153229551-153229573 CAGTTTCTTCTCTACCAGTCTGG + Intergenic