ID: 1140864810

View in Genome Browser
Species Human (GRCh38)
Location 16:79050608-79050630
Sequence CTCAAATACAAGTGCAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140864810_1140864811 -2 Left 1140864810 16:79050608-79050630 CCAAGACTGCACTTGTATTTGAG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1140864811 16:79050629-79050651 AGTTGCATAAGAAGCTGCTGAGG 0: 1
1: 0
2: 1
3: 15
4: 184
1140864810_1140864812 13 Left 1140864810 16:79050608-79050630 CCAAGACTGCACTTGTATTTGAG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1140864812 16:79050644-79050666 TGCTGAGGAATTTTAAGAACAGG 0: 1
1: 0
2: 2
3: 27
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140864810 Original CRISPR CTCAAATACAAGTGCAGTCT TGG (reversed) Intronic
903542383 1:24104158-24104180 CTCAAATGCAAGTGAAGTTTTGG + Intronic
908332177 1:63081838-63081860 CTCAAATTCAGGTGAAGTCCTGG - Intergenic
908425133 1:63999874-63999896 TTTAAAAACAAGTGAAGTCTTGG - Intronic
911104636 1:94120130-94120152 GTCATTTACAAGTACAGTCTTGG + Intronic
914862175 1:151396033-151396055 CTCACATACTAGTGCAGCCATGG + Intergenic
918823085 1:189284960-189284982 GTCAAATACAAGGAAAGTCTGGG - Intergenic
918935633 1:190916961-190916983 GACTAATACAAGTGCAATCTAGG + Intergenic
919313638 1:195944575-195944597 CTCAAATACCTTTGTAGTCTTGG - Intergenic
921325517 1:213983570-213983592 CTTAAGTACAAAGGCAGTCTCGG - Intronic
922925763 1:229345547-229345569 CACAAATATAAGGGCACTCTGGG + Intergenic
924123216 1:240823670-240823692 TTCAAATCCAAAGGCAGTCTGGG - Intronic
1064834600 10:19511983-19512005 CTCCAAAAGATGTGCAGTCTTGG + Intronic
1067315285 10:45155683-45155705 CTCAAAGACAAGTGCATTGGAGG - Intergenic
1071576817 10:86733201-86733223 CTGAAGTACAATTCCAGTCTTGG - Exonic
1071932981 10:90495193-90495215 CTCTTATACAAGTCCAGTCTTGG - Intergenic
1072242487 10:93509779-93509801 CTCAAATATAAGTTCTGGCTGGG - Intronic
1072627083 10:97119503-97119525 CTCAAATCCGAGCGCAGTCAGGG + Intronic
1086094925 11:83040822-83040844 GTCAAATACATCTCCAGTCTGGG - Intronic
1086492162 11:87366458-87366480 CTCAAAGACAAGGGCAGGTTGGG - Intergenic
1090049846 11:123368297-123368319 CTAGAATATTAGTGCAGTCTAGG - Intergenic
1093564225 12:20582779-20582801 CTCAAAAACAAGTGCACTGGTGG + Intronic
1096599680 12:52720730-52720752 CTCAAATACAAATTCAGCTTGGG + Intergenic
1101272613 12:103163456-103163478 CTCAAACACAAGGGCAGTCCTGG - Intronic
1101488387 12:105189481-105189503 ATCACATTCAAATGCAGTCTTGG - Intronic
1103200825 12:119086591-119086613 CACAGAGGCAAGTGCAGTCTGGG + Intronic
1109757979 13:66787109-66787131 CACAAAAATAAGTGCAGACTAGG - Intronic
1113005576 13:105698285-105698307 CTTAAATACAACTTCAGTGTAGG + Intergenic
1113639431 13:111946568-111946590 CAAAAATAAAAGTGCAGGCTGGG + Intergenic
1114993969 14:28323578-28323600 CAGAAATATAAGTGCAGTCATGG + Intergenic
1116247203 14:42430730-42430752 CTCAAATACATCTTCTGTCTGGG + Intergenic
1119028684 14:71174575-71174597 CTCATTTTCAAGTGAAGTCTTGG + Intergenic
1120690956 14:87591859-87591881 CTCAAATAAACGTGCATTCTTGG - Intergenic
1121797654 14:96748507-96748529 CTCTATGACAAGTGCATTCTAGG + Intergenic
1127358638 15:58225836-58225858 CTCAAACTCCAGTGCAGTCATGG + Intronic
1127598278 15:60509408-60509430 CTCACTTTCCAGTGCAGTCTGGG - Intronic
1128000958 15:64191353-64191375 CTCAAAAACAAATGCAGGCTGGG - Intronic
1128439690 15:67694149-67694171 TTCAAAGACCAGTGCAGACTTGG + Intronic
1131793859 15:95993316-95993338 CTTAAATACAAATGCAGGATGGG + Intergenic
1131953217 15:97704236-97704258 CTCCAAAACCAGTTCAGTCTTGG + Intergenic
1135912209 16:26571770-26571792 CTAAAATACAAGGGCAGGATAGG + Intergenic
1138205479 16:55121321-55121343 GGAAAATACAAGTGCATTCTGGG + Intergenic
1139012998 16:62656469-62656491 CTCACATACATGTGCAGGGTAGG - Intergenic
1140864810 16:79050608-79050630 CTCAAATACAAGTGCAGTCTTGG - Intronic
1157348653 18:46864473-46864495 CTAAAATACTAATGCAGGCTGGG + Intronic
1157740480 18:50088416-50088438 CTTAAATACAAGTGCAGCACTGG + Intronic
1163817914 19:19478250-19478272 CACAAATCCAACTGCTGTCTGGG - Intronic
1165918519 19:39276855-39276877 CACAAGTACAAGACCAGTCTGGG + Intergenic
1167082166 19:47284015-47284037 CTCAAGTTCAAGACCAGTCTGGG + Intergenic
927675090 2:25099386-25099408 TTCAAATACAAAGGCAGCCTTGG - Intronic
929347246 2:40899745-40899767 CTCAACTGCAAATGCAGCCTAGG - Intergenic
933315939 2:80715196-80715218 CTCAAATGCCACTGGAGTCTTGG - Intergenic
937123072 2:119454148-119454170 CTGAAACAGAAGTGCTGTCTGGG + Intronic
942957544 2:181791063-181791085 CTAAAAGACAAATGCAGTCAGGG + Intergenic
948289335 2:236813718-236813740 CTGAAATCCAAGTGCAGCCCTGG + Intergenic
948341180 2:237253535-237253557 GTGAAATACAAGTACAGCCTTGG + Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1172127269 20:32632136-32632158 CTCAAATGCAAGCCCAGGCTGGG - Intergenic
1174046013 20:47733997-47734019 CTGAAGGACAAGTGAAGTCTAGG - Intronic
1175868644 20:62195991-62196013 TTCAAATGCACATGCAGTCTCGG - Intronic
1177550254 21:22611558-22611580 GTTAAATACAAGTACACTCTTGG + Intergenic
1182878089 22:33709489-33709511 TTTAAATCCAAGTGCAGTCTTGG - Intronic
1184385958 22:44174824-44174846 CTCAAATATAACTGCCGTCCGGG + Intronic
1184540643 22:45121923-45121945 CTCAAATGAAATTGCATTCTGGG + Intergenic
1184934290 22:47707736-47707758 CTTAAAAAAAAGTGCAGTTTTGG - Intergenic
953225417 3:41014560-41014582 CTCAAATGCAAATGGAGACTTGG + Intergenic
954866164 3:53731891-53731913 CTCAAATACAGATGCAGCTTTGG + Intronic
958413349 3:93845523-93845545 CTCAAAGACAAATACACTCTTGG - Intergenic
959945236 3:112119085-112119107 GTCAAAAACAAAGGCAGTCTGGG + Intronic
960541404 3:118865960-118865982 CTCAAGTGGAAGTGCAGCCTAGG + Intergenic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
961798564 3:129427317-129427339 CACAAAGACAAATCCAGTCTTGG - Intronic
962394864 3:135006619-135006641 CAAAAGTTCAAGTGCAGTCTGGG + Intronic
968014106 3:195312117-195312139 CTTGATTACAAGAGCAGTCTGGG - Intronic
970707120 4:18817382-18817404 CTCAAACACAAGATAAGTCTTGG + Intergenic
970810316 4:20085753-20085775 CTCAAATGCATGTAGAGTCTAGG + Intergenic
974600926 4:64078242-64078264 CTCAAAACCAAATGCAGCCTTGG + Intergenic
980550785 4:134331388-134331410 CTCACATACAAGTACACTCATGG - Intergenic
981822516 4:148902163-148902185 CTTAAATACAAAGTCAGTCTAGG - Intergenic
987400254 5:17468009-17468031 CTCAATTCCAACTGCTGTCTTGG - Intergenic
988290752 5:29282491-29282513 CTCAAATACTAGTACAGCATAGG - Intergenic
988779533 5:34507557-34507579 GTCAAAAACATGTGCAGTCATGG - Intergenic
989129365 5:38090810-38090832 CTCAATTTCATGTTCAGTCTTGG - Intergenic
992896285 5:81247932-81247954 CTCAGACACAAGGGCAGTATTGG + Intronic
994325879 5:98443969-98443991 CTCAAATTGAAGTAGAGTCTGGG + Intergenic
996584121 5:125065792-125065814 GGCAAATACAATTGAAGTCTTGG - Intergenic
997706341 5:135957063-135957085 AAGAAATAAAAGTGCAGTCTAGG + Intergenic
1000444313 5:161301195-161301217 CTCAATTACGAGTTCTGTCTTGG + Intronic
1000839804 5:166204146-166204168 TTCAAATACAGTTGCAGTTTGGG + Intergenic
1002463140 5:179386864-179386886 CTGAAAAAAAAGTGCACTCTTGG - Intergenic
1004657691 6:17680156-17680178 CTGAAATAAAAGTCCTGTCTGGG + Intronic
1010813914 6:80332284-80332306 TGTAAATACAAGTGCAGTATAGG - Intronic
1010934556 6:81845806-81845828 CTCAAGGACAAGTCCATTCTGGG - Intergenic
1011551406 6:88534151-88534173 TTGAAAGACAAGTGCAGCCTGGG - Intergenic
1011579822 6:88848999-88849021 CTTTAATACATGTTCAGTCTGGG - Intronic
1012903864 6:105041205-105041227 CTAAAATCCAATTGCAGGCTAGG - Intronic
1013924874 6:115459808-115459830 CTAAAATACAAGTGCTGATTGGG + Intergenic
1014039268 6:116805952-116805974 CAGAAATACAACTGCAGTCTGGG - Intronic
1015996448 6:138999599-138999621 CTCAACTCCAAATGCAGCCTGGG - Intergenic
1020869668 7:13611647-13611669 ATCAAATAAAAGTGCAATTTAGG - Intergenic
1028914959 7:96248639-96248661 CTCAATCACGAGTTCAGTCTGGG + Intronic
1029436271 7:100565727-100565749 CCCACATACGAGAGCAGTCTGGG - Exonic
1031064639 7:117091874-117091896 CTCAATTGCAAGTTCAGTCAGGG + Intronic
1033222530 7:139537940-139537962 TTCAAATACAAGTGTATTGTAGG + Intronic
1034301525 7:150019727-150019749 CCCAAATGCCAGTGAAGTCTAGG - Intergenic
1034804521 7:154077541-154077563 CCCAAATGCCAGTGAAGTCTAGG + Intronic
1039106147 8:33991970-33991992 CTAAACTTCAAGTGCATTCTGGG - Intergenic
1039226931 8:35398588-35398610 CTCAAATACAACTTCAATGTGGG - Intronic
1039556549 8:38480205-38480227 CTGGAATGCAGGTGCAGTCTTGG + Intergenic
1040985674 8:53291624-53291646 CTCAAATTCAAGTGCTTACTAGG + Intergenic
1042110142 8:65372820-65372842 CTCAAAAGCAATTGCAGGCTGGG + Intergenic
1042838049 8:73095184-73095206 AGCAAAGACAAGTGCAGTTTTGG + Intronic
1043031383 8:75137550-75137572 CTCAAATATAAGTGGAGTTGTGG + Intergenic
1043463054 8:80479907-80479929 TTCAAAAAGATGTGCAGTCTTGG - Intergenic
1047342344 8:123994270-123994292 CTCAAAGACAGGTGGGGTCTGGG + Intronic
1047441755 8:124885005-124885027 CTCAATTCCAAATGCAGCCTGGG + Intergenic
1055600062 9:77907235-77907257 CTTAATTACCACTGCAGTCTTGG - Intronic
1060503234 9:124179111-124179133 CTCAAATACTTGGGCATTCTTGG + Intergenic
1186421654 X:9431766-9431788 TTTAAAAACAAGTGCAGCCTGGG + Intergenic
1189608581 X:42706657-42706679 CTTACATACAAGTCCAGTGTGGG + Intergenic
1189867436 X:45345880-45345902 CTCAAATAAAAGTGCAGCATTGG + Intergenic
1194495230 X:94608207-94608229 GTCAAAAACAAGTGCACTGTAGG + Intergenic
1194830941 X:98621366-98621388 CACAAATATATGTGGAGTCTTGG - Intergenic
1195098815 X:101533095-101533117 GTCAATTACAAATGGAGTCTGGG - Intronic
1201267445 Y:12221705-12221727 TCCAAATATAAGTGCAGGCTAGG + Intergenic